scholarly journals First report of grapevine rupestris vein feathering virus in grapevines from Washington State

Plant Disease ◽  
2020 ◽  
Author(s):  
Nomatter Chingandu ◽  
Sridhar Jarugula ◽  
Jati Adiputra ◽  
Basavaraj Bagewadi ◽  
Raphael Olayemi Adegbola ◽  
...  
Keyword(s):  
New Zealand ◽  
De Novo ◽  
Salt Lake ◽  
Salt Lake City ◽  
Washington State ◽  
Australian Isolate ◽  
Total Rna ◽  
First Report ◽  
Hop Stunt Viroid ◽  
Blastn Analysis

Since the first report of grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) in a Greek grapevine causing chlorotic discoloration of leaf veins (El Beaino et al., 2001), GRVFV was reported in some European countries, and in Australia, China, Korea, New Zealand, Uruguay, and Canada (Blouin et al., 2017; Cho et al., 2018; Reynard et al., 2017). In the USA, the virus was reported only from California in vines showing Syrah decline symptoms (Al Rwahnih et al., 2009). During virus surveys conducted between 2015 and 2019, 424 samples (petioles from individual or composite of five vines, with 4 petioles/vine) with and without discernible symptoms were collected randomly from 39 Vitis vinifera cultivars in vineyards and nurseries in eastern Washington State. Total RNA was isolated from these samples separately using SpectrumTM Plant Total RNA Kit (Sigma-Aldrich) and subjected individually to Illumina RNAseq (Huntsman Cancer Institute, Salt Lake City, UT). An average of ~28 million 120-base pair (bp) paired-end reads using HiSeq2500 platform and an average of ~18 million 145-bp paired-end reads using Novaseq 6000 platform were obtained per sample. The contigs from de novo assembly of quality-filtered reads from each sample (CLC Genomics workbench 12) were subjected to BLASTn analysis against the virus database from GenBank. In addition to grapevine viruses and viroids previously reported in Washington State, GRVFV-specific sequences were obtained in samples from 11 of the 39 cultivars; namely, Muscat Ottonel, Pinot gris and Sangiovese from vineyards and Aglianico, Bonarda, Cabernet Sauvignon, Chardonnay, Garnacha Tinta, Riesling, Tempranillo and Valdiguie from nurseries. BLASTn analysis of the 73 GRVFV-specific contigs, ranging in size between 500 nt and 6474 nt, showed sequence identity between 79.4% and 95.5% with GRVFV sequences deposited in GenBank. The data also revealed that GRVFV was always present as coinfection with one or more viruses and viroids (grapevine leafroll-associated virus 3, grapevine red blotch virus, grapevine virus A and B, grapevine rupestris stem pitting-associated virus, hop stunt viroid and grapevine yellow speckle viroid 1) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5’- TACAAGGTGAATTGCTCCACAC -3’) and SaR-1027 (5’-TCATTGGCGATGCGTTCG-3’) to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT782070) showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084811.1) to 90.9% (738 bp out of 813 bp) with an isolate from New Zealand (MF000326.1). Additional studies are in progress to examine the etiology, genetic diversity and impact of GRVFV in Washington vineyards.

scholarly journals First Report of Grapevine yellow speckle viroid 1 and Hop stunt viroid in Grapevine (Vitis vinifera) in New Zealand

Plant Disease ◽  
2011 ◽  
Vol 95 (5) ◽  
pp. 617-617 ◽  
Author(s):  
L. I. Ward ◽  
G. M. Burnip ◽  
L. W. Liefting ◽  
S. J. Harper ◽  
G. R. G. Clover
Keyword(s):  
United States ◽  
New Zealand ◽  
Vitis Vinifera ◽  
Complete Genome ◽  
Consensus Sequence ◽  
The United States ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Blastn Analysis

