First Report of Charcoal Rot on Canola Caused by Macrophomina phaseolina in Western Australia

In the spring of 2006, canola (Brassica napus L.) plants suffering from wilt were observed in an experimental plot at Merredin, Western Australia. Symptoms on the affected plants were tan-brown, longitudinal streaks along the main stem and on some lateral branches. Lesions on the stem were predominantly unilateral but sometimes covered the entire stem. Some of the lateral branches were completely wilted, and if present, pods were either shriveled or contained small seed. At the base of the stem, the lesions were grayish brown streaks that caused longitudinal splitting of the stem base. Small spherical (55 to 75 μm in diameter) and elongated (75 to 120 μm long) microsclerotia were seen in the pith and vascular region. Roots appeared to be symptomless, but upon removing the epidermis, grayish streaks were also seen on the roots and small sclerotia were observed in the pith and the vascular region of roots. One hundred and four small pieces (1 to 2 cm) of stem and root from 10 symptomatic plants were surface sterilized with 1.25% NaOCl, rinsed twice in sterile distilled water, and plated on potato dextrose agar (PDA) supplemented with 10 ppm of aureomycin. These were incubated under a blacklight at 22°C. Macrophomina phaseolina (Tassi) Goid. was isolated from 80% of the pieces as identified by colony morphology and the size of microsclerotia that ranged between 50 and 190 μm (3). Eight-three isolates were obtained. None of the isolates produced pycnidia on PDA. However, pycnidia (100 to 190 μm) with pycnidiospores (17.5 to 30 × 7.5 to 10 μm) were produced on the affected stems collected from the field. Pathogenicity tests with one of the isolates were conducted on seven 2-week-old canola plants (cv. Stubby). Three uninoculated plants served as the control. Roots of 2-week-old plants were dipped in an aqueous conidial suspension (1 × 104 conidia/ml) of M. phaseolina for an hour while roots of control plants were dipped in sterile water. Inoculated and control plants were repotted in separate pots and transferred to a glasshouse. A week after inoculation, M. phaseolina produced chlorosis of the leaves, and subsequently, complete wilting and death of the inoculated plants. M. phaseolina was successfully reisolated from roots and stems of symptomatic plants. No symptoms developed on the control plants. Pathogenicity was also tested by soaking seeds of cv. Stubby with an aqueous conidial suspension of M. phaseolina for one-half hour and incubating on agar media after drying. Germinating seeds were colonized by the growing mycelium and seedlings were completely killed within a week. Abundant microsclerotia were produced on the dead seedlings. M. phaseolina has been previously reported on canola in the United States (1) and Argentina (2) and more recently has been reported on canola in eastern Australia (4). To our knowledge, this is the first record of occurrence of M. phaseolina on canola in Western Australia and its impact on canola yield needs to be determined. References: (1) R. E. Baird et al. Plant Dis. 78:316, 1994. (2) S. A. Gaetán et al. Plant Dis. 90:524, 2006. (3) P. Holliday and E. Punithalingam. Macrophomina phaseolina. No. 275 in: Descriptions of Plant Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1970. (4) M. Li et al. Aust. Plant Dis. Notes 2:93, 2007.

Download Full-text

Occurrence of Charcoal Rot Caused by Macrophomina phaseolina on Canola in Argentina

Plant Disease ◽

10.1094/pd-90-0524a ◽

2006 ◽

Vol 90 (4) ◽

pp. 524-524 ◽

Cited By ~ 11

Author(s):

S. A. Gaetán ◽

L. Fernandez ◽

M. Madia

Keyword(s):

