scholarly journals Direct Polymerase Chain Reaction-Based Detection of Cercospora beticola in Field Soils

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1100-1104 ◽  
Author(s):  
R. T. Lartey ◽  
T. C. Caesar-TonThat ◽  
A. W. Lenssen ◽  
J. Eckhoff ◽  
S. L. Hanson ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Sugar Beet ◽  
Fragment Size ◽  
Rapid Screening ◽  
Cercospora Beticola ◽  
Field Soil ◽  
Chain Reaction ◽  
Field Soils ◽  
Total Dna ◽  
Polymerase Chain

Cercospora beticola, the causal agent of Cercospora leaf spot of sugar beet, survives as pseudostromata in infected sugar beet residues in the soil. Under optimal conditions, overwintering propagules germinate and produce conidia that are dispersed as primary inoculum to initiate infection in sugar beet. We developed a polymerase chain reaction (PCR) technique for rapid detection of C. beticola in field soils. Total DNA was first isolated from soil amended with C. beticola culture using the PowerSoil DNA Kit. The purified DNA was subjected to PCR in Extract-N-Amp PCR mix with CBACTIN primers over 35 cycles. The amplified products were resolved and compared by electrophoresis in 1% agarose gels. The PCR fragment size of C. beticola from the amended field soil correlated in size with the amplicon from control C. beticola culture DNA extract. Additionally, sample soils were collected from sugar beet fields near Sidney, MT and Foxholm, ND. Total DNA was extracted from the samples and subjected to PCR and resolved as previously described. The amplicons were purified from the gels and subjected to BigDye Terminator Cycle sequencing. All sequences from field soils samples, C. beticola-amended field soil, and pure culture were compared by alignment with a C. beticola actin gene sequence from GenBank. The result of the alignment confirmed the amplicons as products from C. beticola. Rapid screening for the presence of C. beticola in the soil by PCR will improve research capabilities in biological control, disease forecasting, and management of this very important sugar beet pathogen.

scholarly journals Easy and Efficient DNA Extraction from Woody Plants for the Detection of Phytoplasmas by Polymerase Chain Reaction

Plant Disease ◽  
1999 ◽  
Vol 83 (5) ◽  
pp. 482-485 ◽  
Author(s):  
Margaret J. Green ◽  
Dan A. Thompson ◽  
Donald J. MacKenzie
Keyword(s):  
Polymerase Chain Reaction ◽  
Plant Material ◽  
Woody Plant ◽  
Leaf Roll ◽  
Chain Reaction ◽  
Efficient Procedure ◽  
Identical Manner ◽  
Total Dna ◽  
Polymerase Chain ◽  
Selection Of

A simple and efficient procedure for the extraction of high-quality DNA from phytoplasma-infected woody and herbaceous plants for polymerase chain reaction (PCR) detection is described. This procedure does not require phenol, chloroform, or alcohol for the precipitation of nucleic acids. Herbaceous and woody plant material are extracted in an identical manner with no additional purification or enrichment steps required. The method utilizes commercially available microspin-column matrices, and the extraction of total DNA can be achieved in less than 1 h. The method has been used to successfully purify phytoplasma DNA from whole leaves, leaf petioles and midribs, roots, and dormant wood from a diverse selection of plant material. The phytoplasmas detected by PCR include pear decline, western X-disease, peach yellow leaf roll, peach rosette, apple proliferation, Australian grapevine yellows, and Vaccinium witches'-broom.

scholarly journals Barcode DNA Edelweis (Anaphalis javanica) Berdasarkan Gen matK

Jurnal MIPA ◽  
2015 ◽  
Vol 4 (2) ◽  
pp. 131
Author(s):  
Muzakir Rahalus ◽  
Maureen Kumaunang ◽  
Audy Wuntu ◽  
Julius Pontoh
Keyword(s):  
Polymerase Chain Reaction ◽  
Dna Sequences ◽  
Dna Barcode ◽  
Living Organism ◽  
Chain Reaction ◽  
Base Pairs ◽  
Barcode Dna ◽  
Reverse Primer ◽  
Total Dna ◽  
Polymerase Chain

DNA barcode merupakan metode identifikasi organisme hidup dengan menggunakan urutan DNA pendek (± 500 pasang basa). Tujuan dari penelitian ini adalah memperoleh barcode DNA Edelweis dan menganalisis kemiripan gen matK Edelweis (Anaphalis javanica) dengan kerabat terdekatnya. Isolasi DNA total Edelweis berhasil dilakukan dengan menggunakan  manual prosedur dari InnuPrep Plant DNA Kit yang dimodifikasi. Gen matK parsial telah diisolasi dengan metode Polymerase Chain Reaction (PCR) menggunakan Primer forward matK-1RKIM-f dan Primer Reverse matK-3FKIM-r. Hasil analisis sekuens menghasilkan barcode DNA edelweis berukuran 843 bp. Hasil analisis kemiripan menunjukkan tingkat kekerabatan terdekat dengan A. margaritaceae yaitu 99.86% pada BOLD System dan 100 % pada NCBI.DNA barcode is a method to identify living organism by using several short sequences of DNA (± 500 base pairs). The purpose of this study was to obtain a DNA barcode and analyze the similarity of matK genes of edelweis (Anaphalis javanica) with its closest relatives. Isolation of total DNA of edelweis has been succesfully done by using modified manual procedures of InnuPrep Plant Kit. matK partial gene has been isolated by the method of Polymerase Chain Reaction (PCR) using forward primer MATK-1RKIM-f and reverse primer MATK-3FKIM-r. Analysis of DNA sequences of edelweis confirmed its DNA barcode size was 843 bp. Furthermore, A. javanica showed similarity 99.86% in BOLD system and 100% in NCBI with A. margaritaceae.