In February 2009, grapevines (Vitis vinifera) in a commercial vineyard in Auckland were showing shortened, spindly canes with tiny leaves. Approximately 10% of the vines were affected. An RNeasy Plant Mini Kit (Qiagen, Valencia, CA) was used to isolate total RNA from leaves collected from six symptomatic (cvs. BAC0022A and Syrah) and eight symptomless vines (cvs. BAC0022A, Syrah, and Chardonnay). RNA was tested by reverse transcription-PCR for the presence of Australian grapevine viroid, Citrus exocortis viroid, Grapevine yellow speckle viroid 1 (GYSVd-1), Grapevine yellow speckle viroid 2, and Hop stunt viroid (HSVd). Four of the six symptomatic and all the symptomless vines tested positive for GYSVd-1 using primers 5′-TGTGGTTCCTGTGGTTTCAC-3′ and 5′-ACCACAAGCAAGAAGATCCG-3′, which amplify the complete genome (368 bp), and published primers PBCVd100C/194H (3), which amplify a 220-bp region of the genome. Amplicons from each PCR were transformed into a pCR 4-TOPO vector (Invitrogen, Carlsbad, CA), cloned, and sequenced. Sequence from both PCRs aligned identically to generate a consensus sequence (GenBank Accession No. HQ447056), which showed 99% nt identity to GYSVd-1 (GenBank No. X87906) by BLASTN analysis. All symptomatic and symptomless vines also tested positive for HSVd using primers C/H-HSVd (4) and HSVd-C60/H79 (1), which amplify the complete genome (298 bp). Amplicons from each isolate were cloned and sequenced. Sequence from both PCRs were aligned. Clones from all isolates, with the exception of one, aligned identically to create a consensus sequence (GenBank No. HQ447057) that showed 99% nt identity to Chinese HSVd isolates from grapevine (GenBank Nos. DQ371436–59) by BLASTN analysis. Sequence from the remaining isolate (GenBank No. HQ447056) was identical to a German Riesling grape isolate of HSVd (GenBank No. X06873). The presence of each viroid was further confirmed in PCR-positive plants by dot-blot hybridization with digoxigenin-labeled synthetic ssRNA probes specific to the full-length genomes of GYSVd-1 and HSVd (S. Harper and L. Ward, unpublished data). To our knowledge, this is the first report of GYSVd-1 and HSVd in V. vinifera in New Zealand. Since both viroids were detected in symptomatic and symptomless plants, the symptoms observed in the vineyard cannot be attributed to viroid infection. Symptoms described for GYSVd-1 include leaf spots and flecks, but no disease symptoms have been reported in grapes as a result of HSVd (2). Viruses found in the vines include Grapevine leaf roll virus-3, Grapevine viruses A and B, and Rupestris stem pitting associated virus, but these are not thought to be the cause of the symptoms. Two sequence types of HSVd were found, suggesting at least two separate introductions of HSVd into the vineyard. The vineyard is more than 40 years old so both viroids may have been present for some years. Export of wine from New Zealand was worth 1 billion dollars in 2009, so there is potential for these viroids to have an economic impact if symptoms are expressed. HSVd has been reported from China, Europe, Japan, Middle East, Pakistan, and the United States. GYSVd-1 has been reported from Australia, China, East Mediterranean, Europe, Japan, and the United States. References: (1) A. Hadidi et al. Acta Hortic. 309:339, 1992. (2) A. Hadidi et al., eds. Viroids. CSIRO Publishing, Collingwood, Australia, 2003. (3) R. Nakaune and M. Nakano. J. Virol. Methods 134:244, 2006. (4) A. M. Shamoul et al. J. Virol. Methods 105:115, 2002.

scholarly journals First report of Apple rubodvirus 2 infecting pear (Pyrus communis) in South Africa

Plant Disease ◽  
2021 ◽  
Author(s):  
Kayleigh Bougard ◽  
Hans Jacob Maree ◽  
Gerhard Pietersen ◽  
Julia Christine Meitz-Hopkins ◽  
Rachelle Bester
Keyword(s):  
South Africa ◽  
De Novo ◽  
Rna Extraction ◽  
Pyrus Communis ◽  
Cold Sensitivity ◽  
Total Rna ◽  
First Report ◽  
Sequencing Library ◽  
Blastn Analysis ◽  
Tree Branch