United States ◽

Buenos Aires ◽

Vascular Tissue ◽

Disease Incidence ◽

Pathogenic Fungi ◽

Macrophomina Phaseolina ◽

The United States ◽

Buenos Aires Province ◽

Charcoal Rot ◽

Experimental Plots

Canola (Brassica napus) is an important oleaginous crop in Argentina. Approximately 16,000 ha are grown commercially in the southern region of Buenos Aires Province. In 2003, typical symptoms and signs of charcoal rot were observed on canola plants in experimental plots located at the School of Agricultural Sciences, University of Buenos Aires in Buenos Aires. Average disease incidence across three 5- to 6-month-old plants (cvs. Monty, Rivette, and Trooper) was 12% (range = 7 to 17%). Affected plants appeared in patches following the rows at pod-filling stage. Symptoms included wilted foliage, premature senescence, and death of plants. Black, spherical microsclerotia 78 to 95 μm in diameter were present in vascular tissue of basal stems and taproots. The affected plants were stunted and had unfilled pods. In advanced phases of the disease, areas of silver gray-to-black discoloration were observed in the stem cortex; many plants were killed during late-grain fill, and plants could be pulled easily from the ground because basal stems were shredded. Four samples consisting of five symptomatic plants per sample were randomly collected from experimental plots. Pieces (1-cm long) taken from taproots and basal stems of diseased plants were surface sterilized with 1% NaOCl for 2 min and then placed on potato dextrose agar (PDA). Plates were incubated in the dark at 26°C for 4 days and then exposed to 12-h NUV light/12-h dark for 6 days. Five resulting isolates were identified as Macrophomina phaseolina (Tassi) Goidanich (1) based on the gray color of the colony and the presence of microsclerotia 71 to 94 μm in diameter. Two colonies developed globose pycnidia with one-celled, hyaline, and elliptic conidia. Pathogenicity tests were conducted using four inoculated and three non-inoculated control plants potted in a sterilized soil mix (soil/sand, 3:1) in a greenhouse at 25°C and 75% relative humidity with no supplemental light. Crown inoculations were carried out by placing a disk taken from an actively growing culture of M. phaseolina into wounds made with a sterile scalpel. Control plants received disks of sterile PDA. Inoculated and control plants were covered with polyethylene bags for 48 h after inoculation. Three isolates caused disease on 7-week-old canola plants (cvs. Master, Mistral, Rivette, and Trooper). Characteristic symptoms similar to the original observations developed for all three isolates within 21 days after inoculation on 80% of inoculated plants. The pathogen was successfully reisolated from diseased stem tissue in all instances. Symptoms included leaf necrosis, stunting, decay and collapse of seedlings, and plant death. Control plants remained asymptomatic. The experiment was repeated once with similar results. To our knowledge, this is the first report of the occurrence of M. phaseolina causing charcoal rot on canola in Argentina. This pathogen has been previously reported in the United States (2,3). The results demonstrate the potential importance of this pathogen in Argentina, since two commercial cultivars (Master and Mistral) were apparently susceptible to M. phaseolina. More studies are needed to determine the presence of charcoal rot in canola-growing areas of Argentina. References: (1) Anonymous. Macrophomina phaseolina. No. 275 in: Descriptions of Plant Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1970. (2) R. E. Baird et al. Plant Dis. 78:316, 1994. (3) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989.

Download Full-text

First Report of Myrothecium roridum Causing Myrothecium Leaf Spot on Salvia spp. in the United States

Plant Disease ◽

10.1094/pdis-91-6-0772b ◽

2007 ◽

Vol 91 (6) ◽

pp. 772-772 ◽

Cited By ~ 7

Author(s):

J. A. Mangandi ◽

T. E. Seijo ◽

N. A. Peres

Keyword(s):

