scholarly journals First Report of Botrytis cinerea on Kenaf in South Africa

Plant Disease ◽  
2001 ◽  
Vol 85 (9) ◽  
pp. 1032-1032
Author(s):  
W. J. Swart ◽  
M. T. Tesfaendrias ◽  
J. Terblanche
Keyword(s):  
South Africa ◽  
El Salvador ◽  
Botrytis Cinerea ◽  
Fiber Quality ◽  
Gray Mold ◽  
Hibiscus Cannabinus ◽  
Malt Extract ◽  
First Report ◽  
Significant Difference ◽  
Stem Lesions

Kenaf (Hibiscus cannabinus L.) (Malvaceae) is a source of high-quality cellulose fibers and is being investigated in South Africa with a view to commercial production. In April 2001, 20 to 30% of 5-month-old kenaf plants grown from seed in experimental plots near Rustenburg, Northwest Province, South Africa, were affected by gray mold caused by Botrytis cinerea Pers.:Fr. Infected plants displayed brown necrotic areas that girdled the stem, resulting in wilting and lodging in at least 50% of observed cases. Symptoms included extensive growth of mycelia and gray conidia on stem lesions. Microscopic examination revealed hyaline, one-celled conidia and conidiophores conforming to the description of B. cinerea. Plating of diseased stem tissue on malt extract agar (MEA) consistently yielded B. cinerea. Koch's postulates were satisfied by applying toothpick tips (5 mm) colonized by B. cinerea on MEA to the stems of 10 120-day-old greenhouse-grown plants of each of five kenaf cultivars. A colonized toothpick tip was placed on the stem of each of five plants per cultivar at a point ≍15 cm above soil level. Another five plants of each cultivar were wounded once using a sharp dissecting needle, and a colonized toothpick tip was placed on top of each wound. Corresponding control treatments consisted of five additional plants per cultivar, each wounded and mock-inoculated with sterile toothpick tips. Inoculation points were wrapped in Parafilm. The experiment was conducted twice. Developing lesions were measured after 7 days. Mean lesion lengths for the two treatments, nonwounded and wounded, on the five cultivars were, respectively: 32.4 and 35.2 mm for Everglades 41; 14.9 and 53.8 mm for Cuba 108; 39.5 and 55.8 mm for El Salvador; 19.0 and 44.3 mm for SF459; and 12.4 and 43.9 mm for Tainung 2. The Newman-Keuls multiple comparison test revealed no significant difference (P < 0.05) in means among cultivars for the wounded treatment. For the nonwounded treatment, Everglades 41 and El Salvador were significantly more susceptible (P < 0.05) than the three remaining cultivars. No lesions developed on control treatments. The fungus was reisolated on MEA from all artificially inoculated plants. The pathogen is reported to cause serious losses in yield and fiber quality of kenaf in Spain (1). This is the first report of B. cinerea on kenaf in South Africa, and its potential impact on kenaf production in this country should be taken seriously. Reference: (1) A. De Cal and P. Melgarejo. Plant Dis. 76:539, 1992.

scholarly journals First Report of Sclerotium rolfsii on Kenaf in South Africa

Plant Disease ◽  
2003 ◽  
Vol 87 (7) ◽  
pp. 874-874
Author(s):  
W. J. Swart ◽  
M. T. Tesfaendrias ◽  
J. Terblanche
Keyword(s):  
South Africa ◽  
Fiber Quality ◽  
Sclerotium Rolfsii ◽  
Ground Level ◽  
Hibiscus Cannabinus ◽  
Control Measures ◽  
Malt Extract ◽  
First Report ◽  
Potted Plants ◽  
Multiple Comparison Test

