scholarly journals First Report of Grapevine Virus Sequences Highly Similar to Grapevine Syrah virus-1 from Washington Vineyards

Plant Disease ◽  
2010 ◽  
Vol 94 (6) ◽  
pp. 787-787 ◽  
Author(s):  
T. A. Mekuria ◽  
R. A. Naidu
Keyword(s):  
Pairwise Comparison ◽  
Pinot Noir ◽  
Base Pairs ◽  
First Report ◽  
Sequence Identity ◽  
Protein Encoding ◽  
Tentative Member ◽  
Putative Movement Protein ◽  
Dna Fragment ◽  
Viral Sequences

Grapevine Syrah virus-1 (GSyV-1), a tentative member of the genus Marafivirus in the family Tymoviridae, has recently been found in a declining Syrah grapevine in California vineyards (1). To determine if GSyV-1 is present in grapevines grown in Washington State vineyards, extracts prepared from individual grapevines of six cultivars (Merlot, Chardonnay, Pinot Noir, Lemberger, Cabernet Sauvignon, and Syrah/Shiraz) were tested by single-tube reverse transcription (RT)-PCR using the primer pair GSyV-1 Det-F (5′-CAAGCCATCCGTGCATCTGG-3′) and GSyV-1 Det-R (5′-GCCGATTTGGAACCCGATGG-3′). The primer GSyV-1 Det-F is identical to nucleotides (nt) 1125 to 1144 and GSyV-1 Det-R complementary to nt 1401 to 1420 of the GSyV-1 genome (GenBank Accession No. NC_012484) in the putative movement protein encoding gene (1). DNA fragment of approximately 296 base pairs (bp) was amplified only from 7 of 60 and 2 of 20 individual grapevines of cv. Syrah/Shiraz and Chardonnay, respectively, obtained from geographically separate vineyards. The 296-bp fragments from three Syrah/Shiraz and two Chardonnay grapevines were cloned individually into the pCR2.1 plasmid (Invitrogen Corp., Carlsbad, CA). Three independent clones derived from each DNA fragment were sequenced from both orientations and the sequences edited and assembled using ContigExpress project in the Vector NTI Advance 11 sequence analysis software packages (Invitrogen). Pairwise comparison of four of these sequences (Accession Nos. GU372349–52) showed 99 to 100% amino acid (aa) sequence identity among themselves and with corresponding sequences of GSyV-1. Because of the lack of antibodies, an additional 611-bp fragment specific to the capsid protein (CP) gene of GSyV-1 was amplified from six isolates (five from cv. Syrah/Shiraz, and one from cv. Chardonnay) (Accession Nos. GU372353–66) using primers GSyV-1-F (5′-TGTCGACGCTCCAATGTCTGA-3′) and GSyV-1-R (5′-CATTGCTGCGCTTTGGAGGCTTTA-3′). GSyV-1-F is identical to nt 5775 to 5795 and GSyV-1-R is complementary to nt 6385 to 6408 of the GSyV-1 genome. The amplicons were cloned and sequenced as described above. Comparison of these sequences among themselves and with corresponding sequences of GSyV-1 showed 96 to 99% aa sequence identity, further complementing the results obtained above. To our knowledge, this is the first report of the occurrence of viral sequences closely related to GSyV-1 in Washington vineyards. Together with other reports (1,2), this study suggests that viruses similar to GSyV-1 could be widely distributed in wine grape cultivars across grape-growing regions. References: (1) M. Rwahnih et al. Virology 387:395, 2009. (2) S. Sabanadzovic. Virology 394:1, 2009.

scholarly journals Recombination-independent recognition of DNA homology for meiotic silencing in Neurospora crassa

2021 ◽  
Vol 118 (33) ◽  
pp. e2108664118
Author(s):  
Nicholas Rhoades ◽  
Tinh-Suong Nguyen ◽  
Guillaume Witz ◽  
Germano Cecere ◽  
Thomas Hammond ◽  
...  
Keyword(s):  
Conformational Changes ◽  
Dna Homology ◽  
Meiotic Silencing ◽  
Base Pairs ◽  
Homologous Chromosomes ◽  
Sequence Identity ◽  
Experimental Systems ◽  
Double Stranded Dna ◽  
Dna Fragment ◽  
Homology Recognition