Apple rubbery wood virus 2 (ARWV-2; Rott et al., 2018) belong to the species Apple rubodvirus 2, a member of the genus Rubodvirus (family Phenuiviridae; Kuhn et al 2020). ARWV-2 was first identified in apples and is associated with apple rubbery wood disease (ARWD) that is characterized by unusual flexibility of stems and branches, reduced growth, shortened internodes and increased cold sensitivity (Jakovljevic et al., 2017, Rott et al., 2018). ARWD was first reported in 1935 in England on apple and has since been found on quince and pear (Jakovljevic et al., 2017; Rott et al., 2018). In January 2021, leaves were collected from a pear tree (Pyrus communis cv. Forelle, F514) in a commercial orchard near Villiersdorp, South Africa. The tree displayed no foliar or tree branch symptoms, except for malformed fruits potentially due to insect feeding damage or pear stony pit disease previously associated with infection of apple stem pitting virus (ASPV) (Paunovic et al. 1999). Leaf petioles (one gram) were used for total RNA extraction, using a modified CTAB extraction protocol (Ruiz-García et al. 2019). A sequencing library was constructed (Illumina TruSeq Stranded Total RNA with plant Ribo-Zero) and sequenced on an Illumina HiseqX instrument (Macrogen, South Korea). A total of 30,709,182 paired-end reads (100 nt) were obtained and trimmed for quality with Trimmomatic (SLIDINGWINDOW:3:20, MINLEN:20) (Bolger et al. 2014). De novo assembly, using default parameters of CLC Genomics Workbench 11.0.1 (Qiagen), resulted in 97,294 contigs. BLASTn analysis identified 17 viral contigs, with 14 contigs having high nucleotide identity to ASPV and three to ARWV-2. The latter contigs included all three segments of ARWV-2. The L contig was 7371 nts, M was 1289 nts and S was 1463 nts in length, generated with 7341, 626 and 9161 reads for segment L, M and S, respectively. Segment S had the highest read coverage (524.87x), followed by segment L (88.07x) and M (36.60x). The ARWV-2 GenBank accessions with the highest percentage identity to the contigs were MF062128.1 from United States of America (98.2% to segment L), MN163134.1 from China (97.5% to segment M) and NC_055535.1 from Germany (93.5% to segment S). The contigs spanned 100%, 80.92% and 100% of these accessions of segments L, M and S, respectively and were deposited in GenBank as accessions MZ593725- MZ593727. Reverse transcription polymerase chain reaction (RT-PCR) was used to validate the presence of ARWV-2 in sample F514, using primers directed at segments L (con708_178F/con708_666R), M (ARWaV-2S1_38F/ARWaV-2S1_682R) and S (ARWaV-2M567F/ARWaV-2M1342R) (Rott et al., 2018). Amplicon sequences (510 bp (L), 645 bp (M) and 799 bp (S)) were confirmed with bi-directional Sanger sequencing. Fifty-nine additional pear samples were surveyed in 2021 for ARWV-2 using the M segment assay as mentioned above. The survey included the Koue Bokkeveld and Elgin areas, and cultivars Bosc (22 samples), Abate (10 samples), Rosemarie (3 samples), Forelle (9 samples), Packham’s Triumph (12 samples) and Early Bon Chretien (3 samples). A total of 27 samples (11 samples from the Koue Bokkeveld region and 16 samples from the Elgin region) tested positive for ARWV-2, demonstrating the common presence of this virus in pears in South Africa. This is the first report of ARWV-2 infecting pear in South Africa. Although no association with disease symptoms were observed, this study expands the data on the incidence and distribution of this virus in South Africa.

scholarly journals First Report of Bean common mosaic virus in Cudrania tricuspidata in Korea

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 292-292 ◽  
Author(s):  
J.-K. Seo ◽  
M. Kang ◽  
O. J. Shin ◽  
H.-R. Kwak ◽  
M.-K. Kim ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Large Scale ◽  
De Novo ◽  
Bean Common Mosaic Virus ◽  
Deciduous Tree ◽  
Root Bark ◽  
Genome Database ◽  
Cudrania Tricuspidata ◽  
Total Rna ◽  
First Report

Cudrania tricuspidata (Moraceae) is a deciduous tree widely distributed in East Asia, including China, Korea, and Japan. It produces delicious fruit, and its cortex and root bark have been used as a traditional medicine to treat neuritis and inflammation. As C. tricuspidata has become known as a functional food, its cultivation area and production gradually have increased in Korea. However, information of viral disease in C. tricuspidata is very limited. In September 2012, open-field-grown C. tricuspidata trees showing virus-like symptoms of mosaic, yellowing, and distortion on the leaves were found in Naju, Korea. The fruit production in the diseased trees decreased to 20 to 40% of that in healthy trees. To identify causal agent(s), total RNA was isolated from the symptomatic leaves and used to generate a transcriptome library using the TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA) according to the manufacturer's instruction. The transcriptome library was analyzed by next-generation sequencing (NGS) using an Illumina HiSeq2000 sequencer. NGS reads were quality filtered and de novo assembled by the Trinity pipeline, and the assembled contigs were analyzed against the viral reference genome database in Genbank by BLASTn and BLASTx searches (3). The entire NGS procedure was perofrmed by Macrogen Inc. (Seoul, South Korea). Among the analyzed contigs, one large contig (10,043 bp) was of viral origin. Nucleotide blast searches showed that the contig has a maximum identity of 89% (with 100% coverage) to the isolate MS1 (Genbank Accession No. EU761198) of Bean common mosaic virus (BCMV), which was isolated from Macroptilium atropurpureum in Australia. The presence of BCMV was confirmed by a commercially available double-antibody sandwich (DAS)-ELISA kit (Agdia, Elkhart, IN). To confirm the BCMV sequence obtained by NGS, two large fragments covering the entire BCMV genome were amplified by reverse transcription-polymerase chain reaction (RT-PCR) using two sets of specific primers (5′-AAAATAAAACAACTCATAAAGACAAC-3′ and 5′-AGACTGTGTCCCAGAGCATTTC-3′ to amplify the 5′ half of the BCMV genome; 5′-GCATCCTGAGATTCACAGAATTC-3′ and 5′-GGAACAACAAACATTGCCGTAG-3′ to amplify the 3′ half of the BCMV genome) and sequenced. To obtain the complete genome sequence, the 5′ and 3′ terminal sequences were analyzed by the 5′ and 3′ rapid amplification of cDNA ends (RACE) method as described previously (1). The assembled full-length sequence of BCMV isolated from C. tricuspidata was 10,051 nucleotides in length without a poly(A) tail. It was deposited in Genbank under the accession number KM076650. BCMV, a member of the genus Potyvirus, is one of the most common viruses naturally infecting legumes, including Phaseolus vulgaris (2). In general, BCMV is known to have a restricted host range outside legume species (2). Therefore, the identification of BCMV from C. tricuspidata in this report is very exceptional. Because BCMV is easily transmitted by various aphids like other potyviruses, a large-scale survey may be required for exact investigation of the BCMV incidence in C. tricuspidata to prevent rapid spread of the virus. To the best of our knowledge, this is the first report of BCMV in C. tricuspidata. References: (1) H.-R. Kwak et al. Plant Pathol. J. 29:274, 2013. (2) M. Saiz et al. Virus Res. 31:39, 1994. (3) S.-E. Schelhorn et al. PLoS Comput. Biol. 9:e1003228, 2013.