United States ◽

Leaf Spot ◽

Pathogenic Fungi ◽

Lower Surface ◽

The United States ◽

Plant Diseases ◽

Control Measures ◽

Conidial Suspension ◽

First Report ◽

Myrothecium Roridum

The genus Salvia includes at least 900 species distributed worldwide. Wild species are found in South America, southern Europe, northern Africa, and North America. Salvia, commonly referred to as sage, is grown commercially as a landscape plant. In August 2006, pale-to-dark brown, circular leaf spots 5 to 20 mm in diameter with concentric rings were observed on Salvia farinacea ‘Victoria Blue’. Approximately 5% of the plants in a central Florida nursery were affected. Lesions were visible on both leaf surfaces, and black sporodochia with white, marginal hyphal tuffs were present mostly on the lower surface in older lesions. Symptoms were consistent with those of Myrothecium leaf spot described on other ornamentals such as gardenia, begonia, and New Guinea impatiens (4). Isolations from lesions on potato dextrose agar produced white, floccose colonies with sporodochia in dark green-to-black concentric rings. Conidia were hyaline and cylindrical with rounded ends and averaged 7.4 × 2.0 μm. All characteristics were consistent with the description of Myrothecium roridum Tode ex Fr. (2,3). The internal transcribed spacer regions ITS1, ITS2, and the 5.8s rRNA genomic region of one isolate were sequenced (Accession No. EF151002) and compared with sequences in the National Center for Biotechnology Information (NCBI) database. Deposited sequences from M. roridum were 96.3 to 98.8% homologous to the isolate from salvia. To confirm pathogenicity, three salvia plants were inoculated by spraying with a conidial suspension of M. roridum (1 × 105 conidia per ml). Plants were covered with plastic bags and incubated in a growth chamber at 28°C for 7 days. Three plants were sprayed with sterile, distilled water as a control and incubated similarly. The symptoms described above were observed in all inoculated plants after 7 days, while control plants remained symptomless. M. roridum was reisolated consistently from symptomatic tissue. There are more than 150 hosts of M. roridum, including one report on Salvia spp. in Brunei (1). To our knowledge, this is the first report of Myrothecium leaf spot caused by M. roridum on Salvia spp. in the United States. Even the moderate level disease present caused damage to the foliage and reduced the marketability of salvia plants. Therefore, control measures may need to be implemented for production of this species in ornamental nurseries. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. ARS, USDA, 2006, (2) M. B. Ellis. Page 449 in: Microfungi on Land Plants: An Identification Handbook. Macmillan Publishing, NY, 1985. (3) M. Fitton and P. Holliday. No. 253 in: CMI Descriptions of Pathogenic Fungi and Bacteria. The Eastern Press Ltd. Great Britain, 1970. (4) M. G. Daughtrey et al. Page 19 in: Compendium of Flowering Potted Plant Diseases. The American Phytopathological Society. St. Paul, MN, 1995.

Download Full-text

Crown Rot of Strawberry Caused by Macrophomina phaseolina in California

Plant Disease ◽

10.1094/pdis-92-8-1253b ◽

2008 ◽

Vol 92 (8) ◽

pp. 1253-1253 ◽

Cited By ~ 37

Author(s):

S. T. Koike

Keyword(s):