The pairing of homologous chromosomes represents a critical step of meiosis in nearly all sexually reproducing species. In many organisms, pairing involves chromosomes that remain apparently intact. The mechanistic nature of homology recognition at the basis of such pairing is unknown. Using “meiotic silencing by unpaired DNA” (MSUD) as a model process, we demonstrate the existence of a cardinally different approach to DNA homology recognition in meiosis. The main advantage of MSUD over other experimental systems lies in its ability to identify any relatively short DNA fragment lacking a homologous allelic partner. Here, we show that MSUD does not rely on the canonical mechanism of meiotic recombination, yet it is promoted by REC8, a conserved component of the meiotic cohesion complex. We also show that certain patterns of interspersed homology are recognized as pairable during MSUD. Such patterns need to be colinear and must contain short tracts of sequence identity spaced apart at 21 or 22 base pairs. By using these periodicity values as a guiding parameter in all-atom molecular modeling, we discover that homologous DNA molecules can pair by forming quadruplex-based contacts with an interval of 2.5 helical turns. This process requires right-handed plectonemic coiling and additional conformational changes in the intervening double-helical segments. Our results 1) reconcile genetic and biophysical evidence for the existence of direct homologous double-stranded DNA (dsDNA)–dsDNA pairing, 2) identify a role for this process in initiating RNA interference, and 3) suggest that chromosomes can be cross-matched by a precise mechanism that operates on intact dsDNA molecules.

scholarly journals One of the tightly clustered genes of the mouse surfeit locus is a highly expressed member of a multigene family whose other members are predominantly processed pseudogenes.

1988 ◽  
Vol 8 (9) ◽  
pp. 3898-3905 ◽  
Author(s):  
C Huxley ◽  
T Williams ◽  
M Fried
Keyword(s):  
Multigene Family ◽  
Open Reading Frame ◽  
The Other ◽  
Base Pairs ◽  
Regulation Of Expression ◽  
Reading Frame ◽  
Processed Pseudogenes ◽  
Dna Fragment ◽  
Basic Polypeptide

The mouse surfeit locus is unusual in that it contains a number of closely clustered genes (Surf-1, -2, and -4) that alternate in their direction of transcription (T. Williams, J. Yon, C. Huxley, and M. Fried, Proc. Natl. Acad. Sci. USA 85:3527-3530, 1988). The heterogeneous 5' ends of Surf-1 and Surf-2 are separated by 15 to 73 base pairs (bp), and the 3' ends of Surf-2 and Surf-4 overlap by 133 bp (T. Williams and M. Fried, Mol. Cell. Biol. 6:4558-4569, 1986; T. Williams and M. Fried, Nature (London) 322:275-279, 1986). A fourth gene in this locus, Surf-3, which is a member of a multigene family, has been identified. The poly(A) addition site of Surf-3 lies only 70 bp from the poly(A) addition site of Surf-1. Transcription of Surf-3 has been studied in the absence of the other members of its multigene family after transfection of a cloned genomic mouse DNA fragment, containing the Surf-3 gene, into heterologous monkey cells. Surf-3 specifies a highly expressed 1.0-kilobase mRNA that contains a long open reading frame of 266 amino acids, which would encode a highly basic polypeptide (23% Arg plus Lys). The other members of the Surf-3 multigene family are predominantly, if not entirely, intronless pseudogenes with the hallmarks of being generated by reverse transcription. The role of the very tight clustering on regulation of expression of the genes in the surfeit locus is discussed.

Rescue of functional replication origins from embedded configurations in a plasmid carrying the adenovirus genome

1984 ◽  
Vol 4 (2) ◽  
pp. 302-309
Author(s):  
D Hanahan ◽  
Y Gluzman
Keyword(s):  
Viral Genome ◽  
Infectious Virus ◽  
Adenovirus Type ◽  
Small Fragment ◽  
Origin Of Replication ◽  
Wild Type ◽  
Base Pairs ◽  
Bacterial Plasmid ◽  
Dna Fragment ◽  
Adenovirus Type 5