scholarly journals First Report of Potato spindle tuber viroid in Cape Gooseberry in Slovenia

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 150-150 ◽  
Author(s):  
M. Viršček Marn ◽  
I. Mavrič Pleško
Keyword(s):  
New Zealand ◽  
Sequence Analysis ◽  
Unknown Origin ◽  
Potato Spindle Tuber Viroid ◽  
Adult Plant ◽  
Total Rna ◽  
First Report ◽  
Physalis Peruviana ◽  
Plant Pathol ◽  
Cape Gooseberry

Cape gooseberry (Physalis peruviana) was first reported as a host of Potato spindle tuber viroid (PSTVd) in 2009 (4). In Slovenia, 10 young plants of cape gooseberry that were grown in a glasshouse were inspected in April 2011. Plants were multiplied from an adult plant of unknown origin. During sampling, the inspected plants showed no disease symptoms. Total RNA was extracted twice from leaves of five plants with an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). Reverse transcription (RT)-PCR assay employing two pairs of semi-universal pospiviroid primers (Pospi1-RE/FW and Vid-RE/FW [3]) yielded amplicons of the expected size (approximately 196 and 360 bp) from each total RNA preparation. All four DNA products were sequenced directly (Macrogen, Amsterdam, the Netherlands). Sequence analysis confirmed the identity of a viroid as PSTVd. Further RT-PCRs using primer pairs of Shamloul et al. (2) and Di Serio (1) were made to obtain a full viroid sequence. The sequence was deposited in the NCBI GenBank under Accession No. JN543964. Sequence analysis confirmed the identity of the viroid as PSTVd. The Slovenian isolate had 358 nucleotides and was 100% identical to the cape gooseberry isolate from Germany (GenBank Accession No. EU862231) and the tomato isolate from New Zealand (GenBank Accession No. AF369530). The analyzed sample was the only sample of cape gooseberry taken from the start of the survey for PSTVd in 2006 because P. peruviana is rarely grown in Slovenia. To our knowledge, this is the first report of PSTVd infection of P. peruviana in Slovenia and the fourth reported case after the detection of PSTVd infection in Germany, Turkey, and New Zealand. This emerging host for PSTVd could potentially serve as a source of infection for tomato and potato, where the viroid can cause severe losses. References: (1) F. Di Serio. J. Plant Pathol. 89:297, 2007. (2) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (3) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004. (4) J. Th. J. Verhoeven et al. Plant Dis. 93:316, 2009.

scholarly journals First Report of Actinidia virus A and Actinidia virus B on Kiwifruit in China

Plant Disease ◽  
2014 ◽  
Vol 98 (11) ◽  
pp. 1590-1590 ◽  
Author(s):  
Y. Z. Zheng ◽  
G. P. Wang ◽  
N. Hong ◽  
J. F. Zhou ◽  
Z. K. Yang ◽  
...  
Keyword(s):  
New Zealand ◽  
Rna Binding ◽  
De Novo ◽  
Central China ◽  
Rt Pcr ◽  
First Report ◽  
Sequence Contigs ◽  
Leaf Vein ◽  
Symptomless Plant ◽  
Encoding Gene