Kenaf, Hibiscus cannabinus L. (Malvaceae), is being planted commercially in South Africa for the high quality cellulose fibers that it produces. In a January 2001 survey of 3-month-old kenaf plants grown from seed in experimental plots near Rustenburg, Northwest Province, 30% of plants were observed with severe wilting. Stems at ground level of all infected plants had sunken tan lesions, white mycelial strands, and small, dark brown, 1 to 2 mm diameter sclerotia. Isolations from diseased stem tissue on malt extract agar (MEA) consistently yielded a fungus conforming to the description of Sclerotium rolfsii Sacc. (teleomorph Athelia rolfsii (Curzi) Tu & Kimbrough). Pathogenicity tests were conducted by applying toothpick tips (5 mm) colonized by S. rolfsii on MEA to the stems of 120-day-old potted plants of 10 kenaf cultivars in the greenhouse. Five plants of each cultivar were wounded once using a sharp dissecting needle, and a colonized toothpick tip was placed on top of each wound. Control treatments consisted of five plants per cultivar each wounded and inoculated with sterile toothpick tips. All inoculation points were wrapped using Parafilm, and the experiment was conducted twice. Lesions were measured after 10 days. Mean lesion lengths for the 10 cultivars were as follows: Dowling (34.9 mm), Cuba 108 (38.6 mm), Gregg (41.1 mm), Everglades 41 (44.2 mm), SF459 (44.9 mm), Tainung 2 (45.8 mm), El Salvador (45.9 mm), Whitton (46.1 mm), Everglades 71 (46.4 mm), and Endora (54.0 mm). The Newman-Keuls multiple comparison test revealed that cvs. Dowling and Endora were significantly more resistant and more susceptible (P < 0.05), respectively, than the other cultivars. Lesions did not develop on control plants. The fungus was reisolated on MEA from all artificially inoculated plants. The pathogen is reported to cause serious losses in yield and fiber quality of kenaf (1). To our knowledge, this is the first report of S. rolfsii on kenaf in South Africa. Commercial plantings of kenaf in South Africa are expected to exceed 500 ha during the next 2 years, so its potential impact on kenaf production in this country will be significant if efficient disease control measures are not practiced. References: (1) J. M. Dempsey. Kenaf. Pages 203–304 in: Fiber Crops. The University Press of Florida, Gainesville, 1975.

scholarly journals First Report of Fludioxonil Resistance in Botrytis cinerea from a Blackberry Field in Georgia

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 848-848 ◽  
Author(s):  
D. Fernández-Ortuño ◽  
A. Grabke ◽  
P. K. Bryson ◽  
E. D. Beasley ◽  
L. A. Fall ◽  
...  
Keyword(s):  
South Carolina ◽  
Botrytis Cinerea ◽  
Crop Protection ◽  
The United States ◽  
Gray Mold ◽  
Resistant Isolate ◽  
Malt Extract ◽  
First Report ◽  
Control Fruit ◽  
Lesion Diameter

Botrytis cinerea Pers. is an important plant-pathogenic fungi responsible for gray mold on more than 230 plant species worldwide, including blackberry (Rubus). One of the main strategies to control the disease involves the application of different classes of fungicides. The phenylpyrrole fludioxonil is currently marketed in combination with the anilinopyrimidine cyprodinil as Switch 62.5WG (Syngenta Crop Protection Inc., Greensboro, NC) for gray mold control. In August 2013, blackberries affected with symptoms resembling gray mold were collected from a field located in Berrien County (Georgia), where Switch 62.5WG had been used extensively over the last 5 years. Three single-spore isolates, each from a different fruit, were obtained and identified as B. cinerea on the basis of morphology and confirmed by a 238-bp PCR amplification product obtained with primer set G3PDH-F1 (5′-GGACCCGAGCTAATTTATGTCACGT-3′), G3PDH-F2 (5′-GGGTGTCAACAACGAGACCTACACT-3′), and G3PDH-R (5′-ACCGGTGCTCGATGGGATGAT-3′). In vitro sensitivity to fludioxonil (Scholar SC, Syngenta) was determined on 1% malt extract agar (MEA) using a conidial germination assay as previously described (4). One isolate was moderately resistant due to growth on medium amended with the discriminatory dose of 0.1 μg/ml fludioxonil and residual growth at 10 μg/ml (4). To assess performance of fludioxonil in detached fruit assays, commercially grown strawberries (24 in total for each isolate and treatment) were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water (control fruit) or 2.5 ml/liter of Scholar SC to runoff using a hand mister. Scholar SC was used because fludioxonil was the sole active ingredient in this product and strawberries were used because latent infections in fresh blackberry fruit interfered with inoculation experiments. This dose reflects the rate recommended for postharvest gray mold control according to the Scholar label. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of conidia suspension (106 spores/ml) of the two sensitive or the resistant isolate. After inoculation, the fruit were kept at 22°C for 4 days. The sensitive isolates developed gray mold on non-treated (2.7 cm lesion diameter) but not on Scholar SC-treated fruit (0.0 cm lesion diameter). The resistant isolate developed gray mold disease on the water-treated control fruit (2.5 cm lesion diameter) and the fungicide-treated fruit (1.8 cm lesion diameter). EC50 values were determined in microtiter assays as described previously (3) using the concentrations of 0.01, 0.04, 0.12, 0.37, 1.1, 3.3, and 10 μg/ml fludioxonil. Values were 0.02 and 0.05 μg/ml for the two sensitive isolates and 3.15 μg/ml for the resistant isolate. All experiments were performed twice. This is the first report of fludioxonil resistance in B. cinerea from blackberry in Georgia. Prior to this study, resistance to fludioxonil in B. cinerea was reported in France, Germany, and only a few states in the United States including Maryland, South Carolina, Virginia, and Washington (1,2). The emergence of resistance to fludioxonil emphasizes the importance of resistance management strategies. References: (1) D. Fernández-Ortuño et al. Plant Dis. 97:848, 2013. (2) D. Fernández-Ortuño et al. Plant Dis. 98:692, 2013. (3) M. Kretschmer et al. PLOS Pathog. 5:e1000696, 2009. (4) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

