scholarly journals First Report of Gloeosporidina sp. Isolated from Lesions on Shoots and Leaves of Eucalyptus nitens and E. globulus in Australia

Plant Disease ◽  
2000 ◽  
Vol 84 (5) ◽  
pp. 510-512 ◽  
Author(s):  
Z. Q. Yuan ◽  
T. Wardlaw ◽  
C. Mohammed
Keyword(s):  
Morphological Characteristics ◽  
First Record ◽  
Eucalyptus Nitens ◽  
First Report ◽  
First Time ◽  
Mitosporic Fungus

A mitosporic fungus with small conidia was frequently isolated from blighted shoots and leaves of young plantation trees and nursery seedlings of Eucalyptus nitens and E. globulus in Tasmania. Lesions on these shoots and leaves are purple to light brown, becoming necrotic with well-defined margins. The fungus is characterized by having acervular conidiomata, cylindrical to lageniform monophialidic conidiogenous cells, and spheroid to pyriform conidia that are hyaline, aseptate, and often produced in chains. The morphological characteristics fit the published description for the genus Gloeosporidina. This is the first record of a member in the genus from Australia and the first time a Gloeosporidina species has been found on eucalypts.

scholarly journals First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1019-1019 ◽  
Author(s):  
Y. F. Wang ◽  
S. Xiao ◽  
Y. K. Huang ◽  
X. Zhou ◽  
S. S. Zhang ◽  
...  
Keyword(s):  
Morphological Characteristics ◽  
Severe Infection ◽  
Original Description ◽  
First Record ◽  
Vegetable Crops ◽  
Species Identity ◽  
Fujian Province ◽  
First Report ◽  
Lateral Lines ◽  
Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

FIRST RECORD ON HOST PLANTS AND TAXONOMICAL DESCRIPTION ON Aptopus opata (ELATERIDAE: CARDIOPHORINAE: CARDIOPHORINI) FROM SINDH PAKISTAN

2020 ◽  
Vol 27 (1) ◽  
pp. 415-424
Author(s):  
Shabana Mangi
Keyword(s):  
Light Trap ◽  
Lateral Lobe ◽  
Morphological Characteristics ◽  
First Record ◽  
Pest Species ◽  
South Central ◽  
Sindh Province ◽  
Significant Damage ◽  
Germinating Seeds ◽  
First Time

Aptopus Eschscholtz is a native of the Mexico sonar light trap Huachuca Mountain of south central Arizona. This species has been first time observed from district Khairpur Sindh province of Pakistan from (March 2018 to October 2019), these observation represent first record of this species from Sindh or Pakistan. This description and illustrations are provided for easy identification, they cause significant damage to crops, they are pest species and omnivores feeder, especially on maize crops, potatoes, tomatoes and germinating seeds, weeds and small grasses overall in worldwide, its larva is yellowish to brown in color, from damage use the granules insecticides at planting time will prevent from wireworm, Aptopus opata is a differ from the closely allied species on the basis of genitalial and morphological characteristics body lengthened, dark brown to blackish with densely punctuations, prontal angles lengthened, pointed, scutellum blackish spot like, legs lengthened, aedeagus wider than longer, base broader, lateral lobe parameres slightly bigonal, with have golden hairs, at apex, median lobe parameres, broad at basal, rapidly narrowing apically, hairs like structure view from the ventral aspects.

First records of peracarid crustaceans from the Cayo Matias Ocean Blue Hole, SW Cuba, with the description of two new species

Zootaxa ◽  
2012 ◽  
Vol 3505 (1) ◽  
pp. 53 ◽  
Author(s):  
MANUEL ORTIZ ◽  
IGNACIO WINFIELD ◽  
CARLOS VARELA
Keyword(s):  
New Species ◽  
First Record ◽  
Filamentous Algae ◽  
First Report ◽  
Blue Hole ◽  
Two New Species ◽  
First Time

First records of peracarid crustaceans obtained from the Cayo Matías Ocean Blue Hole, southwestern Cuba, aredocumented. In addition, two new species of isopod and amphipod are herein described. Gnathia micheli n. sp. (Isopoda,Gnathiidae) and Boca normae n. sp. (Amphipoda, Aristiidae) were associated with filamentous algae at a depth of 20 m.Both represent the first report for a blue hole and the amphipod constitutes the first record of the genus for Cuba and theCaribbean Sea. Three other isopods, i.e. Gnathostenetroides sp., Cirolana parva, and Cirolana crenulitelson, and the cumacean Procampylaspis sp. are documented for the first time from the same blue hole.

