scholarly journals First Report of Tomato chlorosis virus in China

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1123-1123 ◽  
Author(s):  
R. N. Zhao ◽  
R. Wang ◽  
N. Wang ◽  
Z. F. Fan ◽  
T. Zhou ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Mainland China ◽  
Economic Losses ◽  
Degenerate Primers ◽  
First Report ◽  
Sequence Identity ◽  
Cp Gene ◽  
Specific Fragment ◽  
Tomato Chlorosis Virus ◽  
Beijing China

In October 2012, a severe yellowing disease was found on greenhouse and plastic house tomato (Solanum lycopersicum) plants in Beijing, China. The disease incidence varied from 5 to 80% in each of six fields across Haidian and Daxing districts. The lower leaves showed symptoms of interveinal chlorosis, leaf brittleness, and limited brown necrotic flecks, similar to symptoms induced by Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV) (two members of genus Crinivirus, family Closteroviridae) (4). A large number of whiteflies (Bemisia tabaci) were also observed. Leaf samples were taken from eight symptomatic and two asymptomatic tomato plants in two plastic houses in the Haidian district and total RNA was isolated from the 10 samples using TRIzol reagent (Tiangen, Beijing, China). Nested reverse transcription (RT)-PCR was performed to test the presence of ToCV and TICV with degenerate primers HS-11 and HS-12 and specific primers ToC-5/ToC-6 or TIC-3/TIC-4 for ToCV or TICV, respectively (1). With ToCV primers, a 463-bp specific fragment was amplified from eight symptomatic samples but not from two asymptomatic samples, and there was no amplification with TICV primers from any sample. Sequence analysis of the amplified fragment showed 99% nucleotide sequence identity with the heat shock protein 70 homolog (HSP70h) gene of ToCV isolates from Japan (GenBank Accession No. AB513442), Spain (DQ136146), Florida (AY903448), and Greece (EU284744). The presence of ToCV was confirmed by amplification of a 848-bp fragment covering the coat protein (CP) gene of ToCV with primers CP-F (5′-GAATCTTTTAGAAGCTTTGGTTTAAGG-3′) and CP-R (5′-GATCCTCTTGATCCTCATAGATTTC-3′) (3). The CP had 97 to 99% amino acid sequence identity to the above-mentioned four ToCV isolates. A sequence of the CP gene obtained from one isolate was deposited at GenBank (KC311375). Additionally, virions were isolated from 25 g of symptomatic samples followed Klaassen's method (2) and their lengths were estimated to be about 800 to 850 nm by transmission electronic microscopy To our knowledge, this is the first report of ToCV on tomato in mainland China. Tomato is one of the most widely cultivated crops in China and the spread of ToCV in China may cause significant economic losses. Further information on the prevalence and incidence of ToCV is required to assess the potential impact of this virus. References: (1) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (2) V. A. Klaassen et al. J. Gen. Virol. 75:1525, 1994. (3) H. Tomoki et al. J. Gen. Plant Pathol. 76:168, 2010. (4) G. C. Wisler et al. Phytopathology 88:402, 1998.

scholarly journals First Report of Natural Infection of Zucchini by Tomato Chlorosis Virus and Cucurbit Chlorotic Yellows Virus in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xiaohui Sun ◽  
Ning Qiao ◽  
Xianping Zhang ◽  
Lianyi Zang ◽  
Dan Zhao ◽  
...  
Keyword(s):  
Natural Infection ◽  
Pcr Analysis ◽  
Control Group ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Specific Primers ◽  
First Report ◽  
Sequence Identity ◽  
Tomato Chlorosis Virus ◽  
Cucurbit Chlorotic Yellows Virus