A variant of the adenovirus type 5 genome which lacks EcoRI sites has been cloned in a bacterial plasmid after the addition of EcoRI oligonucleotide linkers to its ends. Closed circular forms of the recombinant viral genome were not infectious upon their introduction into permissive eucaryotic cells. The linear genome released by digestion of the 39-kilobase recombinant plasmid (pXAd) with EcoRI produced infectious virus at about 5% of the level of wild-type controls. The viruses which arose were indistinguishable from the parental strain, and the normal termini of the viral genome had been restored. Marker rescue experiments demonstrate that provision of a DNA fragment with a normal viral end improves infectivity. When a small fragment carrying a wild-type left end (the 0 to 2.6% ClaI-B fragment) was ligated to ClaI-linearized pXAd, virus was produced with efficiencies comparable to a similar reconstitution of the two ClaI fragments of the wild-type genome. These viruses stably carry the left-end fragment at both ends, leaving the normal right end embedded in 950 base pairs of DNA. The embedded right origin is inactive. The consensus of the analyses reported here is that a free end is a necessary configuration for the sequences which make up the adenovirus origin of replication.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of Phaeomoniella chlamydospora on Vitis vinifera and French American Hybrids in Chile

Plant Disease ◽  
2004 ◽  
Vol 88 (11) ◽  
pp. 1285-1285 ◽  
Author(s):  
J. Auger ◽  
M. Esterio ◽  
I. Pérez ◽  
W. D. Gubler ◽  
A. Eskalen
Keyword(s):  
Vitis Vinifera ◽  
Vascular Tissue ◽  
Polymerase Chain Reaction Amplification ◽  
Morphological Characters ◽  
Pinot Noir ◽  
Single Node ◽  
Metropolitan Regions ◽  
First Report ◽  
Phaeomoniella Chlamydospora ◽  
Rdna Sequences

Phaeomoniella chlamydospora (W. Gams, Crous. M.J. Wingfield & L. Mugnai) Crous & Gams (= Phaeoacremonium chlamydosporum) was isolated during the growing seasons of 2003-2004 from roots, trunks, and cordons of grapevines, including cvs. Cabernet Sauvignon, Merlot, Pinot noir, Thompson seedless, Ruby seedless and root stock 3309C, and Kober 5BB, from 10 locations in V, VI, VII, and metropolitan regions of Chile. P. chlamydospora was isolated from 82% of samples from vines 2 to 18 years old that showed decline symptoms in the field. Isolates were identified on the basis of a previous description (1) and internal transcribed spacer (ITS1-5.8S-ITS2) rDNA sequences identical to those of P. chlamydospora isolated from Vitis vinifera (culture CBS 22995, GenBank Accession No. AF 197973). P. chlamydospora is established as a member of the petri and esca disease complex and as a pathogen of grapevines (2,3). Pathogenicity tests were completed by injecting into the pith of 50 single-node, rooted cuttings of Pinot noir and 3309C, approximately 20 μl of a 106 conidia per ml suspension, obtained from four isolates from Chile and one from California. Ten control cuttings of Pinot noir and 3309C were injected with an equal volume of sterile distilled water. Twenty-four weeks after inoculations, all P. chlamydospora-inoculated cuttings exhibited dark streaking of the vascular tissue extending 40 to 45 mm from the point of inoculation. The vascular streaking observed in inoculated plants was identical to symptoms observed in declining vines in the vineyard. No symptoms were observed in the controls. P. chlamydospora was isolated from the region of vascular streaking in 85% of inoculated cuttings. P. chlamydospora was not isolated from the water-treated controls. The reisolated P. chlamydospora was verified with means of morphological characters and polymerase chain reaction amplification with the species-specific primers (3). P. chlamydospora is widespread and readily isolated from declining grapevines in Chile and other grape growing regions of the world. To our knowledge, this is the first report of P. chlamydospora from the cultivars cited above in Chile. References: (1) M. Groenewald et al. Mycol. Res. 105:651, 2001. (2) L. sparapano et al. Phytopathol. Mediterr. (Suppl.)40:376, 2001. (3) S. Tegli et al. Phytopathol. Mediterr. 39:134, 2000.

scholarly journals First Report of Leptosphaeria biglobosa ‘brassicae’ Causing Blackleg on Brassica juncea var. multisecta in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yuexuan Long ◽  
Mingxue Shang ◽  
Yue Deng ◽  
Chuan Yu ◽  
Mingde Wu ◽  
...  
Keyword(s):  
Brassica Juncea ◽  
Yellow Pigment ◽  
Causal Agent ◽  
Control Group ◽  
Conidial Suspension ◽  
First Report ◽  
Fungal Isolates ◽  
Dna Fragment ◽  
Leptosphaeria Biglobosa ◽  
Β Tubulin