At present, two viruses affecting kiwifruit (Actinidia spp.), Actinidia virus A (AcVA) and Actinidia virus B (AcVB), both belonging to the genus Vitivirus in the family Betaflexiviridae, have been reported from New Zealand (2). The infected trees showed leaf vein chlorosis, flecking, and ringspots. China is the largest commercial kiwifruit producer. During field investigations in the growing season of 2013, symptoms of leaf chlorosis or ringspots, similar to those caused by AcVA and AcVB (1), were observed on some kiwifruit (Actinidia chinensis) plants in Hubei Province in the central China. Leaf samples were collected from three symptomatic and two symptomless plants of two A. chinensis cultivars. Total nucleic acids were extracted from the samples using a CTAB-based protocol described by Li et al. (3) and used as template in RT-PCR for the detection of AcVA and AcVB. Each virus was detected using two sets of primers reported by Blouin et al. (1). Primer sets AcVA 1F/1R and AcVA5F/5R were used for the AcVA detection, and AcVB1F/1R and AcVB5F/Viti3'R were used for the AcVB detection. AcVA was detected in three symptomatic plants (ID: Ac-HN-1, Ac-HN-3, and Ac-HN-5), and AcVB was detected in two symptomatic plants (ID: Ac-HN-1 and Ac-HN-3) and in one symptomless plant (ID: Ac-HN-2). Neither virus was detected in the second symptomless plant (ID: Ac-HN-4). Samples Ac-HN-1 and Ac-HN-3 had mixed infection of AcVA and AcVB, and sample Ac-HN-2 had the latent infection of AcVB. The sequenced 283-bp RT-PCR amplicons of the replicase-encoding gene from AcVA isolates AC-HN-3 and AC-HN-5 using AcVA1F/1R shared 90.8% nucleotide (nt) identity with the corresponding sequence of the New Zealand AcVA isolate (GenBank Accession No. JN427014.1). The 269-bp fragments of the RNA-binding protein-encoding gene obtained by using AcVA5F/5R shared 85.5 to 85.9% nt identities with the corresponding sequence of JN427014.1. The AcVB5F/Viti3'R products of 365 to 369 bp from three AcVB isolates shared 85.5 to 88.6% nt identities with the corresponding sequence of the New Zealand AcVB isolate. The representative sequences were submitted to GenBank with accession numbers KJ696776 and KJ696777 for the 269-bp fragments of AcVA-HN-1 and AcVA-HN-3, and KJ696778 and KJ696779 for the 365-bp and 369-bp fragments of AcVB-HN-1 and AcVB-HN-2, respectively. In addition, 12 and 14 out of 42 kiwi samples (excluding HN-1 to HN-5) collected randomly were positive for AcVA and AcVB as detected by RT-PCR. Meanwhile, the sample affected by AcVA-HN-5 was subjected to deep sequencing of the small RNAs (sRNAs) for complete survey of the infecting viruses. De novo assembly of sRNAs generated four sequence contigs, with lengths ranging from 161 to 285 nt, matching to ORFs 1 to 3 of the genome of the New Zealand AcVA isolate with significant nucleotide (91 to 95%) and amino acid (80 to 94%) similarities, and some other contigs from a new virus (unpublished). The result further confirmed AcVA infection in the kiwi plant. To our knowledge, this is the first report of both AcVA and AcVB outside of New Zealand. The Chinese isolates of the two viruses are distinct from those reported from New Zealand. The results provide valuable information for improving the viral sanitary status of the kiwifruit germplasm in China. References: (1) A. G. Blouin et al. Arch. Virol. 157:713, 2012. (2) A. G. Blouin et al. J. Plant Pathol. 95:221, 2013. (3) R. Li et al. J. Virol. Methods 154:48, 2008.

scholarly journals First report of grapevine virus L infecting grapevine in southeast France

Plant Disease ◽  
2022 ◽  
Author(s):  
Laurence Svanella ◽  
Armelle Marais ◽  
Thierry Candresse ◽  
Marie Lefebvre ◽  
Jerome Lluch ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Protein Gene ◽  
The United States ◽  
Read Length ◽  
Nucleic Acid Binding ◽  
Grapevine Virus ◽  
Total Rna ◽  
First Report ◽  
Grapevine Virus A ◽  
Hop Stunt Viroid