Disease Incidence ◽

Pathogenic Fungi ◽

Macrophomina Phaseolina ◽

The United States ◽

Crown Rot ◽

Charcoal Rot ◽

Crown Tissue ◽

Original Field ◽

Rot Disease ◽

Eventual Collapse

In 2006 and 2007, severely diseased strawberry (Fragaria × ananassa) plants were observed in five commercial fields in southern California (Orange County). Disease generally occurred in discrete patches. Within such patches, disease incidence ranged from 10 to 75%. Symptoms consisted of wilting of foliage, drying and death of older leaves, plant stunting, and eventual collapse and death of plants. When plant crowns were dissected, internal vascular and cortex tissues were dark brown to orange brown. Fruiting bodies or other fungal structures were not observed. A fungus was consistently isolated from symptomatic crown tissue that had been surface sterilized and placed on acidified corn meal agar (LA-CMA). All isolates produced numerous, dark, irregularly shaped sclerotia that were 67 to 170 μm long and 44 to 133 μm wide. When isolates were grown on 1.5% water agar with dried and sterilized wheat straw, dark, ostiolate pycnidia and hyaline, single-celled, cylindrical conidia were produced. On the basis of these characters, all isolates were identified as Macrophomina phaseolina (1). The symptomatic plants tested negative for Colletotrichum spp., Phytophthora spp., Verticillium dahliae, and other pathogens. Inoculum for pathogenicity tests was produced by growing six isolates on CMA on which sterilized wood toothpicks were placed on the agar surface. After 1 week, toothpicks were removed and inserted 4 to 5 mm deep into the basal crown tissue of potted strawberry plants (cv. Camarosa) grown in soilless, peatmoss-based rooting medium. Ten plants were inoculated per isolate and one toothpick was inserted per plant. Ten control strawberry plants were treated by inserting one sterile toothpick into each crown. All plants were then grown in a shadehouse. After 2 weeks, all inoculated plants began to show wilting and decline of foliage. By 4 weeks, all inoculated plants had collapsed. Internal crown tissue was discolored and similar in appearance to the original field plants. M. phaseolina was isolated from all inoculated plants. Control plants did not exhibit any disease symptoms, and crown tissue was symptomless. The test was repeated and the results were similar. While M. phaseolina has been periodically associated with strawberry in California (3), to my knowledge, this is the first report of charcoal rot disease on commercial strawberry in California. Charcoal rot of strawberry has been reported in Egypt, France, India, Israel, and the United States (Florida and Illinois) (2,4). Similar to previous reports (2,4), many of the affected California fields were not preplant fumigated with methyl bromide + chloropicrin fumigants, and it is possible that under these changing production practices this pathogen may increase in importance in California. References: (1) P. Holliday and E. Punithalingam. No. 275 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1970. (2) J. Mertely et al. Plant Dis.89:434, 2005. (3) S. Wilhelm. Plant Dis. Rep. 41:941, 1957. (4) A. Zveibil and S. Freeman. Plant Dis. 89:1014, 2005.

Download Full-text

Strains of Leptosphaeria maculans with the Capacity to Cause Crown Canker on Brassica carinata are Present in Western Australia

Plant Disease ◽

10.1094/pd-90-0832a ◽

2006 ◽

Vol 90 (6) ◽

pp. 832-832

Author(s):

R. Khangura ◽

M. Aberra

Keyword(s):

Western Australia ◽

Leptosphaeria Maculans ◽

Lesion Size ◽

Hypersensitive Reaction ◽

Adult Plant ◽

Conidial Suspension ◽

Pressure Potential ◽

Brassica Napus L ◽

Blackleg Resistance ◽

B Genome

Blackleg, caused by Leptosphaeria maculans (Desm.) Ces. et de Not., is the most important disease of canola (Brassica napus L.) in Australia, Europe, Canada, and North America (2). During the early 1990s, new cultivars of canola with resistance to blackleg were released in Australia. Despite good adult-plant resistance, these cultivars still suffered significant yield losses from blackleg under high disease pressure. Potential new sources of blackleg resistance such as B. nigra L., B. carinata L., and Sinapis alba L. are being evaluated. B. carinata is believed to be highly resistant to blackleg by virtue of its B-genome. However, some L. maculans isolates that can attack B. carinata have been reported from Germany (1). During the 2003 growing season, 22 isolates of L. maculans were collected from different canola-growing areas of Western Australia and tested for their reaction on 24 seedlings of each of various Brassica genotypes, including B. carinata, in a controlled environment chamber. Twenty-four seeds per genotype were sown in 100-ml plastic pots (12 seeds per pot) and both cotyledons of 10-day-old seedlings were wound inoculated with a conidial suspension (1 × 107 conidia/ml) of each isolate of L. maculans. Disease assessments were made 2 weeks after inoculation. The majority of isolates induced a noninvasive hypersensitive reaction on B. carinata without pycnidial development. However, four of the isolates caused lesions with abundant pycnidia on B. carinata cotyledons. The lesion size ranged between 3 and 7 mm and appeared similar to that on susceptible B. napus cultivars. B. carinata seedlings were grown for another 8 weeks in a glasshouse, and crown cankers were observed from plants inoculated with three of the four seedling virulent isolates. The severity of crown cankers as percent of stem circumference (percent disease index) ranged between 20 and 54%. Twenty-five stem pieces from mature B. carinata plants infected with one of the three isolates were plated on V8 juice agar and L. maculans was recovered from 70% of pieces. Abundant pycnidia were also observed on these stem pieces. These results have important implications for using B. carinata as a source of blackleg resistance in canola breeding. To our knowledge, this is the first report of L. maculans isolates with the capacity to induce crown cankers on B. carinata in Australia. References: (1) C. Sjöidin and K. Glimelius. J. Phytopathol. 123:322, 1988. (2) J. West et al. Plant Pathol. 51:454, 2002.