Helminths of the vagrant shrew, Sorex vagrans, from western Montana, USA

2007 ◽  
Vol 52 (2) ◽  
Author(s):  
John Kinsella
Keyword(s):  
North America ◽  
First Record ◽  
Helminth Species ◽  
Western Montana ◽  
First Report ◽  
Sorex Vagrans ◽  
First Time

AbstractA total of 19 helminth species (1 trematode, 11 cestodes, 7 nematodes) were collected from 45 vagrant shrews, Sorex vagrans (Mammalia, Soricidae), in western Montana, USA. One trematode (Brachylaima sp.), 2 cestodes (Paruterina candelabraria, Staphylocystoides longi), and 6 nematodes (Baruscapillaria rauschi, Eucoleus oesophagicola, Longistriata meylani, Paracrenosoma sp., Parastrongyloides winchesi, Pseudophysaloptera formosana) are reported for the first time from this host. Baruscapillaria rauschi n. comb. is proposed for Capillaria rauschi Read, 1949. This is the first record of merocercoids of P. candelabraria from a shrew, and the first report of the genus Paracrenosoma in North America.

scholarly journals A first record of Pestalotiopsis clavispora in Argan mass cutting propagation: Prevalence, prevention and consequences for plant production

2011 ◽  
Vol 90 (3) ◽  
pp. 117-120
Author(s):  
Mustapha Bakry ◽  
Guy Bussières ◽  
Mohammed S. Lamhamedi ◽  
Hank A. Margolis ◽  
Debra C. Stowe ◽  
...  
Keyword(s):  
Mortality Rate ◽  
Success Rate ◽  
Molecular Analysis ◽  
Morphological Characteristics ◽  
First Record ◽  
Plant Production ◽  
Mass Propagation ◽  
Cutting Propagation ◽  
Apical Buds ◽  
First Time

A trial involving the mass propagation of Argania spinosa cuttings was established following two protocols: in mini-bouturathèques without mist and in a greenhouse under mist. Symptoms of petiole necrosis, foliar yellowing and abundant black acervuli were observed under both protocols. These symptoms were responsible for a 90% mortality rate in the mini-bouturathèques while under the mist treatment premature fatal necrosis of the apical buds resulted in 100% mortality. The disease’s causal agent, Pestalotiopsis clavispora, was identified on the basis of its morphological characteristics and by molecular analysis. Alternating weekly treatments of systemic and contact fungicides resulted in a 41% success rate in controlling this pathogen, described for the first time on argan cuttings.

scholarly journals FIRST RECORD OF HERMETIA ILLUCENS (LINNAEUS, 1758) – BLACK SOLDIER FLY, FROM NEPAL

2020 ◽  
Vol 5 (1) ◽  
pp. 21-23
Author(s):  
Biplov Sapkota ◽  
Shristi Upadhyaya ◽  
Anuj Lamichhane ◽  
Rajendra Regmi ◽  
Kuldip Ghimire ◽  
...  
Keyword(s):  
Organic Waste ◽  
Animal Feed ◽  
Morphological Characteristics ◽  
First Record ◽  
Feed Ingredient ◽  
Black Soldier Fly ◽  
Hermetia Illucens ◽  
Animal Feeding ◽  
Simple Systems ◽  
First Time

Hermetia illucens (Linnaeus, 1758)- Black soldier fly is a beneficial insect which has been used in simple systems, to treat organic waste efficiently and rapidly, and to produce animal feed ingredient and fertilizer as end products. These flies are naturally found in warmer parts of the globe. The incidence of Black soldier fly was recorded for the first time in Nepal in between April and May 2020 in the sub urban area of Chitwan District, Nepal. Identification of the insect was done in the Laboratory of Department of Entomology, Faculty of Agriculture, Agriculture and Forestry University, Nepal. Both adult and larval forms of the insect were identified based on the study of morphological characteristics of captured specimens using simple microscope and stereomicroscope. The record of this insect in Nepal opens up a new dimension for its use in bio-systems to treat organic waste and produce more sustainable ingredient for animal feeding, and rich fertilizer to be used in agriculture.

scholarly journals New faunistic and taxonomic notes on the Haplogyne and Cribellate spiders (Araneae: Dictynidae, Dysderidae, Eresidae, Filistatidae, Sicariidae) from three Balkan countries