Grapevine virus L (GVL) is a recently described vitivirus (family Betaflexiviridae) with a positive-sense single-stranded RNA genome. It has so far been reported from China, Croatia, New-Zealand, the United States and Tunisia (Debat et al. 2019; Diaz-Lara et al. 2019; Alabi et al. 2020; Ben Amar et al. 2020). It has significant genetic variability (up to 26% of nucleotide divergence between isolates) and the existence of four phylogroups has been proposed (Alabi et al. 2020). In the frame of a project investigating the possible links between grapevine trunk diseases and grapevine virome, viral high throughput sequencing (HTS)-based testing was performed on symptomatic and asymptomatic grapevines collected in July 2019 in vineyards of four areas in France (Bourgogne, Charentes, Gard, Gironde) corresponding to five cultivars of Vitis vinifera (Cabernet franc, Cabernet Sauvignon, Chardonnay, Sauvignon, Ugni blanc). Total RNAs were purified from powder of 105 trunk wood samples using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, Saint-Quentin-Fallavier, France) and RNA-seq libraries were prepared using Zymo-Seq RiboFree Total RNA Library Prep Kit (Ozyme, Saint Cyr l’Ecole, France). HTS was performed on a S4 lane of Illumina NovaSeq 6000 using a paired-end read length of 2x150 bp. The trimmed sequence reads obtained from Chardonnay plants CH30-75M (99.9 M) and CH37-19S (114 M) from a vineyard in Gard were analyzed using CLC Genomics Workbench v21 (Qiagen, Courtaboeuf, France) and revealed complex mixed infections. Besides contigs representing a complete GVL genome (average scaffold coverage: 6,197x and 2,970x, respectively), contigs from grapevine rupestris stem pitting virus (1,697x ; 1,124x), grapevine virus A (82x ; 95x), grapevine pinot gris virus (1,475x ; 866x), grapevine leafroll-associated virus 3 (5,122x ; 1,042x), hop stunt viroid (13,783x ; 29,514x) and grapevine yellow speckle viroid 1 (690x ; 1158x) were also identified. Plant CH37-19S was also co-infected by grapevine rupestris vein feathering virus (164x). The GVL contigs integrated respectively 320,000 and 152,000 reads (corresponding to 0.32% and 0.11% of filtered/trimmed reads, respectively). The GVL genomic sequences from each sample (7,616 nt) have been deposited in GenBank (Accession nos. OK042110 and OK042111, respectively). The two contigs are nearly identical (99.9% nt identity) and share respectively 97.5% and 95.9% with GVL-KA from the USA (MH643739) and GVL-RS from China (MH248020), the closest isolates present in GenBank. To confirm the presence of GVL, the original grapevines were resampled in the field and total RNAs were extracted as described above from cambial scrappings and leaves. Total RNAs were used for RT-PCR tests using primers targeting a 279-bp fragment corresponding to the 3’ end of the coat protein gene and part of the nucleic acid binding protein gene (Debat et al. 2019). The Sanger-derived sequences from the amplicons shared 100% nt identities with the corresponding sequences of the HTS assembled genomes, confirming the presence of GVL in both tissues of both grapevine samples. To our knowledge, this represents the first report of the occurrence of GVL in vineyards in France. Given the complex mixed infection present in the two analyzed grapevines, no conclusions can be drawn on the pathogenicity of GVL. Further efforts are needed to better understand GVL distribution and its potential pathogenicity to grapevine. References Alabi, O J., et al. 2020. Arch. of Virol. 165:1905-1909. Ben Amar, A., et al. 2020. Plant disease 104:3274. Debat, H., et al. 2019. Eur J Plant Pathol. 155:319. Diaz-Lara, A., et al. 2019. Arch. of Virol. 164:2573. Acknowledgments The authors are grateful to the “Plan National Dépérissement du Vignoble” (Mycovir project) for the financial support

scholarly journals First report of grapevine virus H (GVH) in grapevine in Greece

Plant Disease ◽  
2021 ◽  
Author(s):  
Polina Panailidou ◽  
Leonidas Lotos ◽  
Chrysoula-Lyto Sassalou ◽  
E. Gagiano ◽  
Gerhard Pietersen ◽  
...  
Keyword(s):  
Sanger Sequencing ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Virus Genome ◽  
Composite Sample ◽  
Grapevine Virus ◽  
Northern Greece ◽  
Total Rna ◽  
First Report ◽  
The Usa

Grapevine virus H (GVH) is a member of the genus Vitivirus in the family Betaflexiviridae (subfamily Trivirinae, order Tymovirales) that infects grapevine (Candresse et al., 2018). GVH was first identified in a symptomless grapevine of an unknown cultivar from Portugal in 2018 (Candresse et al. 2018), and since then the virus has been reported only from California (Diaz‑Lara et al. 2019). Several vitiviruses have been detected in Greek vineyards (Avgelis and Roubos 2000; Dovas and Katis 2003a; 2003b; Panailidou et al. 2019; Lotos et al. 2020), but no information was available on the presence of GVH. In the fall of 2020, in order to investigate the virome of a commercial vineyard of the cultivar Assyrtiko in northern Greece, a composite sample was made of leaves and petioles from nine vines exhibiting leafroll disease symptoms. Total RNA was extracted from the composite sample according to the protocol of White et al. (2008) and subjected to rRNA depletion, library construction (TruSeq Stranded Total RNA kit), and high-throughput sequencing (HTS) in a NovaSeq6000 platform (Illumina Inc.) at Macrogen (Korea). The resulting ~42 million 101-nt paired-end reads were analyzed in Geneious Prime 2020, and the assembled de novo contigs were subjected to a local BLASTn search, which revealed the presence of 18 grapevine infecting viruses and viroids, among which also a GVH-like contig (GeA-9). GeA-9 was 7,404 nucleotides (nt) long, covering 99.4% of the full virus genome and shared 98.2 % nt identity with a GVH isolate from the USA (MN716768). To confirm the presence of GVH, the nine samples of the cultivar Assyrtiko, used initially to produce the composite sample for HTS analysis, were tested individually by RT-PCR, using the primers GVH_F_2504 (5’-CTGCTTCGCTGAACATATGC-3’) and GVH_R_2835 (5’-ATCATTRTGATCGAGAGAGTAGTG-3’) that amplify a 331-nt segment of ORF1. GVH was detected in five out of the nine tested samples and one of these was reamplified and subjected to Sanger sequencing. The fragment of ORF1 obtained by Sanger sequencing (MW460005) was 97.5% identical to the nucleotide sequence of the corresponding GVH-like de novo contig (GeA-9) from HTS analysis and it shared 97.2% nt identity with GVH sequences reported from Portugal and USA, respectively (NC_040545 and MN716768), confirming the presence of GVH in the tested samples. This is the first report of GVH in grapevine in Greece, thus further increasing the number of vitiviruses known to infect Greek vineyards and also expanding the number of geographic locations in which GVH is recorded so far.