Brassica juncea var. multisecta, a leafy mustard, is widely grown in China as a vegetable (Fahey 2016). In May 2018, blackleg symptoms, grayish lesions with black pycnidia, were found on stems and leaves of B. juncea var. multisecta during disease surveys in Wuhan, Hubei Province. Disease incidence was approximately 82% of plants in the surveyed fields (~1 ha in total). To determine the causal agent of the disease, twelve diseased petioles were surface-sterilized and then cultured on potato dextrose agar (PDA) at 20˚C for 5 days. Six fungal isolates (50%) were obtained. All showed fluffy white aerial mycelia on the colony surface and produced a yellow pigment in PDA. In addition, pink conidial ooze formed on top of pycnidia after 20 days of cultivation on a V8 juice agar. Pycnidia were black-brown and globose with average size of 145 × 138 μm and ranged between 78 to 240 × 71 to 220 μm, n = 50. The conidia were cylindrical, hyaline, and 5.0 × 2.1 μm (4 to 7.1 × 1.4 to 2.9 μm, n=100). These results indicated that the fungus was Leptosphaeria biglobosa rather than L. maculans, as only the former produces yellow pigment (Williams and Fitt 1999). For molecular confirmation of identify, genomic DNAs were extracted and tested through polymerase chain reaction (PCR) assay using the species-specific primers LbigF, LmacF, and LmacR (Liu et al. 2006), of which DNA samples of L. maculans isolate UK-1 (kindly provided by Dr. Yongju Huang of University of Hertfordshire) and L. biglobosa ‘brassicae’ isolate B2003 (Cai et al. 2014) served as controls. Moreover, the sequences coding for actin, β-tubulin, and the internal transcribed spacer (ITS) region of ribosomal DNA (Vincenot et al. 2008) of isolates HYJ-1, HYJ-2 and HYJ-3 were also cloned and sequenced. All six isolates only produced a 444-bp DNA fragment, the same as isolate B2003, indicating they belonged to L. biglobosa ‘brassicae’, as L. maculans generates a 331-bp DNA fragment. In addition, sequences of ITS (GenBank accession no. MN814012, MN814013, MN814014), actin (MN814292, MN814293, MN814294), and β-tubulin (MN814295, MN814296, MN814297) of isolates HYJ-1, HYJ-2 and HYJ-3 were 100% identical to the ITS (KC880981), actin (AY748949), and β-tubulin (AY748995) of L. biglobosa ‘brassicae’ strains in GenBank, respectively. To determine their pathogenicity, needle-wounded cotyledons (14 days) of B. juncea var. multisecta ‘K618’ were inoculated with a conidial suspension (1 × 107 conidia/ml, 10 μl per site) of two isolates HYJ-1 and HYJ-3, twelve seedlings per isolate (24 cotyledons), while the control group was only treated with sterile water. All seedlings were incubated in a growth chamber (20°C, 100% relative humidity under 12 h of light/12 h of dark) for 10 days. Seedlings inoculated with conidia showed necrotic lesions, whereas control group remained asymptomatic. Two fungal isolates showing the same culture morphology to the original isolates were re-isolated from the necrotic lesions. Therefore, L. biglobosa ‘brassicae’ was confirmed to be the causal agent of blackleg on B. juncea var. multisecta in China. L. biglobosa ‘brassicae’ has been reported on many Brassica crops in China, such as B. napus (Fitt et al. 2006), B. oleracea (Zhou et al. 2019), B. juncea var. multiceps (Zhou et al. 2019), B. juncea var. tumida (Deng et al. 2020). To our knowledge this is the first report of L. biglobosa ‘brassicae’ causing blackleg on B. juncea var. multisecta in China, and its occurrence might be a new threat to leafy mustard production of China.

scholarly journals First Report of Sclerotinia Blight on Peanut Caused by Sclerotinia sclerotiorum in Qinghai Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xia Zhang ◽  
Wenrong Xian ◽  
Mingjing Qu ◽  
Manlin Xu ◽  
zhiqing Guo ◽  
...  
Keyword(s):  
Sclerotinia Sclerotiorum ◽  
Early Stage ◽  
Morphological Characteristics ◽  
Broad Host Range ◽  
Heat Shock Protein 60 ◽  
Potential Threat ◽  
Qinghai Province ◽  
First Report ◽  
Sequence Identity ◽  
Sclerotinia Blight