scholarly journals Identifikasi Penyebab Penyakit Hawar Daun Bakteri Pada Kombinasi Pola Tanam System of Rice Intensification (SRI) dan Jajar Legowo

2021 ◽  
Author(s):  
Rini Laraswati ◽  
◽  
Evan Purnama Ramdan ◽  
Umi Kulsum ◽  
◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Xanthomonas Oryzae ◽  
System Of Rice Intensification ◽  
Chain Reaction ◽  
Rice Intensification ◽  
Total Dna ◽  
Polymerase Chain

Hawar daun bakteri (HDB) merupakan salah satu penyakit penting tanaman padi dengan kehilangan hasil mencapai 15-80%. Manipulasi iklim mikro melalui teknik pola tanam menjadi salah satu upaya pengendalian penyakit ini. Oleh karena itu, pada penelitian ini akan diidentifikasi penyebab penyakit HDB pada kombinasi pola tanam system of rice intensification (SRI) dan jajar legowo. Penelitian dilakukan di Balai Besar Peramalan Organisme Pengganggu Tanaman (BBPOPT), Jatisari, Karawang mulai bulan Agustus sampai September 2020. Kombinasi pola tanaman terdiri dari (1) SRI dengan kombinasi jarwo 2:1, (2) SRI dengan kombinasi jarwo 3:1, (3) SRI dengan kombinasi jarwo 4:1, (4) SRI dengan kombinasi jarwo 5:1, (5) SRI tanpa kombinasi, dan (6) Sistem tanem tegal (konvensional). Setiap petak kemudian dibagi menjadi 5 subpetak sebagai ulangan (1 titik di setiap sudut petak dan 1 titik di tengah-tengah petak). Gejala, kejadian dan keparahan penyakit diamati pada masing-masing subpetak. Tanaman yang menunjukkan gejala kemudian diidentifikasi secara molekuler dengan teknik polymerase chain reaction (PCR) meliputi proses ekstraksi total DNA dan amplifikasi nukleotida dengan menggunakan pasangan primer forward (F:CCTCTATGAGTCGGGAGCTG) dan primer reverse (R: ACACCGTGATGCAATGAAGA). Hasil pengamatan menunjukkan gejala berupa bercak abu-abu di tepi daun kemudian berkembang ke arah pangkal daun baik di satu atau dua sisi daun. Selanjutnya daun menjadi tidak beraturan dan mengering. Kejadian penyakit HDB sebesar 81.67 – 95%, sedangkan keparahan penyakit sebesar 27.97 – 42.44% disemua pola tanaman. Identifikasi dengan teknik PCR menunjukkan bahwa penyebab penyakit HDB adalah Xanthomonas oryzae pv. oryzae yang teramplifikasi pada band ukuran 230 – 250 bp.

scholarly journals Molecular Identification of Begomovirus Infecting Angled Luffa

2020 ◽  
Vol 24 (2) ◽  
pp. 147
Author(s):  
Alvina Clara Giovanni ◽  
Sedyo Hartono ◽  
Sri Sulandari ◽  
Susamto Somowiyarjo
Keyword(s):  
Polymerase Chain Reaction ◽  
Dna Sequencing ◽  
Molecular Identification ◽  
Leaf Shape ◽  
Mosaic Symptom ◽  
Chain Reaction ◽  
Central Java ◽  
Total Dna ◽  
Polymerase Chain ◽  
Luffa Acutangula

Begomovirus was reported as one of the most aggressive and destructive viruses on several commercial crops, including cucurbits in Indonesia. Plants that infected with Begomovirus show the mosaic symptom on the leaves, change in leaf shape, stunts, change in color and shape of fruit. It was recently observed in cultivated angled luffa [Luffa acutangula (L.) Roxb] around Yogyakarta and Central Java. The aim of this research was to identify the virus by using Polymerase chain reaction (PCR). The result of Begomovirus amplification from the total DNA samples amplification using primer Krusty-Homer showed that DNA of Begomovirus from angled luffa was amplified at ~580bp. The DNA sequencing of angled luffa’s leaf isolate GD1 had 97.8% homology with SCLV-China isolate MC1. However, amplification of DNA seed samples using the same primer showed negative result. It was concluded that Begomovirus was not a seed borne virus. This is the first molecular report on the occurence of Begomovirus in angled luffa in Yogyakarta.

DNA amplification from vegetative and sexual tissues of trees using polymerase chain reaction

1990 ◽  
Vol 20 (2) ◽  
pp. 254-257 ◽  
Author(s):  
Jean Bousquet ◽  
Luc Simon ◽  
Maurice Lalonde
Keyword(s):  
Polymerase Chain Reaction ◽  
Ribosomal Subunit ◽  
Dna Amplification ◽  
Cell Suspensions ◽  
Chain Reaction ◽  
Vegetative Tissues ◽  
Simple Protocol ◽  
Total Dna ◽  
Polymerase Chain ◽  
Specific Sequences

A simple protocol for the extraction of total DNA from minute amounts of tissues and subsequent amplification of specific sequences by polymerase chain reaction is presented. The method is applicable to a wide variety of vegetative tissues such as leaves, single needles and rootlets, cell suspensions, and also single sexual embryos and megagametophytes derived from a variety of gymnosperms and perennial angiosperms. Amplification of DNA is shown using pairs of primers specific to genes that encode the small ribosomal subunit.

Sign in / Sign up

Export Citation Format

Share Document