Zucchini (Cucurbita pepo) is an extensively cultivated and important economic cucurbit crop in China. In September 2018 and 2019, interveinal chlorosis and yellowing symptoms, suspected to be caused by either tomato chlorosis virus (ToCV; genus Crinivirus) or cucurbit chlorotic yellows virus (CCYV; genus Crinivirus) or by their co-infection, were observed on zucchini plants in a greenhouse in Shandong Province, China. The incidence of the disease in the greenhouse was 20–30%. To identify the causal agent(s) of the disease, leaf samples from 66 zucchini plants were collected in 14 greenhouses in the cities of Shouguang (n = 12), Dezhou (n = 36), Qingzhou (n = 12), and Zibo (n = 6) in Shandong. Four whitefly (Bemisia tabaci) samples and four symptomatic tomato samples were also collected from these sampling sites (one each for each site) because numerous whiteflies were observed in the sampling greenhouses and ToCV was previously reported in greenhouse tomato plants from these regions (Zhao et al. 2014). To determine whether the symptoms were associated with Crinivirus infection, reverse transcription polymerase chain reaction (RT-PCR) using Crinivirus-specific degenerate primers (CriniRdRp251F/CriniRdRp995R) (Wintermantel and Hladky 2010) was performed first on total RNA extracted using the TRIzol protocol (Jordon-Thaden et al. 2015). Thereafter, the RNA samples were subjected to RT-PCR with ToCV- or CCYV-specific primers (Sun et al. 2016; Gan et al. 2019). Of the 66 zucchini samples, 54 tested positive by the degenerate crinivirus primer pair; and among them, 10 tested positive for ToCV only, 40 positive for CCYV only, and 4 positive for both viruses. Interestingly, while both viruses were detected in all B. tabaci samples, only ToCV was detected in the tomato samples (n = 4). To confirm the identity of the viruses, the amplicons of ToCV (four samples each of tomato, B. tabaci and zucchini) and CCYV (four samples each of B. tabaci and zucchini) were Sanger sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China) after cloning into pMD18-T vectors (Takara, Shiga, Japan). BLASTn analysis demonstrated that all sequences were identical to their respective amplicons. The ToCV sequences (GenBank accession numbers: tomato, MN944406; B. tabaci, MN944404; zucchini, MN944405) shared 100% sequence identity with isolates from Beijing (KT751008, KC887999, KR184675, and KP335046), Hebei (KP217196), and Shandong (KX900412). The CCYV sequence (GenBank accession number MT396249) shared 99.9% sequence identity with isolates China (JN126046, JQ904629, KP896506, KX118632, KY400633, and MK568545), Greece (LT716000, LT716001, LT716002, LT716005, and LT716006), and Cyprus (LT992909, LT992910, and LT992911). To assess the transmissibility of ToCV and CCYV, virus-free B. tabaci (n = 30) were placed in ToCV or CCYV-infected zucchini plants for one day for virus acquisition. Thereafter, the whiteflies were transferred into virus-free zucchini seedlings (cv. ‘Zaoqingyidai’, 4-leaf-stage, n = 6 for each of the control, ToCV and CCYV treatment) for one day. Three weeks after inoculation, all plants that were inoculated with either ToCV or CCYV displayed same symptoms as those observed in the greenhouses, whereas plants in the control group remained symptom free. RT-PCR analysis using ToCV- and CCYV-specific primers confirmed the infection of the plants with the respective virus, whereas control plants were free from the viruses. CCYV has been previously reported on zucchini in Algeria (Kheireddine et al. 2020), Iran (LR585225), and Cyprus (LT992910). To our knowledge, this is the first report of CCYV infection in zucchini in China, and moreover the first report of ToCV infection in zucchini in the world. Clearly, stringent management is needed to minimize the losses caused by these viruses in greenhouse operations in the region.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of Tomato chlorosis virus Infecting Tomato in Georgia

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 881-881 ◽  
Author(s):  
S. Sundaraj ◽  
R. Srinivasan ◽  
C. G. Webster ◽  
S. Adkins ◽  
K. Perry ◽  
...  
Keyword(s):  
Nucleic Acid Hybridization ◽  
N Gene ◽  
Natural Occurrence ◽  
Rt Pcr ◽  
Specific Primers ◽  
Tomato Production ◽  
First Report ◽  
Interveinal Chlorosis ◽  
Cp Gene ◽  
Tomato Chlorosis Virus