scholarly journals First Report of Gray Mold in Tomato Caused by Botrytis cinerea in Baja California, Mexico

Plant Disease ◽  
2005 ◽  
Vol 89 (5) ◽  
pp. 528-528 ◽  
Author(s):  
R. J. Holguín-Peña ◽  
F. G. Arcos
Keyword(s):  
Botrytis Cinerea ◽  
Baja California ◽  
Polymerase Chain Reaction Amplification ◽  
Random Amplified Polymorphic Dna ◽  
Gray Mold ◽  
Malt Extract ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Tomato Production ◽  
First Report

San Quintin Valley, a 60-mile-long coastal plain (30°30′N, 116°W) in the Baja California Peninsula, is one of the major fresh tomato (Lycopersicon esculentum Mill.) production areas in Mexico with more than 8,000 ha. During the last 10 years, the valley's tomato production has declined because of gray mold and stem canker diseases. Flower rot, reddish brown margins on the leaves and stems, and fruit with a gray mold were observed on field-grown tomato plants (Roma type cv. Tequila) in the autumn of 2003. Severity ranging from 55 to 60% was observed at harvest. Infected tissues were sampled and disinfested by immersion in 1% NaOCl for 1 min, rinsed in sterile water, and placed on malt extract agar at 22°C. Fungal conidia were then transferred to 2% potato dextrose agar (PDA). The resulting fungal colonies were definitively identified as Botrytis cinerea Pers.:Fr. The colonies of B. cinerea were first hyaline and white and became dark gray after 96 h. Mycelia were septate with dark branched conidiophores. Conidia were unicellular, ellipsoid, and ranged from 5 to 8 × 8 to 14 μm. Profuse black sclerotia developed in 7-day-old cultures. Infection site analyses in diseased flowers at different stages during the bloom were done with scanning electron microscopy. Fungal hyphae were located predominantly on the receptacle areas, whereas conidia were located in the ovaries as described previously (3). The identity of B. cinerea was confirmed by a restriction digest with ApoI of the 413-kb polymerase chain reaction amplification product obtained with BA2f/BA1r primers (1) and random amplified polymorphic DNA banding patterns (2). Pathogenicity tests were done by spray inoculation of 1-ml aqueous conidial suspension (106 CFU/ml) on 20 healthy plants during the blossom stage. An equal number of plants sprayed with sterile water was used as the control. Plants were incubated at 20 ± 2°C for 5 days. The fungus was reisolated from diseased flowers and peduncles after surface disinfestation (2.5% NaOCl) and plating on PDA. No symptoms were observed in the noninoculated controls. To our knowledge, this is the first report of B. cinerea causing gray mold disease on tomato in Baja California. References: (1) K. Nielsen et al. Plant Dis. 86:682, 2002. (2) S. Rigotti et al. FEMS Microbiol. Lett. 209:169, 2002. (3) O. Viret et al. Phytopathology 94:850, 2004.

