scholarly journals Tomato as a New Host of Erwinia carotovora subsp. carotovora in Argentina

Plant Disease ◽  
1997 ◽  
Vol 81 (2) ◽  
pp. 230-230 ◽  
Author(s):  
A. M. Alippi ◽  
E. Dal Bó ◽  
L. B. Ronco ◽  
P. E. Casanova ◽  
O. M. Aguilar
Keyword(s):  
Type Strain ◽  
Disease Incidence ◽  
Tween 80 ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Physiological Characteristics ◽  
Maximum Temperature ◽  
New Host ◽  
Tomato Plants ◽  
Dna Profiles

In 1995, fruiting tomato plants (Lycopersicon esculentum Mill. hybrid Tommy) from different commercial greenhouses near La Plata and near Chacabuco (Province of Buenos Aires) had symptoms similar those caused by Erwinia carotovora subsp. carotovora (1,4). Stems of the infected plants were rotted and produced adventitious roots. The cortex on the basal part of the stems turned black and sloughed off easily. The pith disintegrated and stems appeared hollow. Disease incidence of 2% was common, and nearly 10% of the plants in wetter areas of greenhouses were affected. Bacteria consistently isolated from diseased stems formed white-to-cream-colored colonies on yeast dextrose calcium carbonate agar (YDC). Bacteria from purified colonies were gram negative, oxidase negative, arginine dyhidrolase negative, catalase positive, methyl red positive, and facultatively anaerobic. Tests on four strains showed all fermented glucose, reduced nitrates to nitrites, and grew at a maximum temperature of 37 to 40°C. Strains did not hydrolyse starch nor utilize Tween 80. All strains were resistant to erythromycin in an antibiotic disk (15 μg) assay. Acid was produced from D(+)-glucose, D -mannitol, sucrose, D(+)-cellobiose, L(+)-rhamnose, L(+)-arabinose, D(+)-galactose, and D(+)-trehalose, but not from D-arabinose, D-sorbitol, and maltose. Bacteria utilized maleate and citrate but not propionate, benzoate, or malonate. The strains caused soft rot of pepper fruits and carrot slices within 24 h at 25°C. Pathogenicity was confirmed by needle stab inoculation at the primary leaf node on five plants each of 6-week-old greenhouse-grown tomato hybrids Presto and Parador. Inoculum was from 24-h-old cultures on YDC. Control plants were stab inoculated with needles dampened in sterile water. All plants were covered with polyethylene bags for 48 h at 25°C. Within 24 h after inoculation, watersoak and rot were detected; and during the next 48 h, plants wilted. Controls remained healthy. The bacterium was readily isolated from inoculated plants. Tests showed physiological characteristics identical to those of the bacteria used as inoculum. The pathogen was identified as Erwinia carotovora subsp. carotovora based on morphological, biochemical, and physiological characteristics and on pathogenicity. Reactions were identical to those of the type strain ATCC 15713 that had been included in all tests for comparison. Further identity was shown by polymerase chain reaction utilizing ERIC primers to generate DNA profiles (3). Profiles of the pathogen or the type strain were very similar to those from bacteria recovered from inoculated plants. This is the first known occurrence of a disease caused by Erwinia carotovora subsp. carotovora on greenhouse-grown tomato plants in Argentina, although it has been reported as causing soft rot of vegetables after harvest (2). References: (1) B. N. Dhanvantari and V. A. Dirks. Phytopathology 77:1457, 1987. (2) L. Halperin and L. S. Spaini. Rev. Arg. Agron. 6:261, 1939. (3) F. J. Louws et al. Appl. Environ. Microbiol. 60:2286, 1994. (4) D. E. Speights et al. Phytopathology 57: 902, 1967.

scholarly journals An Outbreak of Bacterial Stem Rot of Dieffenbachia amoena Caused by Erwinia carotovora subsp. carotovora in the Eastern Mediterranean Region of Turkey

Plant Disease ◽  
2004 ◽  
Vol 88 (3) ◽  
pp. 310-310 ◽  
Author(s):  
R. Cetinkaya-Yildiz ◽  
M. Mirik ◽  
Y. Aysan ◽  
M. Kusek ◽  
F. Sahin
Keyword(s):  
Mediterranean Region ◽  
Eastern Mediterranean ◽  
Disease Incidence ◽  
Eastern Mediterranean Region ◽  
Acid Methyl Ester ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Stem Rot ◽  
Tomato Plants ◽  
Rot Disease