scholarly journals First report of Coguvirus eburi infecting pear (Pyrus communis) in South Africa

Plant Disease ◽  
2021 ◽  
Author(s):  
Kayleigh Bougard ◽  
Hans Jacob Maree ◽  
Gerhard Pietersen ◽  
Julia Christine Meitz-Hopkins ◽  
Rachelle Bester
Keyword(s):  
South Africa ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Rna Extraction ◽  
Pyrus Communis ◽  
Rt Pcr ◽  
Disease Symptoms ◽  
Total Rna ◽  
First Report ◽  
Pcr Assays

Coguvirus eburi is a member of the genus Coguvirus in the family Phenuviridae (Khun et al., 2020). The species Coguvirus eburi was established to include citrus virus A (CiVA), which is a negative-sense, single-stranded RNA virus that was first found infecting sweet orange in southern Italy via high-throughput sequencing (HTS) (Navarro et al., 2018). This virus was also found to infect pome fruits in France, such as pear (Svanella-Dumas et al., 2019). More recently CiVA infections have been associated with impietratura disease in citrus (Beris et al. 2021). In the summer of 2021, leaf samples were collected from a pear tree (Pyrus communis cv. Bosc, B175) in the Koue Bokkeveld, South Africa as part of a virus survey. Sample B175 displayed no visual disease symptoms. One gram of leaf petioles was used for total RNA extraction, using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA was prepared (Ribo-Zero Plant kit) and a sequencing library constructed (Illumina TruSeq Stranded Total RNA). The RNA library was paired-end (2 × 100 bp) sequenced on an Illumina HiSeqX instrument (Macrogen, South Korea). A total of 47,750,152 reads were obtained. Raw data was trimmed for quality with Trimmomatic (SLIDINGWINDOW:3:20, MINLEN:20) (Bolger et al. 2014). De novo assembly performed with CLC Genomics Workbench 11.0.1 (Qiagen) (Default parameters) using high quality reads yielded 75250 contigs. BLASTn analysis identified two viral contigs with high nucleotide (nt) identity to apple stem pitting virus (ASPV) and CiVA. The CiVA contig was 9400 nts and on closer examination, a concatemer of CiVA RNA1 and RNA2. The concatenation occurred due to the characteristic near-identical nucleotides shared at the 5’ and 3’ ends of RNA1 and RNA2 of these negative-stranded RNA viruses (Navarro et al., 2018). After splitting and curation, the RNA1 contig was 6664 nts and the RNA2 contig 2686 nts. A total of 51397 and 34820 reads were used to construct these contigs resulting in an average depth of coverage of 761 and 1281 for RNA1 and RNA2, respectively. The contigs had the highest nt identity to the complete CiVA GenBank accessions MT720885.1 (95.53%) and MW148460.1 (96.03%), spanning 99.6% and 98.1 % of the genomes of RNA1 and RNA2, respectively. These contigs were submitted as partial genomes to GenBank as accessions MZ463039 and MZ463040. Reverse transcription polymerase chain reaction (RT-PCR) was used to validate the presence of CiVA in sample B175. Two RT-PCR assays, directed at RNA1 and RNA2 respectively (Bester et al. (2021)) were used to generate amplicons. Amplicon sequences were confirmed with bi-directional Sanger sequencing. Twenty-one additional samples from the same orchard as B175 as well as other samples from the Koue Bokkeveld and Elgin areas, including cultivars Abate (10 samples), Forelle (10 samples), Early Bon Chretien (3 samples), Packham’s Triumph (12 samples) and Rosemarie (3 samples), were all surveyed for CiVA using the same RT-PCR assays as mentioned above. Thirty-six of the 59 samples tested were positive for CiVA, which further confirms the presence and wide-spread distribution of this virus in the limited survey conducted in pears in South Africa. However, no association with any disease symptoms or specific cultivar were identified. This is the first report of CiVA infecting pear in South Africa. This study therefore contributed to investigating the distribution of this virus and will assist the South African plant material certification scheme to assess the incidence of CiVA in South Africa.