2021 ◽  
Vol 67 (1) ◽  
pp. 63-76
Author(s):  
Maria Naumova ◽  
Christo Deltshev
Keyword(s):  
Balkan Peninsula ◽  
First Record ◽  
Spider Species ◽  
First Report ◽  
Balkan Countries ◽  
First Time

In this paper, we report for the first time two spider species for Albania, four for Bulgaria and two for Greece: Altella lucida (Simon, 1874) (Bulgaria), Eresus moravicus Rezác, 2008 (Bulgaria and Greece), Filistata insidiatrix (Forsskål, 1775) (Albania), Harpactea samuili Lazarov, 2006 (Greece), Loxosceles rufescens (Dufour, 1820) (Albania), Pritha parva Legittimo, Simeon, Di Pompeo et Kulczycki, 2017 (Bulgaria) and Pritha vestita (Simon, 1873) (Bulgaria). The recently described species P. parva is the first report for the Balkan Peninsula, while P. vestita is the first record for mainland Europe. Their congener Pritha nana (Simon, 1868) is removed from the Bulgarian checklist of spiders (misidentification). As a result of our report, the number of spider species increases to 571, 1049 and 1183 in Albania, Bulgaria and Greece, respectively.

scholarly journals First report of Coenosia attenuata (Stein, 1903) (Diptera, Muscidae) in Uruguay, confirmed by DNA barcode sequences

Check List ◽  
2020 ◽  
Vol 16 (3) ◽  
pp. 749-752
Author(s):  
Mario Giambiasi ◽  
Abel Rodríguez ◽  
Ana Arruabarrena ◽  
José Buenahora
Keyword(s):  
Dna Barcoding ◽  
Dna Barcode ◽  
Morphological Characteristics ◽  
Control Agent ◽  
First Report ◽  
Coenosia Attenuata ◽  
First Time

Coenosia attenuata (Stein, 1903) is a predatory fly which feeds on other insects and can be used as a possible biological control agent. We report this insect in Uruguay for the first time. The flies were found in greenhouses on tomatoes and sweet peppers and identified using both DNA barcoding and morphological characteristics.

scholarly journals First record of the expansive harvestmen Leiobunum sp. A (Arachnida: Opiliones) in Poland

2017 ◽  
Vol 60 (2) ◽  
pp. 113-118
Author(s):  
Robert ROZWAŁKA ◽  
◽  
Przemysław ŻURAWLEW ◽  
Tomasz RUTKOWSKI ◽  
Keyword(s):  
The Netherlands ◽  
21St Century ◽  
First Record ◽  
European Countries ◽  
Female Genitalia ◽  
Central European ◽  
First Report ◽  
First Time

The invasive harvestmen Leiobunum sp. A (Arachnida: Opiliones) spread rapidly across Europe. Since the first report from the Netherlands at the beginning of the 21st century its known range covers most of the western and central European countries, reaching Berlin in the East. In this note we report for the first time two new sites from Poland which move its range 230 and 300 km eastward, respectively. It was found in Chocz near Pleszew and Dąbrówka near Poznań (Wielkopolska Lowland). Chocz is now easternmost site of this species in Europe. Morphological measurements and drawings are given. Female genitalia are described for the first time.

An emended description of Stemphylium amaranthi with its first record for Iran mycobiota

Phytotaxa ◽  
2018 ◽  
Vol 371 (2) ◽  
pp. 93
Author(s):  
ALIREZA POURSAFAR ◽  
YOUBERT GHOSTA ◽  
MOHAMMAD JAVAN-NIKKHAH
Keyword(s):  
Morphological Characteristics ◽  
First Record ◽  
Its Rdna ◽  
Morphological Identification ◽  
Sexual Morph ◽  
Species Circumscription ◽  
New Information ◽  
Emended Description ◽  
First Time

Stemphylium amaranthi was originally described from the leaves of Amaranthus retroflexous in China based only on asexual morphological characteristics. New collections of S. amaranthi from wheat and barley plants with symptoms of black (sooty) head mould in Golestan and Qazvin Provinces, Iran, revealed abundant formation of a sexual morph. The morphological identification was confirmed by sequences obtained from ITS-rDNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genomic loci. New information on the sexual morph of S. amaranthi is provided and the species circumscription is emended. Wheat and barley are reported as new substrates for S. amaranthi, and this species is recorded for the first time in Iran.

Sign in / Sign up

Export Citation Format

Share Document