Severe outbreaks of bacterial stem rot disease occurred on dieffenbachia plants (Dieffenbachia amoena cv. Tropic Snow) during the autumn and spring seasons of 2002 and 2003 in two commercial glasshouses (3.5 ha) near Adana and Mersin in the Eastern Mediterranean Region of Turkey. Characteristic symptoms of the disease were wilting of the lower leaves, darkening and water soaking of the leaves and stem at or below the soil level, and browning in the vessel and pith of the diseased plants. Eventually, the stem and leaves completely rotted, and the plants collapsed. Nearly 30 and 40% (2002 and 2003, respectively) of the 20,000 potted plants in the glasshouses were destroyed because of the disease. Cuttings often developed a typical soft rot during propagation. Disease incidence was estimated at approximately 50% on propagating material during 2003. Isolations were made from rotted stems, leaves, and discolored vessels of the dieffenbachia plants on King's medium B. Bacteria consistently isolated from the diseased tissues formed white-to-cream colonies on the medium. Bacteria from purified colonies were gram, oxidase, and arginine dyhidrolase negative, catalase positive, and facultative anaerobic. Ten representative strains all fermented glucose and reduced nitrates to nitrites. The strains caused soft rot of potato slices within 24 h at 25°C. All strains were resistant to erythromycin in an antibiotic disk (15 μg) assay. Negative results were obtained from utilization of α-methyl glycoside, reducing substance from sucrose, and indole production from tryptophane and phosphathase activity. Positive results were obtained from pectate, aesculin, and gelatine liquefaction for all strains. Acid was produced from glucose, sucrose, mannitol, mannose, lactose, raffinose, melibiose, trehalose, and L(+)-arabinose but not Darabinose, sorbitol, inulin, and maltose. Pathogenicity was confirmed by needle-stab inoculation at the stem on three plants each of dieffenbachia and tomato plants (5-week-old cv. H-2274). Sterile distilled water was used as a negative control. All plants were covered with polyethylene bags for 48 h at 25°C. Within 72 h after inoculation, water-soaking and soft-rot symptoms were observed on dieffenbachia and tomato plants. All of the bacterial strains isolated in the present study were identified as Erwinia carotovora subsp. carotovora (Jones) based on fatty acid methyl ester analysis with similarity indices ranging from 80 to 94%. Furthermore, Biolog GN (Department of Plant Protection, Faculty of Agriculture, Ataturk University, Erzurum, Turkey) profiles identified them as the same pathovar with similarity values of 67 to 72%. All of the test results were similar to those of reference strain GSPB 435 (Gottinger Sammlung phytopathogener Bakterien, Georg-August University, Gottingen, Germany) of E. carotovora subsp. carotovora used in this study. To our knowledge, this is the first report of the occurrence and outbreak of a bacterial rot disease on dieffenbachia grown in the Eastern Mediterranean Region of Turkey. Contaminated cuttings may be the primary source of inoculum within and between glasshouses.

scholarly journals First Report of Bacterial Leaf Spot of Basil Caused by Pseudomonas viridiflava in Argentina

Plant Disease ◽  
1999 ◽  
Vol 83 (9) ◽  
pp. 876-876 ◽  
Author(s):  
A. M. Alippi ◽  
S. Wolcan ◽  
E. Dal Bó
Keyword(s):  
Leaf Spot ◽  
Disease Incidence ◽  
Tween 80 ◽  
Pathogenic Fungi ◽  
Soft Rot ◽  
Bacterial Leaf Spot ◽  
First Report ◽  
Arginine Dihydrolase ◽  
Pseudomonas Viridiflava ◽  
Physiological Tests