scholarly journals First report of Soybean Mosaic Virus in commercially grown soybean in the Netherlands

Plant Disease ◽  
2021 ◽  
Author(s):  
Sietske van Bentum ◽  
Petra J van Bekkum ◽  
Peter A Strijk ◽  
Johan A van Pelt ◽  
Peter A.H.M. Bakker ◽  
...  
Keyword(s):  
The Netherlands ◽  
Mosaic Virus ◽  
De Novo ◽  
Soybean Mosaic Virus ◽  
Reference Sequence ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Consensus Sequences ◽  
Field Samples

In July 2020, plants with crinkled, chlorotic, occasionally necrotic leaves, typical for Soybean Mosaic Virus (SMV), were observed in eight soybean fields (Glycine max L.) in Flevoland, The Netherlands (Supp. Fig. 1). Disease incidence varied from 5-50% and the plants affected often occurred in small or extensive patches. Leaves from several symptomatic plants were sampled from each of two fields planted with soybean variety Green Shell or Summer Shell. Total RNA was extracted from one plant leaf sample per field using InviTrap Spin Plant RNA Mini Kit (Invitek, Germany). One-tube RT-PCRs employing potyvirus generic primers P9502 and CPUP (Van der Vlugt et al, 1999) and SMV-specific primers SMV-dT (5’-TTTTTTTTTTTTTTTAGGACAAC-3’) and SMV-Nib-Fw (5’-CAAGGATGARTTTAAGGAG-3’) combined with Sanger sequencing confirmed the presence of SMV in all leaf samples. To exclude the presence of other agents in the samples, total RNA from each cultivar was used in standard Illumina library preparation with ribosomal RNA depletion followed by sequencing on an Illumina NovaSeq6000 (paired-end, 150 bp) which yielded 66,579,158 reads (Summer Shell) and 223,953,206 reads (Green Shell). After quality trimming in CLC Genomics Workbench 20.0.4 (CLC-GWB; Qiagen, Hilden), four million reads were randomly sampled for de novo assembly. Contigs over 500 nucleotides (nts) in length with a minimum of 500 reads were annotated by BLASTn against NCBI GenBank. This identified one contig of 9,883 nts (6,233,397 reads) in Summer Shell and one contig of 9,727 nts (3,139,927 reads) in Green Shell with clear homology to SMV (E-value = 0.0). No other viruses were identified in the datasets. Reference assemblies against the SMV reference sequence (NC_002634) mapped 24,090,763 reads (36.2%) for Summer Shell and 175,459,637 reads (78.3%) for Green Shell. Extracted consensus sequences for SMV in both soybean cultivars were 9,584 nts long (excluding the poly-A tail). Sequence data from the de novo and reference assemblies were combined into consensus sequences which showed over 98% overall nt sequence identity to NC_002634 and 99.6% to each other. Both consensus sequences were deposited in GenBank under accession numbers MW822167 (SMV-Summer Shell) and MW822168 (SMV-Green Shell). In addition, the presence of SMV in the field samples was confirmed with an inoculation assay. Leaf samples from both fields were ground in phosphate buffer (0.1M, pH 7.2) and inoculated on cotyledons and first expanded leaves of soybean plants (unknown cv.) 12 days post-germination. Plants showed veinal chlorosis in systemic leaves from 12 days post-inoculation, which developed into veinal necrosis. SMV infections were confirmed by RT-PCR in systemic, chlorotic leaf samples of all symptomatic plants using the SMV-specific primers described above. To our knowledge, this is the first report of SMV in The Netherlands. As soybean is a relatively new but expanding crop in this country, information about emerging diseases is highly relevant. SMV can be transmitted via seeds and aphids, where seeds can serve as primary source of virus inoculum (Cui et al., 2011; Hartman et al., 2016; Hajimorad et al., 2018). Weeds and non-commercial plants can also serve as origin of SMV, particularly in subsequent growing seasons, although this virus infects a limited host range of six plant families (Cui et al., 2011; Hill & Whitham, 2014). Special monitoring would be advised for the recurrence and possible damage by SMV in Dutch soybean fields.

scholarly journals First report of Tobacco ringspot virus in highbush blueberry in Washington State

Plant Disease ◽  
2021 ◽  
Author(s):  
Arunabha Mitra ◽  
Sridhar Jarugula ◽  
Gwen Hoheisel ◽  
Naidu Rayapati
Keyword(s):  
South Korea ◽  
Vaccinium Corymbosum ◽  
Washington State ◽  
Ringspot Virus ◽  
Highbush Blueberry ◽  
Korean Isolate ◽  
Total Rna ◽  
First Report ◽  
Tobacco Ringspot Virus ◽  
Cherry Leaf Roll Virus

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Sign in / Sign up

Export Citation Format

Share Document