Tomato yellow leaf curl virus (TYLCV) and Tomato spotted wilt virus (TSWV) are prevalent in field-grown tomato (Solanum lycopersicum) production in Georgia. Typical TYLCV symptoms were observed during varietal trials in fall 2009 and 2010 to screen genotypes against TYLCV at the Coastal Plain Experiment Station, Tifton, GA. However, foliar symptoms atypical of TYLCV including interveinal chlorosis, purpling, brittleness, and mottling on upper and middle leaves and bronzing and intense interveinal chlorosis on lower leaves were also observed. Heavy whitefly (Bemisia tabaci (Gennadius), B biotype) infestation was also observed on all tomato genotypes. Preliminary tests (PCR and nucleic acid hybridization) in fall 2009 indicated the presence of TYLCV, TSWV, Cucumber mosaic virus, and Tomato chlorosis virus (ToCV); all with the exception of ToCV have been reported in Georgia. Sixteen additional symptomatic leaf samples were randomly collected in fall 2010 and the preliminary results from 2009 were used to guide testing. DNA and RNA were individually extracted using commercially available kits and used for PCR testing for ToCV, TYLCV, and TSWV. Reverse transcription (RT)-PCR with ToCV CP gene specific primers (4) produced approximately 750-bp amplicons from nine of the 16 leaf samples. Four of the nine CP gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 100.0% identical with each other (GenBank Accession Nos. HQ879840 to HQ879843). They were 99.3 to 99.5%, 97.2 to 97.5%, and 98.6 to 98.9% identical to ToCV CP sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. The presence of ToCV was confirmed by amplifying a portion of the HSP70h gene using the primers HSP-1F and HSP-1R (1). RT-PCR produced approximately 900-bp amplicons in the same nine samples. Four HSP70h gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 99.7% identical to each other (Accession Nos. HQ879844 to HQ879847). They were 99.2 to 99.5%, 98.0 to 98.4%, and 98.9 to 99.3% identical to HSP70h sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. TYLCV was also detected in all 16 samples by PCR using degenerate begomovirus primers PAL1v 1978 and PARIc 496 (3) followed by sequencing. TSWV was also detected in two of the ToCVinfected samples by RT-PCR with TSWV N gene specific primers (2) followed by sequencing. To our knowledge, this is the first report of the natural occurrence of ToCV in Georgia. Further studies are required to quantify the yield losses from ToCV alone and synergistic interactions between ToCV in combination with TSWV and/or TYLCV in tomato production in Georgia. References: (1) T. Hirota et al. J. Gen. Plant Pathol. 76:168, 2010. (2) R. K. Jain et al. Plant Dis. 82:900, 1998. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) L. Segev et al. Plant Dis. 88:1160, 2004.

scholarly journals First Report of Tomato chlorosis virus in Tomato in Costa Rica

Plant Disease ◽  
2009 ◽  
Vol 93 (9) ◽  
pp. 970-970 ◽  
Author(s):  
R. M. Castro ◽  
E. Hernandez ◽  
F. Mora ◽  
P. Ramirez ◽  
R. W. Hammond
Keyword(s):  
Costa Rica ◽  
Sequence Analysis ◽  
Nucleotide Sequence Analysis ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
Specific Primers ◽  
First Report ◽  
Sequence Identity ◽  
Pcr Products ◽  
Tomato Chlorosis Virus

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

scholarly journals First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽  
2001 ◽  
Vol 85 (6) ◽  
pp. 678-678 ◽  
Author(s):  
A. D. Avgelis ◽  
N. Roditakis ◽  
C. I. Dovas ◽  
N. I. Katis ◽  
C. Varveri ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Rflp Analysis ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Comparisons ◽  
Tomato Plants ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

scholarly journals First Report of Bidens mottle virus Infecting Calendula in Taiwan

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 362-362 ◽  
Author(s):  
C.-H. Huang ◽  
F.-J. Jan
Keyword(s):  
Amino Acid ◽  
Inclusion Bodies ◽  
Amino Acid Identity ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Acid Identity ◽  
First Report ◽  
Cp Gene ◽  
Dna Fragment