In June 1998, during a cool, humid period, typical bacterial spot symptoms were observed on basil plantlets (Ocimun basilicum L. ‘Royal Louis’ and ‘Zaes’) in a commercial greenhouse in La Plata, Argentina. Affected plants had dark brown to black lesions on cotyledons. Spots on leaves were first water soaked, then became necrotic and progressed inward from the margins. Disease incidence approached 30%. Symptoms were similar to those reported by Little et al. (2) on basil affected by Pseudomonas viridiflava. No pathogenic fungi or viruses were associated with symptomatic plants. Bacterial streaming was observed from lesion margins. Bacteria consistently isolated from leaf lesions formed cream-colored, glistening, convex colonies on sucrose peptone agar and a green fluorescent pigment on King's medium B. Bacterial growth produced a distinctive olive green pigment on glycerol agar medium and a pink pigment on T-5 medium (1). Four isolates selected for further study were aerobic, Gram-negative, non-spore-forming rods. In LOPAT (levan-oxidase-potato rot-arginine dihydrolase-tobacco hypersensitivity) tests, all induced a hypersensitive response in tobacco plants, caused soft rot of potato tubers, and were negative for levan, oxidase, and arginine dihydrolase. In addition, strains rotted onion slices and produced a reddish sunken lesion on bean pods. Acid was produced aerobically from D-glucose, mannitol, mesoinositol and sorbitol, but not from D-arabinose, L-rhamnose, melibiose, amygdalin, or sucrose. Bacteria used D-tartrate, pyruvate, and citrate, but not benzoate. The strains did not hydrolyze starch, exhibited an oxidative metabolism of glucose, and did not reduce nitrates to nitrites or accumulate poly-β-hydroxybutyrate inclusions. Negative reactions were obtained with indole, ornithine, and D-tryptophan. Isolates hydrolyzed gelatine, used Tween 80, were positive for catalase, and were unable to grow in the presence of 5% NaCl. Colonies developed at 4°C but not 37°C. Reactions were identical to those of reference strains ICMP 5776 and 12363, which were included in all tests for comparison. Pathogenicity was verified on 35-day-old basil plants by both spraying and infiltration inoculations with bacterial suspensions (108 and 105 cells per ml, respectively). Carborundum was included in the inoculum used for a set of plants inoculated by spraying. Controls were injected or sprayed (with and without Carborundum) with sterile, distilled water. In addition, bean (Phaseolus vulgaris cv. Nag12 INTA) and lettuce (Lactuca sativa cv. criolla), both reported as host plants, were inoculated by spraying with bacterial suspensions of 107 cells per ml plus Carborundum. After 48 h in a humid chamber, inoculated plants and controls were maintained at 23 ± 3°C. Symptoms on basil plants inoculated by injection or spraying with Carborundum were identical to those observed on basil in the field. Symptoms on bean and lettuce were similar to those described for P. viridiflava. The bacterium was reisolated from lesions of all species tested, fulfilling Koch's postulates. No lesions were observed on controls or on plants sprayed without Carborundum, suggesting that bacteria gain entry through wounds. The microorganism was identified by physiological tests and polymerase chain reaction as P. viridiflava. This is the first report of bacterial leaf spot of basil in Argentina. References: (1) R. Gitaitis et al. Plant Dis. 81:897, 1997. (2) E. L. Little et al. Plant Dis. 78:831, 1994.

scholarly journals First Report of Erwinia carotovora subsp. carotovora Causing Bacterial Root Rot of Sweetpotato (Ipomoea batatas) in Louisiana

Plant Disease ◽  
1998 ◽  
Vol 82 (1) ◽  
pp. 129-129 ◽  
Author(s):  
C. A. Clark ◽  
M. W. Hoy ◽  
J. P. Bond ◽  
C. Chen ◽  
Y.-K. Goh ◽  
...  
Keyword(s):  
Root Rot ◽  
Ipomoea Batatas ◽  
Disease Incidence ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Stem Rot ◽  
Identification System ◽  
Natural Occurrence ◽  
Storage Roots ◽  
First Report