Download Full-text

First Report of Phoma glomerata Associated with the Ascochyta Blight Complex on Field Pea (Pisum sativum) in Australia

Plant Disease ◽

10.1094/pdis-08-13-0809-pdn ◽

2014 ◽

Vol 98 (3) ◽

pp. 427-427 ◽

Cited By ~ 15

Author(s):

H. S. Tran ◽

M. P. You ◽

V. Lanoiselet ◽

T. N. Khan ◽

M. J. Barbetti

Keyword(s):

Pisum Sativum ◽

Western Australia ◽

Ascochyta Blight ◽

Field Pea ◽

Post Inoculation ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Representative Isolate ◽

Eastern Australia

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as “black spot disease” in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5′GTTTCCGTAGGTGAACCTGC 3′) and AB28 (5′ATATGCTTAAGTTCAGCGGGT 3′) were used to amplify extracted DNA from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml–1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.

Download Full-text

First Report of Club Root Caused by Plasmodiophora brassicae on Canola in Australia

Plant Disease ◽

10.1094/pdis-11-11-1006-pdn ◽

2012 ◽

Vol 96 (7) ◽

pp. 1075-1075 ◽

Cited By ~ 1

Author(s):

R. K. Khangura ◽

D. W. Wright

Keyword(s):

Western Australia ◽

Plasmodiophora Brassicae ◽

Root Hairs ◽

The United States ◽

Brassica Napus L ◽

Cortical Cells ◽

First Report ◽

Modified Method ◽

Resting Spores ◽

Species Specific

In 2009, a disease survey was conducted in 97 commercial canola (Brassica napus L.) fields in Western Australia by the Department of Agriculture and Food, Western Australia (DAFWA). In about 20% of the fields from the northern agricultural region of Western Australia, small patches were observed where canola plants showed symptoms of stunting and wilting. These plants were collected and roots of affected plants were washed thoroughly and examined for the presence of root disease. Small galls and clublike structures were observed on the secondary roots and sometimes on the main root of the affected plants. Examination of thin free hand sections from the root galls revealed that several cortical cells were enlarged and full of resting spores. The diameter of resting spores ranged between 2.5 and 3.0 μm. Plasmodia and zoosporangia were also observed in the root hairs. The identity of Plasmodiophora brassicae Woronin was confirmed by PCR using a modified method of Cao et al. 2007 (1). DNA from spores and slices of the galls of 14 different samples were extracted using DNeasy plant mini kit (QIAGEN Australia) as per manufacturer's instructions. Samples were disrupted by placing them into MPBIO tube A and placed in the Fast Prep machine at speed of 6 ms–1 for 40 s. This was repeated twice. The species-specific primers TC1F (5′-GTGGTCGAACTTCATTAAATTTGGGCTCTT-3′)/TC1R (5′-TTCACCTACGGAACGTATATGTGCATGTGA-3′) and TC2F (5′-AAACAACGAGTCAGCTTGAATGCTAGTGTG-3′)/TC2R (5′-CTTTAGTTGTGTTTCGGCTAGGATGGTTCG-3′) were used (1). The primers TC1F and TC1R failed to produce a PCR product of 548-bp size but using the primers TC2F and TC2R the PCR reaction resulted in a 519- bp fragment. Seven out of 14 samples gave positive results for P. brassicae with primers TC2F and TC2R. This indicates that the P. brassicae pathotype from Western Australia may be different than the one found in Alberta, Canada. However, pathotypes of P. brassicae from brassica vegetables from Australia have been found similar to the populations of P. brassicae present in the United States (2). Pathogenicity of P. brassicae was tested by dipping roots of five 10-day-old canola plants var. Cobbler in a spore suspension (1 × 106 resting spores/ml). Roots of five control plants were dipped in sterile water. Five weeks after inoculation, small galls were observed on the roots of three inoculated plants and the control plants remained symptomless. Resting spores were recovered from the galls developed on the roots of affected plants. Presence of P. brassicae in the affected roots was further confirmed by PCR using the method described above. To our knowledge, this is the first report of club root of canola in Australia. Club root is reported from vegetable brassicas and white mustard (Sinapis alba L.) in Australia. Club root has become a serious disease of canola in Canada since its detection in Alberta in 2006 (3). The resting spores of the fungus can survive for several years in soil, and therefore, this disease could pose a significant threat to canola production in Western Australia. References: (1) Cao et al. Plant Dis. 91:80, 2007. (2) Donald et al. Ann. App. Biol. 148:239, 2006. (3) S. Streklov et al. Can. J. Plant Pathol. 28:467, 2006.