In March of 2010, calendula (Calendula officinalis L.), a perennial herb known as the pot marigold, showing chlorotic spots on leaves, chlorosis, and stunting were collected from Puli Township, Nantou County, Taiwan. The disorder occurred in more than 50% of the calendula plants in the field. A virus culture isolated from one of the symptomatic calendulas was established in Chenopodium quinoa through triple single-lesion isolation and designated as TwCa1. With transmission electron microscopy (TEM), negatively stained flexuous filamentous virions approximately 12 × 720 nm were observed in the crude sap of TwCa1-infected C. quinoa leaves and pinwheel inclusion bodies were found in the infected cells. On the basis of the sizes of the viral particles and inclusion bodies, isolate TwCa1 was a suspected potyvirus. By reverse transcription (RT)-PCR and potyvirus degenerate primers (Hrp5/Pot1) (1,2), a 0.65-kb DNA fragment, which included the 3′-end of the NIb gene and the 5′-end of coat protein (CP) gene of the virus, was amplified from total RNA isolated from TwCa1-infected plants. The amplified DNA fragment was cloned and sequenced. A homology search indicated that the new calendula-infecting virus in Taiwan might belong to Bidens mottle virus (BiMoV) because its partial genomic sequence shared 94.9 to 97.3% nucleotide and 96.6 to 98.1% amino acid identity with 11 BiMoV isolates available in NCBI GenBank. Primer pairs Hrp5/oligo d(T) were used to amplify the 3′-end genome of BioMV TwCa1 including the 3′-end of the NIb gene, the full-length CP gene, and the 3′-nontranslatable region of the virus. The 807-nt CP gene of TwCa1 (Accession No. HQ117871) shared 97.3 to 98.6% nucleotide and 98.5 to 98.9% amino acid identity with those of 11 BiMoV isolates available in GenBank. Results from TEM observations and CP gene sequence analysis indicated that TwCa1 is an isolate of BiMoV. BiMoV was later detected by RT-PCR in eight symptomatic calendulas collected from the same field. To our knowledge, this is the first report of BiMoV infecting calendula in Taiwan. This newly identified calendula-infecting BiMoV could have a direct impact on the economically important vegetable and floral industry in Taiwan. References: (1) C. C. Chen et al. Bot. Stud. 947:369, 2006. (2) D. Colinet and J. Kummert. J. Virol. Methods 45:149, 1993.

scholarly journals First Report of Powdery Mildew Caused by Podosphaera xanthii on Cuphea hyssopifolia (Lythraceae) in Mainland China

Plant Disease ◽  
2021 ◽  
Author(s):  
Irum Mukhtar ◽  
Ruiting Li ◽  
IBATSAM KHOKHAR ◽  
Ruanni Chen ◽  
Yunying Cheng ◽  
...  
Keyword(s):  
Powdery Mildew ◽  
Disease Incidence ◽  
Large Subunit ◽  
Mainland China ◽  
Lsu Rdna ◽  
Podosphaera Xanthii ◽  
Powdery Mildew Fungus ◽  
Potential Threat ◽  
First Report ◽  
Plant Pathol

Cuphea hyssopifolia (Mexican heather) is a popular evergreen perennial shrub used for ornamental and medicinal purposes. Due to its high ornamental value, it is often used as a ground cover in parks and gardens in China. During February and March 2019 & 2020, powdery mildew was observed on C. hyssopifolia in the districts of Minhou and Jinshan of Fuzhou, China. Disease incidence was 70% but of low severity with only a few older leaves showing yellowing and wilting. Sparse irregular patches of white superficial powdery mildew observed on both sides of mature and young leaves. The powdery mildew fungal appressoria that occurred on epigenous hyphae, were indistinct to nipple-shaped, hyaline, and smooth. Conidiophores were erect, smooth, 80 to 210 × 10 to 12 µm, and produced two to eight crenate-shaped conidia in chains. Foot-cells of conidiophores were straight, cylindric, and 30 to 65 × 10 to12 µm. Conidia were hyaline, smooth, ellipsoid-ovoid to barrel-shaped, 25 to 38 × 16 to 20 µm with distinct fibrosin bodies. Germ tubes were simple to forked and produced from the lateral position of the germinating conidia. No chasmothecia were observed on the surface of infected leaves. Based on the morphology of the imperfect state, the powdery mildew fungus was identified as Podosphaera xanthii (Castagne) U. Braun & N. Shishkoff (Braun and Cook 2012). To confirm fungal identification, total DNA was extracted (Mukhtar et al., 2018) directly from epiphytic mycelia on infected leaves collected from both districts. Internal transcribed spacer (ITS) regions and the partial large subunit (LSU) rDNA were amplified using primers ITS1/ITS4 and LSU1/LSU2 (Scholin et al. 1994, White et al. 1990), respectively. The sequences were deposited in GenBank (ITS: MW692364, MW692365; LSU: MW699924, MW699925). The ITS and LSU sequences were 99 to 100 % identical to those of P. xanthii in GenBank, (ITS: MT568609, MT472035, MT250855, and AB462800; LSU: AB936276, JX896687, AB936277, and AB936274). Koch’s postulates were completed by gently pressing diseased leaves onto leaves of five healthy potted C. hyssopifolia plants that were held in a greenhouse at 24 to 30°C without humidity control. Five non-inoculated plants served as controls. Inoculated plants developed symptoms after 6 to 10 days, whereas the controls remained symptomless. The morphology of the fungus on the inoculated leaves was identical to that observed on the originally diseased leaves. Previously, Podosphaera sp. has been reported on C. rosea in the United Kingdom (Beales & Cook 2008) and P. xanthii on C. hyssopifolia in Taiwan (Yeh et al. 2021). To our knowledge, this is the first report of powdery mildew caused by P. xanthii on C. hyssopifolia in mainland China. Our field observations suggest that the P. xanthii infections would be a potential threat to the health of C. hyssopifolia in China. References: Beales, P. A., and Cook, R. T. A. 2008. Plant Pathol. 57:778. Braun, U., Cook, R. T. A. 2012. The Taxonomic Manual of the Erysiphales (Powdery Mildews). CBS Biodiversity Series 11: CBS. Utrecht, The Netherlands. Mukhtar, I., et al. 2018. Sydowia.70:155. Scholin, C. A., et al. 1994. J. Phycol. 30:999. White, T. J., et al. 1990. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA. Yeh, Y. W., et al. 2021. Trop. Plant Pathol. 46:44.