Bacterial root and stem rot of sweetpotato (Ipomoea batatas (L.) Lam.) was first fully characterized in the U.S. in 1977 (2). It was thought to be caused exclusively by Erwinia chrysanthemi. Although a previous report described sweetpotato as a host for E. carotovora subsp. carotovora, based on artificial inoculations, others have reported that neither E. carotovora subsp. carotovora nor E. carotovora subsp. atroseptica decay sweetpotato storage roots (1). In October 1995, storage roots of sweetpotato cv. Beauregard were received from St. Landry Parish, LA, that displayed typical bacterial root rot. Isolations from these roots yielded bacteria that showed a similarity of 0.945 to E. carotovora subsp. carotovora with the Biolog GN Bacterial Identification System (version 3.50). This isolate (Ecc-LH) also differed from isolates of E. chrysanthemi (Ech) from sweetpotato and other hosts in that it was insensitive to erythromycin, did not produce phosphatase or lecithinase, and did not produce gas from glucose. Ecc-LH differed from known strains of E. carotovora subsp. atroseptica in that it did not produce reducing substances from sucrose or acid from palatinose. When Beauregard storage roots were inoculated by inserting micropipette tips containing 50 μl of 1.0 × 108 CFU/ml, both Ecc-LH and Ech-48 produced typical bacterial root rot symptoms. However, when they were compared by infectivity titrations at 28 to 32°C, Ecc-LH was less virulent than Ech-48. Ecc-LH had an ED50 of approximately 1.0 × 106 CFU/ml and did not cause appreciable disease below inoculum concentrations of 1.0 × 105, whereas Ech-48 had an ED50 of approximately 1.0 × 108 and caused soft rot at the lowest concentration tested, 1.0 × 103. Similar disease incidence was observed in infectivity titrations at 22 to 24°C, but Ech-48 caused less severe soft rot. E. carotovora subsp. carotovora was reisolated from inoculated storage roots and its identity was reconfirmed by Biolog. When terminal vine cuttings of Beauregard were dipped in 1.0 × 108 CFU/ml and planted in a greenhouse, bacterial stem rot symptoms developed on plants inoculated with Ech-48 at about 4 weeks postinoculation, or when new growth began. However, no symptoms developed on plants inoculated with Ecc-LH. This is the first report of natural occurrence of E. carotovora subsp. carotovora causing bacterial root rot of sweetpotato in Louisiana. E. chrysanthemi remains the most important pathogen causing bacterial soft rot in sweetpotato since it is widely associated with sweetpotato, is more virulent on storage roots and also causes a stem rot. E. carotovora subsp. carotovora can cause root rot, but has been isolated in only one location to date, is less virulent on storage roots, and apparently does not cause stem rot on the predominant cultivar in U.S. sweetpotato production, Beauregard. References: (1) C. A. Clark and J. W. Moyer. 1988. Compendium of Sweet Potato Diseases. American Phytopathological Society, St. Paul, MN. (2) N. W. Schaad and D. Brenner. Phytopathology 67:302, 1977.

scholarly journals Outbreak of Erwinia carotovora on Zantedischia spp. in South Africa

Plant Disease ◽  
1999 ◽  
Vol 83 (10) ◽  
pp. 966-966
Author(s):  
E. L. Mansvelt ◽  
E. Carstens
Keyword(s):  
South Africa ◽  
Reference Strain ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Maximum Temperature ◽  
Initial Symptom ◽  
Cut Flower ◽  
Arginine Dihydrolase ◽  
Potato Slices ◽  
Tuber Rot

In South Africa, summer-flowering Arum lilies are grown for the tuber, potted plant, and cut flower markets. In 1998, an outbreak of soft rot was detected on Zantedischia oculata cv. Black Magic and Z. elliottiana plants from several nurseries. Crop losses of up to 25% were incurred. The initial symptom was wilting of leaves. When plants were lifted from the soil, soft rot of the tuber was found. Tuber rot usually developed on one side, and plants developing from affected tubers wilted and died. No discoloration of leaf or tuber tissues was found. Isolations from diseased tissues consistently yielded bacterial colonies that were translucent, white, and glistening and that had entire margins on nutrient agar. Ten representative isolates were chosen for further characterization. Erwinia carotovora subsp. carotovora strain B56 was included as a reference strain. All isolates were gram-negative rods, oxidase and arginine dihydrolase negative, catalase positive, and facultatively anaerobic. They degraded pectate and rotted potato slices but did not hydrolyze starch. All isolates fermented glucose, reduced nitrates to nitrites, and grew at a maximum temperature of 37°C. Isolates produced acids from D(+)-glucose, D(+)-cellobiose, melibiose, amygdalin, L(+)-arabinose, D-mannitol, L(+)-rhamnose, sucrose, ribose, D(-)xylose, and D(-)glucose but not from D-arabinose, D-sorbitol, or maltose. Isolates liquefied gelatin and used citrate, arbutine, esculin, salicin, and cellobiose as the sole carbon source. Pathogenicity to Zantedischia spp. was tested by injection of tubers with an inoculum suspension containing 108 CFU/ml. Control plants were inoculated with sterile distilled water. Inoculated plants were kept in a greenhouse at 24°C. Symptoms developed 2 days after inoculation with the pathogen and appeared to be identical to those observed on diseased material in nurseries. Control plants did not rot. The bacterium was readily reisolated from diseased plants, confirmed to be the inoculated pathogen, and identified as E. carotovora, based on morphological, biochemical, and physiological characteristics and pathogenicity. E. aroideae has been reported to cause soft rot of rhizomes of winter-flowering Arum lilies (Z. aethiopica) in South Africa (1). However, this is the first report of soft rot caused by E. carotovora subsp. carotovora on tubers of Z. oculata and Z. elliottiana plants in South Africa. Reference: (1) V. Wager. 1970. Flower Garden Diseases and Pests. Purnell, Cape Town, South Africa.