Download Full-text

On the diagnostic characters of the genus Stygonitocrella (Copepoda, Harpacticoida), with descriptions of seven new species from Australian subterranean waters

Zootaxa ◽

10.11646/zootaxa.2324.1.1 ◽

2009 ◽

Vol 2324 (1) ◽

pp. 1-85 ◽

Cited By ~ 3

Author(s):

TOMISLAV KARANOVIC ◽

PETER HANCOCK

Keyword(s):

New Species ◽

Western Australia ◽

Type Species ◽

First Record ◽

The United States ◽

Morphological Characters ◽

Generic Diagnosis ◽

The North ◽

Central Asian ◽

Eastern Australia

Seven new freshwater ameirids were discovered in the Australian subterranean habitats, six of which would fit into the present unsatisfactory diagnosis of the genus Stygonitocrella Reid, Hunt & Stanley, 2003. Two of them were discovered in Pioneer Valley, Queensland, representing the first record of this genus in eastern Australia. Four other species were collected from the Pilbara region in Western Australia, the same region in Australia where the first three representatives of this genus were reported. An additional new species was collected in the Kimberley region in Western Australia and could not be assigned to the revised genus Stygonitocrella, but has some remarkable similarities with species that were in the past considered to be members of this genus. In order to assess the most natural allocation of these ameirid taxa, a revision of the genus Stygonitocrella was made, based on a cladistic approach by using 57 phylogenetically informative morphological characters. The phylogenetic analysis revealed the presence of six monophyletic groups, giving ground for the establishment of six new genera, three of them created to accommodate a single new Australian species: Kimberleynitocrella billhumphreysi gen. et sp. nov. from several bores in the Argyle Diamond Mine and Ord River in the Kimberley region in Western Australia, Gordanitocrella trajani gen. et sp. nov. from three different localities in the Pilbara region in Western Australia, and Lucionitocrella yalleenensis gen. et sp. nov. from a single bore on the Yalleen Station, also in the Pilbara region in Western Australia. All three new Australian genera have a basal position on the phylogenetic tree, because they share several plesiomorphic characters; nevertheless they are well defined by the combination of apomorphic and plesiomorphic features. The generic diagnosis of Stygonitocrella is emended and the genus redefined to include only four species: S. montana (Noodt, 1965) from Argentina (the type species), S. dubia (Chappuis, 1937) and S. guadalfensis Rouch, 1985 from Spain and S. sequoyahi Reid, Hunt & Stanley, 2003 from the United States. The Cuban S. orghidani (Petkovski, 1973) was left as incertae sedis in this genus. The subgenus Fiersiella Huys, 2009 is established as a junior subjective synonym of Stygonitocrella. Generic diagnoses are emended for the monospecific Australian genus Inermipes Lee & Huys, 2002, the monospecific Japanese genus Neonitocrella Lee & Huys, 2002 and the North American genus Psammonitocrella Huys, 2009, that contains two species. The genus Reidnitocrella gen. nov. is erected to accommodate three closely related central Asian species: R. tianschanica (Borutzky, 1972) comb. nov., R. pseudotianschanica (Sterba, 1973) comb. nov., and R. djirgalanica (Borutzky, 1978) comb. nov. Also, after carefully examining the available published information on R. tianschanica another new species is recognized in this genus: R. borutzkyi sp. nov. The genus Eduardonitocrella gen. nov. is erected for the Mexican E. mexicana (Suárez-Morales & Iliffe, 2005) comb. nov. The newly established genus Megastygonitocrella gen. nov. is the largest one in this group of freshwater ameirids, containing the following 11 species: M. trispinosa (Karanovic, 2006) comb. nov. (type species), M. bispinosa (Karanovic, 2006) comb. nov., M. unispinosa (Karanovic, 2006) comb. nov., M. ecowisei sp. nov., M. dec sp. nov., M. pagusregalis sp. nov., M. kryptos sp. nov., M. karamani (Petkovski, 1959) comb. nov., M. petkovskii (Pesce, 1985) comb. nov., M. ljovuschkini (Borutzky, 1967) comb. nov. and M. colchica (Borutzky & Michailova-Neikova, 1970) comb. nov. The first five species are endemic to the Pilbara region in Western Australia, the next two are described from Queensland, M. karamani is known from Slovenia, M. petkovskii from Greece, while the last two species are endemic to the Caucasus. A Tethyan origin for this genus is here hypothesized. New locality data is presented for the first three species, which revealed that M. trispinosa is the most common and widely distributed member of this group (although restricted to a single Australian region), while M. bispinosa and M. unispinosa are short range endemics. A key to species is provided for each polytypic genus, as well as a key to genera of Stygonitocrella s. l.