scholarly journals First Report of Fusarium verticillioides on Kenaf in South Africa

Plant Disease ◽  
2007 ◽  
Vol 91 (1) ◽  
pp. 112-112
Author(s):  
W. J. Swart ◽  
G. Tarekegn
Keyword(s):  
South Africa ◽  
Fusarium Verticillioides ◽  
Hibiscus Cannabinus ◽  
Control Measures ◽  
Control Treatment ◽  
Malt Extract ◽  
Seedling Mortality ◽  
First Report ◽  
Germinated Seeds

Kenaf (Malvaceae; Hibiscus cannabinus L.) is being commercially cultivated in Winterton, South Africa for its high-quality cellulose fibers with approximately 2,000 ha currently under cultivation. In 2004, 25% of 1-month-old kenaf plants grown from seed were observed in the field with severe wilting followed by lodging and mortality within 1 week. Isolations from diseased stem and root tissue on malt extract agar (MEA) consistently yielded Fusarium verticillioides (Sacc.) Nirenberg (2). Pathogenicity tests were conducted by inoculating kenaf seedlings with inoculum prepared from barley grains that had been colonized by the pathogen in vitro for 2 weeks prior to being finely ground in a laboratory mill. Fifty seeds from each of eight kenaf cultivars were incubated at 25°C on sterile filter paper to ensure germination and the absence of pathogens. Germinated seeds were sown in pots (400 cm3) containing steam sterilized loam soil (200 g) by placing 20 germinated seeds from each cultivar, with four replicates (5 seeds per pot), on the soil in each pot and covering them with 100 g of the same soil. Inoculum powder was sprinkled on the surface of the soil in each pot and covered by 100 g of soil. Pots were maintained in a glasshouse at an ambient temperature of 25°C. Sterile ground barley seeds served as the control treatment. Pots were watered daily with 20 ml of water and observed periodically for seedling emergence. The percentage of diseased seedlings was recorded after 3 weeks and the experiment was repeated. Wilting had occurred in 85% of seedlings when they were approximately 4 cm high and all diseased seedlings had died within 1 week thereafter. Subsequent examination revealed dark brown lesions girdling the stem and decayed roots in all instances. No symptoms developed on control plants. From means of combined data, the greatest seedling mortality was observed for cv. Gregg (65%) and the least for cv. Cuba108 (5%). Mean mortalities for the remaining six cultivars ranged from 30 to 55%. The pathogen was reisolated on MEA from all diseased seedlings. To our knowledge, this is the first report of F. verticillioides occurring on kenaf in South Africa. The only other report of Fusarium sp. causing serious damping-off of kenaf is from Iran (1). The potential impact of the pathogen on kenaf production in South Africa must be considered in the implementation of disease control measures. References: (1) J. M. Dempsey. Kenaf. In: Fiber Crops. The University Press of Florida, Gainesville, 1975. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006.

scholarly journals First Report of Botrytis Blight, Caused by Botrytis cinerea, on Hibiscus in South Africa

Plant Disease ◽  
2000 ◽  
Vol 84 (4) ◽  
pp. 487-487 ◽  
Author(s):  
L. Swart ◽  
P. Langenhoven
Keyword(s):  
South Africa ◽  
Botrytis Cinerea ◽  
The United States ◽  
Gray Mold ◽  
Flower Stalk ◽  
Transparent Plastic ◽  
Food Ingredients ◽  
First Report ◽  
Plant Parts ◽  
Average Size