scholarly journals Effect of Sprinkler Irrigation on Bacterial Soft Rot and Yield of Broccoli

Plant Disease ◽  
1997 ◽  
Vol 81 (6) ◽  
pp. 614-618 ◽  
Author(s):  
R. L. Ludy ◽  
M. L. Powelson ◽  
D. D. Hemphill
Keyword(s):  
Irrigation System ◽  
Disease Incidence ◽  
Low Frequency ◽  
Sprinkler Irrigation ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Field Studies ◽  
Bacterial Soft Rot ◽  
Irrigation Frequency ◽  
Applied Water

The effect of amount of applied water under two irrigation frequencies (once versus three times per week) on the incidence of bacterial soft rot, caused by Erwinia carotovora subsp. carotovora, and yield of broccoli was investigated in field studies conducted in 1987 and 1988. At head initiation, the amount of applied water was varied by utilizing a line source irrigation system. Incidence of soft rot was higher in the OSU breeding line 86-3 plots, followed by cv. Citation and then cv. Gem. Soft rot was not consistently affected by amount of applied water. Differences in amount of disease were apparent, however, between the separate irrigation frequency studies in 1988; disease incidence more than doubled under the high- compared with the low-frequency irrigation. Further studies on the effects of frequency and timing of sprinkler irrigation on soft rot and yield of Gem broccoli were undertaken in 1993 and 1994. Six sprinkler irrigation regimes, a factorial combination of frequency (irrigation every 2, 4, or 8 days) and timing (morning or evening), were established. Total water applied did not differ by treatment. Incidence of soft rot was negligible at the first harvest in both years. At the last harvest, the incidence of soft rot was significantly reduced, from 22 to 10% in 1993 and from 30 to 15% in 1994, by the change in frequency of irrigation from 2 to 8 days. In contrast, timing of irrigation had no effect on disease incidence. Yield of broccoli was not affected by either frequency or timing of irrigation.

Screening of Antagonistic Bacterium to Control Konjac Soft Rot

2013 ◽  
Vol 726-731 ◽  
pp. 4427-4430
Author(s):  
Guo Hua Chen
Keyword(s):  
Bacterial Strain ◽  
Bacterial Pathogen ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Field Trials ◽  
Antagonistic Effect ◽  
Soil Samples ◽  
Plate Method ◽  
Antagonistic Bacterium

Konjac soft rot is a bottleneck limiting konjac yield caused by bacterial strain of Erwinia carotovora var. carotovora. In order to control konjac soft rot, soil samples were collected, and each sample was spread on surface of a plate seeded with E. carotovora var. carotovora in advance. Strains expressing antagonistic activities were selected and then isolated with streak plate method. One bacterial strain (named Z10) was obtained from soil by this method. In field trials, strain Z10 still showed antagonistic effect against the bacterial pathogen.

scholarly journals Molecular characterization of chickpea chlorotic dwarf virus and peanut witches’ broom phytoplasma associated with chickpea stunt disease and identification of new host crops and leafhopper vectors in India

3 Biotech ◽  
2021 ◽  
Vol 11 (3) ◽  
Author(s):  
Madem Gurivi Reddy ◽  
Virendra Kumar Baranwal ◽  
Doddachowdappa Sagar ◽  
Govind Pratap Rao
Keyword(s):  
Sequence Comparison ◽  
Disease Incidence ◽  
Uttar Pradesh ◽  
Rflp Analysis ◽  
Dwarf Virus ◽  
Rrna Gene ◽  
New Delhi ◽  
New Host ◽  
Severe Stunting ◽  
Virtual Rflp