Download Full-text

First Report of Botrytis Blight on Medinilla magnifica and Various Species of Mandevilla and Allamanda in Italy

Plant Disease ◽

10.1094/pdis.2002.86.10.1175a ◽

2002 ◽

Vol 86 (10) ◽

pp. 1175-1175

Author(s):

A. M. Pennisi ◽

S. O. Cacciola ◽

F. Raudino ◽

A. Pane

Keyword(s):

Glucose Solution ◽

Brown Rot ◽

Pathogenic Fungi ◽

Tropical Species ◽

Conidial Suspension ◽

Transparent Plastic ◽

First Report ◽

Plastic Bags ◽

Lateral Branches ◽

Modal Values

Medinilla magnifica Lindl., Mandevilla splendens (Hook.) Woodson, the hybrid Mandevilla × amoena ‘Alice du Pont’ (pink allamanda), and various species of Allamanda, such as A. cathartica L. and A. blanchetii A. DC. (purple allamanda), are grown in Sicily as ornamentals. After a frost in early December 2001, a sudden wilt of container-grown cuttings of these tropical species was observed in a plastic-covered production greenhouse, with ≈30% of M. magnifica plants and 70% of Mandevilla and Allamanda plants affected. Medinilla plants (≈35 cm high) had been rooted in trays and transplanted individually in 30-cm-diameter pots. Allamanda (recently rooted cuttings) and Mandevilla (well-established) plants showed symptoms ranging from a dark brown rot at the base of stems to a tan-to-brown rot of stem midsection, respectively. Tissues surrounding lesions were water-soaked and covered by gray mycelium. On Allamanda and Mandevilla plants, lesions extended rapidly to lateral branches, and to the petiole and midrib of leaves that became chlorotic and wilted. As stems were girdled, infected plants collapsed, although the roots appeared healthy. Botrytis cinerea Pers.:Fr. was consistently isolated from infected stem pieces surface-disinfested with 1% NaOCl for 1 min and placed on potato dextrose agar (PDA, Oxoid). Morphology and size (6 to 8 × 8 to 12 μm, modal values 7 × 10 μm) of conidia produced on PDA matched those reported for B. cinerea (1). Dark, spherical, and irregularly shaped sclerotia (1 to 6 mm diameter, mean size 3.3 × 2.3 mm) were produced on PDA. Pathogenicity of a single-conidium isolate isolated from M. magnifica was confirmed using two inoculation methods. Twenty 3-month-old cuttings of M. magnifica and pink and purple allamanda were sprayed with a conidial suspension (106 conidia per ml in a 2% glucose solution). A 2% glucose solution was sprayed on 20 control plants. Plants were sealed in transparent plastic bags for 7 days at 15 to 24°C. Typical symptoms developed only on stems of inoculated pink and purple allamanda cuttings 7 days after inoculation. B. cinerea was reisolated from affected tissues. In a separate test, stems of 10 6-month-old plants of M. magnifica and pink allamanda were inoculated by inserting a 3-mm plug taken from 10-day-old sporulating colonies growing on PDA on a superficial cut made with a sterile scalpel. The inoculated wounds were sealed with Parafilm. Ten wounded but noninoculated plants were used as controls. Plants were kept in high humidity at 10 to 20°C. After 10 days, stem necrosis, leaf chlorosis, and wilt were observed on inoculated pink allamanda plants. On inoculated M. magnifica plants, necrotic lesions were observed on stems (45 to 70 mm long and 10 to 18 mm wide) covered by gray mycelium, but the stem was not girdled. B. cinerea was reisolated from infected tissues of inoculated plants to complete Koch's postulates. No lesions developed on noninoculated control plants. To our knowledge, this is the first report from Italy of Botrytis blight on these species. The occurrence of frost may have predisposed these tropical species to infection by B. cinerea. Reference: (1) M. B. Ellis and J. M. Waller. No 431 in: Descriptions of Pathogenic Fungi and Bacteria, CMI, Kew, Surrey, UK, 1974.