Historically, peanut has not been produced in Qinghai province located in Northwest China because of the high elevation and cold climates. However, since 2020 field studies have been conducted to evaluate peanut cultivars for suitability to field production. In 2020, peanut cultivation was successful for the first time in Haidong city, Qinghai province, China. In August 2020, brown, irregular-shaped lesions were observed on peanut stems from Qinghai province in China. In the early stage, the watersoaked spots were formed on the stems, then lesions expanded rapidly and became brown. In advanced stages of the disease, stems became bleached and eventually died. The inside of the stems was rotten and hollow, and the diseased stem wilted and died. White hyphae and black irregular shaped sclerotia were observed on the infected stems. Finally, local or whole plant rotted and died at the end. Approximately 10% of the plants in a field were infected. Symptomatic stems were cut into small pieces, disinfected with 75% ethanol for 1 minute, 0.5% NaClO for two minutes, and sterile water for three times. Pieces then were plated on potato dextrose agar (PDA) media and incubated at 25°C in darkness. Fungal colonies were initially white, becoming gray, then black sclerotia (2.4 to 6.0 mm in diameter) were appeared at the edge of colonies. Genomic DNA of the pure cultures of an isolate (ZHX7) was extracted and PCR was carried out using glyceraldehydes-3-phosphate dehydrogenase gene (G3PDH) region primers G3PDH-F/G3PDH-R, heat-shock protein 60 gene (HSP60) region primers HSP60-F/HSP60-R, and DNA-dependent RNA polymerase subunit gene (RPB2) region primers RPB2-F/RPB2-R (Staats et al., 2005), respectively. G3PDH region (Accession No. MZ388475) showed 99.44% sequence identity (887 bp out of 909 bp) to Sclerotinia sclerotiorum (Accession No. AJ705044, 887 bp out of 887 bp). HSP60 region (Accession No. MZ388476) showed 99.90% sequence identity (972 bp out of 984bp) to S. sclerotiorum (Accession No. AJ716048, 972 bp out of 980 bp). RPB2 region (Accession No. MZ388477) showed 100.00% sequence identity (1096 bp out of 1129 bp) to S. sclerotiorum (Accession No. AJ745716, 1096 bp out of 1096 bp). Phylogenetic analysis was done using Neighbor-Joining (NJ) analysis based on those gene sequences. The isolate was identified as S. sclerotiorum based on molecular analysis and morphological characteristics. For pathogenicity assay, ten-days-old potted peanut (Luhua No.12) seedlings were inoculated with one mycelial plug (8 mm in diameter ) by placing the inoculum on the base of the stem in a growth chamber (30°C in the day and 25°C at night, a 12-h photoperiod and 80% RH). All inoculated seedlings exhibited typical basal stem rot, and root showed different degrees of damage, and wilted 5 days after inoculation. No symptoms were observed on control plants treated with sterile distilled mycelial plugs, and S. sclerotiorum was consistently re-isolated from symptomatic tissue. S. sclerotiorum has been reported on peanut in Northeastern China (Yan et al., 2005). To our knowledge, this is the first report of S. sclerotiorum causing Sclerotinia Blight on peanut in Qinghai province, China. The peanut planting area in Qinghai has been further expanded this year, and S. sclerotiorum has a broad host range (Boland and Hall, 1994), so Sclerotinia Blight is a potential threat to peanut production, and as a result, it is critical for commercial producers to monitor plants for S. sclerotiorum.

Sucl+ encodes a predicted 13-kilodalton protein that is essential for cell viability and is directly involved in the division cycle of Schizosaccharomyces pombe

1987 ◽  
Vol 7 (1) ◽  
pp. 504-511 ◽  
Author(s):  
J Hindley ◽  
G Phear ◽  
M Stein ◽  
D Beach
Keyword(s):  
Cell Division ◽  
Schizosaccharomyces Pombe ◽  
Cell Cycle Control ◽  
Temperature Sensitive ◽  
Base Pairs ◽  
Direct Role ◽  
Protein Coding ◽  
Dna Fragment ◽  
Rna Transcript ◽  
Translational Product