AbstractAn investigation was carried out to identify and characterize the phytoplasma and viruses associated with the chickpea varieties showing severe stunting, leaf reddening, yellowing and phyllody symptoms during the summer season of 2018–2019 and 2019–2020 in eight states of India. The average disease incidence was recorded from 3 to 32% in different states. The presence of chickpea chlorotic dwarf virus (CpCDV) was confirmed in thirty-seven chickpea samples by amplification of CpCDV coat protein gene and sequence comparison analysis. No record of association of luteovirus, polerovirus and cucumovirus could be detected in any of the symptomatic chickpea samples by RT-PCR assay. Brassica nigra, B. juncea, Lens culinaris, two weeds (Heteropogan contartus, Aeschynomene virginica) and one leafhopper (Amarasca biguttula) were identified as new putative hosts for CpCDV. Association of peanut witches’ broom phytoplasma was confirmed in twenty-eight chickpea samples, Sesamum indicum, five weeds hosts and two leafhopper species (Exitianus indicus, Empoasca motti) using nested PCR assays with primer pairs P1/P7 and R16F2n/R16Rn. The results of phytoplasma association in plants and leafhopper samples were further validated by using five multilocus genes (secA, rp, imp, tuf and secY) specific primers. Sequence comparison, phylogenetic and virtual RFLP analysis of 16S rRNA gene and five multilocus genes confirmed the identity of association of 16SrII-C and 16SrII-D subgroups of phytoplasmas strain with chickpea samples collected from Andhra Pradesh (AP), Telangana, Karnataka, Madhya Pradesh, Uttar Pradesh and New Delhi. Mixed infection of phytoplasma (16SrII-D) and CpCDV was also detected in symptomatic chickpea samples from AP and Telangana. The reports of association of 16SrII-C subgroup phytoplasma in chickpea and 16SrII-D subgroup phytoplasma in C. sparsiflora and C. roseus are the new host records in world and from India, respectively.

Assessing potato cultivars for resistance to tuber soft rot (Erwinia carotovora subsp.atroseptica) at four test centres in the UK

1988 ◽  
Vol 31 (1) ◽  
pp. 67-72 ◽  
Author(s):  
R. L. Wastie ◽  
G. J. Jellis ◽  
D. H. Lapwood ◽  
C. Logan ◽  
G. Little ◽  
...  
Keyword(s):  
Erwinia Carotovora ◽  
Soft Rot ◽  
Potato Cultivars ◽  
Erwinia Carotovora Subsp.Atroseptica ◽  
The Uk ◽  
Soft Rot Erwinia

scholarly journals Isolation, Characterization, and Identification of Biological Control Agent for Potato Soft Rot in Bangladesh

2012 ◽  
Vol 2012 ◽  
pp. 1-6 ◽  
Author(s):  
M. M. Rahman ◽  
M. E. Ali ◽  
A. A. Khan ◽  
A. M. Akanda ◽  
Md. Kamal Uddin ◽  
...  
Keyword(s):  
Biological Control ◽  
Biological Control Agent ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Control Agent ◽  
Antagonistic Activity ◽  
Antagonistic Effect ◽  
Antagonistic Bacteria ◽  
And Storage

A total of 91 isolates of probable antagonistic bacteria of potato soft rot bacteriumErwinia carotovorasubsp.carotovora(Ecc) were extracted from rhizospheres and endophytes of various crop plants, different soil varieties, and atmospheres in the potato farming areas of Bangladesh. Antibacterial activity of the isolated probable antagonistic bacteria was testedin vitroagainst the previously identified most common and most virulent soft rot causing bacterial strain Ecc P-138. Only two isolates E-45 and E-65 significantly inhibited thein vitrogrowth of Ecc P-138. Physiological, biochemical, and carbon source utilization tests identified isolate E-65 as a member of the genusBacillusand the isolate E-45 asLactobacillussp. The stronger antagonistic activity against Ecc P-138 was found in E-65in vitroscreening and storage potatoes. E-65 reduced the soft rot infection to 22-week storage potatoes of different varieties by 32.5–62.5% in model experiment, demonstrating its strong potential to be used as an effective biological control agent for the major pectolytic bacteria Ecc. The highest (62.5%) antagonistic effect of E-65 was observed in the Granola and the lowest (32.7%) of that was found in the Cardinal varieties of the Bangladeshi potatoes. The findings suggest that isolate E-65 could be exploited as a biocontrol agent for potato tubers.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Sign in / Sign up

Export Citation Format

Share Document