Download Full-text

First Report of Macrophomina phaseolina Causing Trunk and Cordon Canker Disease of Grapevine in the United States

Plant Disease ◽

10.1094/pdis-07-18-1189-pdn ◽

2019 ◽

Vol 103 (3) ◽

pp. 579-579 ◽

Cited By ~ 1

Author(s):

M. T. Nouri ◽

G. Zhuang ◽

C. M. Culumber ◽

F. P. Trouillas

Keyword(s):

United States ◽

Macrophomina Phaseolina ◽

The United States ◽

Canker Disease ◽

First Report

Download Full-text

Syphilis epidemiology and public health interventions in Western Australia from 1991 to 2009

Sexual Health ◽

10.1071/sh11102 ◽

2012 ◽

Vol 9 (3) ◽

pp. 272 ◽

Cited By ~ 3

Author(s):

Kellie S. H. Kwan ◽

Carolien M. Giele ◽

Heath S. Greville ◽

Carole A. Reeve ◽

P. Heather Lyttle ◽

...

Keyword(s):

Public Health ◽

Western Australia ◽

Aboriginal People ◽

Congenital Syphilis ◽

The United States ◽

Health Interventions ◽

Public Health Interventions ◽

Sex With Men ◽

Notification Data ◽

The Impact

Objectives To describe the epidemiology of congenital and infectious syphilis during 1991–2009, examine the impact of public health interventions and discuss the feasibility of syphilis elimination among Aboriginal people in Western Australia (WA). Methods: WA congenital and infectious syphilis notification data in 1991–2009 and national infectious syphilis notification data in 2005–2009 were analysed by Aboriginality, region of residence, and demographic and behavioural characteristics. Syphilis public health interventions in WA from 1991–2009 were also reviewed. Results: During 1991–2009, there were six notifications of congenital syphilis (50% Aboriginal) and 1441 infectious syphilis notifications (61% Aboriginal). During 1991–2005, 88% of notifications were Aboriginal, with several outbreaks identified in remote WA. During 2006–2009, 62% of notifications were non-Aboriginal, with an outbreak in metropolitan men who have sex with men. The Aboriginal : non-Aboriginal rate ratio decreased from 173 : 1 (1991–2005) to 15 : 1 (2006–2009). Conclusions: These data demonstrate that although the epidemiology of syphilis in WA has changed over time, the infection has remained endemic among Aboriginal people in non-metropolitan areas. Given the continued public health interventions targeted at this population, the limited success in eliminating syphilis in the United States and the unique geographical and socioeconomic features of WA, the elimination of syphilis seems unlikely in this state.

Download Full-text