Sucl+ was originally identified as a DNA sequence that, at high copy number, rescued Schizosaccharomyces pombe strains carrying certain temperature-sensitive alleles of the cdc2 cell cycle control gene. We determined the nucleotide sequence of a 1,083-base-pair Sucl+ DNA fragment and S1 mapped its 866-nucleotide RNA transcript. The protein-coding sequence of the gene is interrupted by two intervening sequences of 115 and 51 base pairs. The predicted translational product of the gene is a protein of 13 kilodaltons. A chromosomal gene disruption of Sucl+ was constructed in a diploid S. pombe strain. Germinating spores carrying a null allele of the gene were capable of very limited cell division, following which many cells became highly elongated. The Sucl+ gene was also strongly overexpressed under the control of a heterologous S. pombe promoter. Overexpression of Sucl+ is not lethal but causes a division delay such that cells are approximately twice the normal length at division. These data suggest that Sucl+ encodes a protein which plays a direct role in the cell division cycle of S. pombe.

scholarly journals Dissociation of the AT-specific bifunctional intercalator [N-MeCys3,N-MeCys7]TANDEM from TpA sites in DNA

1995 ◽  
Vol 306 (1) ◽  
pp. 15-19 ◽  
Author(s):  
M C Fletcher ◽  
R K Olsen ◽  
K R Fox
Keyword(s):  
Dissociation Rate ◽  
Dnase I ◽  
Time Dependent ◽  
Base Pairs ◽  
Unusual Structure ◽  
Dnase I Footprinting ◽  
Calf Thymus ◽  
Stability Of Complexes ◽  
Dna Fragment ◽  
The Stability

We have examined the dissociation of [N-MeCys3,N-MeCys7]TANDEM, an AT-selective bifunctional intercalator, from TpA sites in mixed-sequence DNAs by a modification of the footprinting technique. Dissociation of complexes between the ligand and radiolabelled DNA fragments was initiated by adding a vast excess of unlabelled calf thymus DNA. Portions of this mixture were subjected to DNAse I footprinting at various times after adding the competitor DNA. Dissociation of the ligand from each site was seen by the time-dependent disappearance of the footprinting pattern. Within a natural DNA fragment (tyrT) the ligand dissociates from TTAT faster than from ATAT. We found that the stability of complexes with isolated TpA steps decreases in the order ATAT > TTAA > TATA. Dissociation from each of these sites is much faster than from longer regions of (AT)n. These results confirm the requirement for A and T base-pairs surrounding the TpA step and suggest that the interaction is strongest with regions of alternating AT, possibly as a result of its unusual structure. The ligand dissociates more slowly from the centre of (AT)n tracts than from the edges, suggesting that variations in dissociation rate arise from sequence-dependent variations in local DNA structure.

scholarly journals Crystal structure of the DNA sequence d(CGTGAATTCACG)2with DAPI

2017 ◽  
Vol 73 (9) ◽  
pp. 500-504 ◽  
Author(s):  
Hristina I. Sbirkova-Dimitrova ◽  
Boris Shivachev
Keyword(s):  
Crystal Structure ◽  
Crystal Packing ◽  
Minor Groove ◽  
Van Der Waals Interactions ◽  
Water Molecules ◽  
X Ray Diffraction ◽  
Base Pairs ◽  
X Ray ◽  
Dna Molecule ◽  
Dna Fragment

The structure of 4′,6-diamidine-2-phenylindole (DAPI) bound to the synthetic B-DNA oligonucleotide d(CGTGAATTCACG) has been solved in space groupP212121by single-crystal X-ray diffraction at a resolution of 2.2 Å. The structure is nearly isomorphous to that of the previously reported crystal structure of the oligonucleotide d(CGTGAATTCACG) alone. The adjustments in crystal packing between the native DNA molecule and the DNA–DAPI complex are described. DAPI lies in the narrow minor groove near the centre of the B-DNA fragment, positioned over the A–T base pairs. It is bound to the DNA by hydrogen-bonding and van der Waals interactions. Comparison of the two structures (with and without ligand) shows that DAPI inserts into the minor groove, displacing the ordered spine waters. Indeed, as DAPI is hydrophobic it confers this behaviour on the DNA and thus restricts the presence of water molecules.

Sign in / Sign up

Export Citation Format

Share Document