scholarly journals First Report of Beet black scorch virus in the United States

Plant Disease ◽  
2006 ◽  
Vol 90 (6) ◽  
pp. 828-828 ◽  
Author(s):  
J. J. Weiland ◽  
R. L. Larson ◽  
T. P. Freeman ◽  
M. C. Edwards
Keyword(s):  
Nucleotide Sequence ◽  
Sugar Beet ◽  
The United States ◽  
Enzyme Linked Immunosorbent Assay ◽  
First Report ◽  
Sequence Identity ◽  
Cp Gene ◽  
Local Lesions ◽  
Dna Primers ◽  
Beet Black Scorch Virus

In October of 2005, sugar beet (Beta vulgaris L.) plants exhibiting symptoms of rhizomania caused by Beet necrotic yellow vein virus (BNYVV) (3) were observed in a production field near Greeley, CO. The roots of seven plants exhibiting moderate to severe symptoms characteristic of this disease were tested using double-antibody sandwich enzyme-linked immunosorbent assay with anti-BNYVV antiserum from rabbits. Of these, only two roots exhibiting the mildest symptoms tested positive for BNYVV (all roots tested negative for the presence of the related Beet soilborne mosaic virus (BSBMV). ‘Hairy’ lateral roots characteristic of the disease were combined from the remaining five roots, ground in phosphate buffer, and the supernatant from the suspension was mechanically applied to leaves of Chenopodium quinoa in an effort to isolate an infectious agent. Five days postinoculation (dpi), yellow lesions with necrotic centers were visible on inoculated leaves, well in advance of those typically observed for BNYVV or BSBMV. Lesions exhibiting a similar rate of development on C. quinoa subsequently were induced from extracts of root vascular tissue prepared from four of seven additional beet roots tested from this location. Transfer of the infection from the C. quinoa lesions to 32 healthy C. quinoa and 10 sugar beet plants (hybrid ACH9369; American Crystal Sugar Co., Moorhead MN) resulted in 100% infection. Inoculated leaves of C. quinoa exhibited a high density of necrotic local lesions within 3 dpi, whereas inoculated leaves of sugar beet exhibited pinpoint, necrotic to diffuse, chlorotic local lesions evident by 5 dpi. Electron microscopic examination of fixed, ultra-thin sections of symptomatic C. quinoa leaf tissue revealed aggregates of virus-like particles of icosahedral symmetry within the cell cytoplasm. Following a virus minipreparation procedure, nucleic acid extracted from the partially purified virus was found to be single-stranded RNA by ribonuclease digestion and alone was infectious when inoculated to C. quinoa leaves. The apparently monopartite RNA genome was 3.5 kb long and a candidate for the single coat protein (CP) had a mass of ˜25 kDa. The sole reference set found in the literature for a virus naturally occurring on sugar beet with similar characteristics was that for Beet black scorch virus (BBSV), a virus recently accepted by the ICTV into the genus Necrovirus within the family Tombusviridae (2). Prior to this communication, BBSV has only been reported in China where it was first documented affecting sugar beet in the late 1980s (1). Using the published sequence of BBSV (Genbank Accession No. AY626780), DNA primers directed to the 3′ half of the BBSV genome were used in reverse transcription-polymerase chain reaction to produce an amplicon from the unknown virus. Sequencing the amplicon revealed 88.8% nucleotide sequence identity to the BBSV CP gene and 97% amino acid sequence identity to the predicted CP gene product. Combined, the nucleotide sequence and physical characteristics confirm the presence of BBSV in a U.S. sugarbeet field for the first time. To our knowledge, this is the first report of the occurrence of BBSV outside of China. References: (1) Y. Cao et al. Arch. Virol. 147:2431, 2002. (2) C. M. Fauquet et al. Eighth Report of the International Committee on the Taxonomy of Viruses. Academic Press, New York, 2005. (3) C. M. Rush. Ann. Rev. Phytopathol. 41:567, 2003.