Roselle (Hibiscus sabdariffa L.) is an annual herb grown in China, Thailand, Mexico, and Africa. Different plant parts are used for cold and hot beverages, food ingredients, edible oil, and medicinal properties. In May 1999, a disease was observed in a commercial field of 6-month-old H. sabdariffa plants in Eshowe, KwaZulu-Natal, South Africa. Stems of diseased plants had brown, sunken lesions covered with green-gray spore masses. Infected stems collapsed. Lesions initiated on stems expanded rapidly under cool, humid conditions. In some cases, lesions developed on the flower stalk and expanded to the calyx, causing death of the calyx. Leaves had no lesions or sporulation, but as stem blight progressed, leaves wilted and fell off. Botrytis cinerea Pers.:Fr. (1) was consistently isolated from affected stem and flower stalk tissues. The pathogen produced profuse conidia and mycelia on the surface of dead and infected stems and calyxes, which resulted in a moldy gray appearance. The average size of conidia produced on naturally infected stems ranged from 5.5 to 8.0 × 6.0 to 13.0 μm (average 6.5 × 9.2 μm). On potato dextrose agar (1-month-old culture), conidia ranged from 5.0 to 9.5 × 6.5 to 12.5 μm (average 7.3 × 8.7 μm) based on 50 spore measurements. Microsclerotia were round or irregular and ranged from 1.2 to 3.0 × 1.0 to 2.5 mm (average 2.1 × 2.0 mm). Koch's postulates were confirmed by spraying potted, 6-month-old H. sabdariffa plants with a spore suspension (1 × 105 conidia per ml). Inoculated plants were enclosed in transparent plastic bags for 7 days at 15 and 20°C (night and day) in a glasshouse. Typical symptoms developed on stems and calyxes within 7 days after inoculation. B. cinerea was reisolated from affected tissues. Botrytis gray mold blight has been recorded on H. rosa-sinensis L. and Hibiscus sp. in Florida (2), but this is the first report of Botrytis blight on Hibiscus spp. in South Africa. Because the disease can result in plant death, Botrytis blight may have a significant impact on the establishment and yield of this crop in the field, especially under cool, wet growing conditions. References: (1) M. B. Ellis. 1971. Dematiaceous Hyphomycetes. CAB, Kew, Surrey, England. (2) D. F. Farr et al. 1989. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold Disease on Peach from Pakistan

2018 ◽  
Vol 7 (3) ◽  
pp. 131-131
Author(s):  
Raees Ahmed ◽  
Amjad S. Gondal ◽  
Muhammad Tariq Khan ◽  
Shazia Shahzaman ◽  
Sajjad Hyder
Keyword(s):  
Botrytis Cinerea ◽  
Mycelial Growth ◽  
Agar Medium ◽  
Management Strategies ◽  
Gray Mold ◽  
First Report ◽  
Average Production ◽  
Conducive Environment ◽  
Hyphal Tip ◽  
Important Disease

Gray mold caused by Botrytis cinerea is an important disease that attacks fruits, leaves and twigs of peach. Peach is grown on an area of 18,008 ha with an average production of 72,085 tons per year in Pakistan (FAO, 2017). During May 2017, brown spots on 33% of the peach fruits examined were observed in Swat district of KPK province of Pakistan. Infected fruits were incubated at 25±2 °C in a humid chamber resulted in greyish mycelial growth with light brown lesions. Hyphal growths on infected fruits were cultured on PDA media and purified by hyphal tip method. Morphologically whitish grey growth was observed on PDA and later on dark sclerotia were observed after 6-7 days of incubation. Hyphae were found septate with branched hyaline conidiophores having a bunch of ovoid conidia at their tips. Further confirmations were done by amplifying internal transcribed spacer regions (Andrew et al., 2009) and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) region of the isolates (Li et al., 2012). Amplicons sequenced from Macrogen Korea were blasted and submitted in NCBI showed that ITS sequences (Accessions MH049690 and MH049691) were 99% identical with already reported (MG878388 and MG654661) sequences and the G3PDH gene sequences (Accessions MH560352 and MH560353) were 99 % identical with already reported (Accessions MG204876) sequences of B. cinerea. Pathogenicity was confirmed on healthy peach fruits disinfected with 50% ethanol, inoculated by placing a plug of about 1cm2 taken from the edge of actively growing B. cinerea isolate (BTS-16). Fruits were incubated at 25±2 °C in a humid chamber (Abata et al., 2016). A set of healthy fruits mock-inoculated with a plug of agar medium were used as control. Three days after inoculation, inoculated fruits showed sunken lesions with cottony greyish mycelial growth on their surface. Fungus isolated from these infections was re-confirmed as B. cinerea. Conducive environment for the disease progression in nearby areas can result into a huge loss in peach produce so there is a need to devise management strategies to cope with the pathogen. This is the first report of gray mold disease of peach caused by B. cinerea from Pakistan. 