scholarly journals First Report of Atypical Scab Caused by Venturia asperata on Apple in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yang Zhou ◽  
Haidong Bu ◽  
Chingchai Chaisiri ◽  
Qin Tan ◽  
Li Wang ◽  
...  
Keyword(s):  
Venturia Inaequalis ◽  
Disease Incidence ◽  
Large Subunit ◽  
Apple Scab ◽  
Agar Plate ◽  
Single Spore ◽  
First Report ◽  
Sequence Identity ◽  
Blast Analysis ◽  
Plastic Bag

Apple cv. ‘Huangtaiping’ (Malus pumila Mill.) is grown widely in northern China for the production of jellies, preserves, and cider. In 2018, atypical scab symptoms were observed on fruits of Huangtaiping in Heilongjiang Province of China. The disease incidence was estimated at approximately 0.4%. Symptoms were scab-like black spots (3 to 5 mm diam.) distinct from scab caused by Venturia inaequalis. Conidia were generally produced on lesions and using a modified microscope (Goh 1999), a single spore was picked up from each sample on water agar plate with a glass needle and then transferred to PDA amended with lactic acid (0.50 ml/L) and sulfate streptomycin (0.20 g/L). Fifteen isolates were obtained and incubated at 21°C for 6 weeks in darkness on PDA. The colonies on PDA were gray-black with circular morphology and floccose texture, which were similar with the characteristics of V. asperata described previously (Turan et al. 2019). The conidia were cylindrical to fusiform, 0 to 1 septate, yellowish and 19.7 (13.5 to 25.8) × 5.7 (3.6 to 6.9) μm (n = 10) in size, which were larger than previously described ones (Turan et al. 2019). DNA of three randomly selected isolates were extracted by a modified SDS method (Ping et al. 2004). The internal transcribed spacer (ITS) region of rDNA of the three selected isolates was amplified with the primers ITS4/ITS5 (White et al. 1990), sequenced and deposited in GenBank (MN958665, MN95866 and MN958667). BLAST analysis showed that the amplified sequences were identical and had 99.3% sequence identity with V. asperata (AF333447, MT459450 and MT459451), 95.4% sequence identity with V. cerasi (MK810963 and MK810964) and 94.3% sequence identity with V. carpophila (MN958609, MN958610 and MN958611). In addition, the complete large subunit ribosomal RNA gene (LSU) was amplified with the primers LROR/LR5 (Vilgalys and Hester 1990), sequenced and deposited in GenBank (MT845787, MT845788 and MT845789). BLAST analysis showed that the amplified sequences were identical and had 99.7% sequence identity with V. asperata (EF114711), 99.2% identity with V. carpophila (MT772296, MT845732 and MT845733 ) and 98% identity with V. cerasi (MK810848 and MK810849). Phylogenetic analysis based on concatenated ITS and LSU sequences showed that the tested isolates grouped with V. asperata strain 2349 in the same clade and the closest species with V. asperata was V. carpophila, followed by V. cerasi. In July 2019, pathogenicity of the isolate VAHLJ3-1-1 was evaluated on Huangtaiping. A conidia suspension with a concentration of 5×105/ml was sprayed evenly on the surface of six fruits. In order to maintain high humidity, inoculated fruits were wrapped with a plastic bag (a cotton ball with water was placed in the plastic bag) to maintain wetness for 3 days. Six fruits sprayed with water were used as a control. Four weeks after inoculation, similar symptom of atypical scab was observed on fruits of Huangtaiping, and V. asperata was isolated again from six inoculated fruits with reisolation frequency of 100% by the single spore isolation, while no symptom was observed on the control fruits. Based on the morphological and molecular identifications, the causal agent of atypical scab on Huangtaiping was identified as V. asperata. Apple scab is usually caused by V. inaequalis (Shen et al. 2020). However, apple scab has also been caused by V. asperata in Italy and France (Caffier et al. 2012; Turan et al. 2019). To the best of our knowledge, this is the first report of V. asperata associated with apple scab-like lesions in China. This information augments our knowledge of the spectrum of Venturia species associated with disease on apple fruit and will be a valuable foundation underpinning management strategies for this cultivar.

scholarly journals First Report of Tomato chlorosis virus (ToCV) in Tomato Crops in Saudi Arabia

Plant Disease ◽  
2014 ◽  
Vol 98 (11) ◽  
pp. 1590-1590 ◽  
Author(s):  
M. A. Al-Saleh ◽  
I. M. Al-Shahwan ◽  
M. T. Shakeel ◽  
M. A. Amer ◽  
C. G. Orfanidou ◽  
...  
Keyword(s):  
Saudi Arabia ◽  
Open Field ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Crop Losses ◽  
Total Rna ◽  
Indicator Plants ◽  
First Report ◽  
Access Period ◽  
Tomato Chlorosis Virus

During January 2014, open field and greenhouse tomato (Solanum lycopersicum L.) crops in the peripheral areas of Riyadh region (Al-Aflaj, Al-Kharj, Al-Waseel, and Al-Dalam), Saudi Arabia, were surveyed. In all surveyed tomato crops, yellowing symptoms were observed on the lower leaves, possibly infected by a whitefly transmitted crinivirus (family Closteroviridae) such as Tomato chlorosis virus (ToCV) and/or Tomato infectious chlorosis virus (TICV). Dense population of whiteflies (Bemisia tabaci G.) were present in all affected plants. Incidence of the yellowing disease varied between four greenhouses and three open field tomato crops, but in the majority of the tomato crops surveyed, symptoms typical of Begomovirus infection such as severe stunting, degeneration, upward cupping, distortion and interveinal yellowing of upper leaves, and flower abortion were also observed. Tomato yellow leaf curl virus (TYLCV) is endemic in Saudi Arabia causing severe crop losses (1). Twenty-six leaf samples from 24 symptomatic and two asymptomatic plants from four fields (three greenhouses and one open field crop) were collected and were processed in the lab at King Saud University. Whitefly transmission on tomato indicator plants was carried out using B. tabaci to fulfill Koch's postulates. Two hundred virus-free B. tabaci adults were confined to one of the collected symptomatic tomato sample singly infected with ToCV for a 48-h acquisition access period, followed by a 48-h inoculation access period on five healthy tomato plants Hybrid Super Strain B, using 40 whiteflies per plant. Crinivirus detection following transmission was conducted by RT-PCR. Total RNA was extracted from 26 collected leaf samples using the Total RNA Purification Kit and analyzed by SCRIPT One–Step RT-PCR Kit (Jena Bioscience). First, the degenerate primers HS-11/HS12 were used for amplification of a 587-bp fragment of the HSP70 gene of ToCV and TICV (3). Second, the RT-PCR product was subjected to a nested PCR using specific primers TIC-3/TIC-4 and TOC-5/TOC-6, for the detection of both TICV and ToCV, respectively (2). Finally, degenerate primers (AV494/AC1048) were used for detection of begomoviruses (4). No fragment was amplified by TIC-3/TIC-4 primer whereas TOC-5/TOC-6 amplified a size of 463 bp in all 24 symptomatic tested samples, including one mixed infection with TYLCV detected by AV494/AC1048. Asymptomatic samples did not produce any amplicon regarding TICV, ToCV, and Begomovirus detection. The amplicons of four positive fragments, each from one field, were further sequenced in both directions and all obtained sequences (KJ433488, KJ433489, KJ433490, and KJ433491) analyzed with BLAST and revealed 99% identity with the most closely deposited sequences in NCBI from Japan (AB513442) and Brazil (JQ952601). In the transmission tests, ToCV was detected to all tomato indicator plants which revealed yellowing symptoms 6 weeks post inoculation, whereas no transmission was obtained when non-viruliferous whitefly adults fed on two asymptomatic tomato leaves. To our knowledge, this is the first report of ToCV infecting tomato crops in Saudi Arabia. Further studies are being carried out to study epidemiology and genetic diversity of this virus associated with yellowing diseases of tomato in different regions of Saudi Arabia. This finding is important for the tomato crops and possibly other virus hosts as may cause serious epidemics and crop losses. References: (1) A. M. Ajlan et al. Arab J. Biotech. 10:179, 2007. (3) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (4) S. D. Whyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Sign in / Sign up

Export Citation Format

Share Document