scholarly journals First Report of Fenhexamid-Resistant Botrytis cinerea Causing Gray Mold on Heurchera in a North American Greenhouse

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 147-147 ◽  
Author(s):  
G. W. Moorman ◽  
A.-S. Walker ◽  
S. May
Keyword(s):  
Botrytis Cinerea ◽  
Mode Of Action ◽  
Gray Mold ◽  
North Central ◽  
First Report ◽  
Group I ◽  
Central Pennsylvania ◽  
Commercial Operation ◽  
Penn State ◽  
Botryotinia Fuckeliana

Greenhouse-grown Heuchera plants, treated with fenhexamid (Decree, SePRO, Carmel, IN; FRAC group 17 hydroxyanilide), with active gray mold were submitted to the Penn State Plant Disease Clinic in December 2010 from a commercial operation in north-central Pennsylvania. Genetic and phenotypic analyses identified the isolate as Botrytis cinerea Pers. (teleomorph Botryotinia fuckeliana (de Bary) Whetzel), HydR3 phenotype (2) and not B. pseudocinerea (previously Botrytis group I) (4), naturally resistant to fenhexamid (phenotype HydR1) (1). While 0.2 μg of fenhexamid per ml or less is required to slow mycelial growth and germ tube elongation of sensitive isolates by 50% (EC50), the radial growth EC50 of the Heuchera isolate was approximately 2,000 μg of fenhexamid per ml in culture. Five cucumber seedlings receiving 25 μl of 0.1 M dextrose containing the label rate of Decree (1,800 μg/ml) on the growing tip were inoculated with colonized agar in the drop. Five check plants received 25 μl of 0.1 M dextrose. B. cinerea from silica gel storage since 1988 was also tested. This experiment was repeated three times. The 1988 isolate killed all fungicide-free but no fenhexamid-treated plants. The Heuchera isolate killed all fungicide-free and fenhexamid-treated plants within 4 days. To our knowledge, this is the first report of B. cinerea from a greenhouse in North America with fenhexamid resistance. Resistance occurs in U.S. fields (3). The Heuchera isolate's HydR3 resistance phenotype (2) has been detected in Germany, Japan, and France and has mutations affecting the 3-keto reductase protein, encoded by the erg27 gene, the specific target of fenhexamid and involved in Botrytis sterol biosynthesis. The Decree label states that it is to be used only twice on a crop before switching to a different mode of action. Greenhouses have resident Botrytis populations that are likely to be exposed to any fungicide applied in the structure. Growers should consider using fenhexamid only twice in a particular greenhouse, rather than on a particular crop, before switching to a different mode of action. References: (1) P. Leroux et al. Crop Prot. 18:687, 1999.(2) P. Leroux et al. Pest Manag. Sci. 58:876, 2002. (3) Z. Ma and T. J. Michailides. Plant Dis. 89:1083, 2005. (4) A.-S. Walker et al. Phytopathology 101:1433, 2011.

scholarly journals First Report of Gray Mold on Allium victorialis var. platyphyllum Caused by Botrytis cinerea in Korea

Plant Disease ◽  
2017 ◽  
Vol 101 (1) ◽  
pp. 256-256
Author(s):  
M. Aktaruzzaman ◽  
Y. G. Lee ◽  
T. Afroz ◽  
B. S. Kim ◽  
H. D. Shin
Keyword(s):  
Botrytis Cinerea ◽  
Gray Mold ◽  
First Report

scholarly journals First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jun Guo ◽  
Jin Chen ◽  
Zhao Hu ◽  
Jie Zhong ◽  
Jun Zi Zhu
Keyword(s):  
Botrytis Cinerea ◽  
Morphological Characteristics ◽  
Gray Mold ◽  
Hunan Province ◽  
Conidial Suspension ◽  
Heat Shock Protein 60 ◽  
Basal Cells ◽  
Single Spore ◽  
Internal Transcribed Spacer Region ◽  
First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Sign in / Sign up

Export Citation Format

Share Document