First Report of Raspberry bushy dwarf virus in Ohio

2005 ◽  
Vol 6 (1) ◽  
pp. 30 ◽  
Author(s):  
M. A. Ellis ◽  
J. Kraus ◽  
R. R. Martin ◽  
S. R. Wright
Keyword(s):  
Ringspot Virus ◽  
Dwarf Virus ◽  
Black Raspberry ◽  
Red Raspberry ◽  
Plant Vigor ◽  
First Report ◽  
Tobacco Ringspot Virus ◽  
The Past ◽  
Raspberry Bushy Dwarf Virus

Over the past 10 years, several commercial producers of black raspberry in Ohio have experienced a decline in plant vigor and survival in their plantings. In 2004, a survey of several black and red raspberry plantings in Ohio was conducted to determine if viruses were present. Of the 115 samples taken in the survey, Raspberry bushy dwarf (RBDV), Tomato ringspot (ToRSV), and Tobacco ringspot virus (TRSV) were detected in 21, 5, and 2, respectively. This is the first report of RBDV in Ohio. Accepted for publication 27 April 2005. Published 10 May 2005.

scholarly journals First Report of Raspberry bushy dwarf virus in Rubus multibracteatus from China

Plant Disease ◽  
2003 ◽  
Vol 87 (5) ◽  
pp. 603-603 ◽  
Author(s):  
C. J. Chamberlain ◽  
J. Kraus ◽  
P. D. Kohnen ◽  
C. E. Finn ◽  
R. R. Martin
Keyword(s):  
Amino Acid ◽  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Dwarf Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Black Raspberry ◽  
First Report ◽  
Raspberry Bushy Dwarf Virus ◽  
Plant Pathol

Raspberry bushy dwarf virus (RBDV), genus Idaeovirus, has been reported in commercial Rubus spp. from North and South America, Europe, Australia, New Zealand, and South Africa. Infection can cause reduced vigor and drupelet abortion leading to crumbly fruit and reduced yields (3,4). In recent years, Rubus germplasm in the form of seed, was obtained on several collection trips to The People's Republic of China to increase the diversity of Rubus spp. in the USDA-ARS National Clonal Germplasm Repository, (Corvallis, OR). Before planting in the field, seedlings were tested for the presence of RBDV, Tomato ringspot virus, and Tobacco streak virus using triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) (antiserum produced by R. R. Martin). One symptomless plant of R. multibracteatus H. Lev. & Vaniot (PI 618457 in USDA-ARS GRIN database), from Guizhou province in China, tested positive for RBDV (RBDV-China). After mechanical transmission on Chenopodium quinoa Willd., this isolate produced typical symptoms of RBDV (3). To determine if RBDV-China was a contaminant during the handling of the plants, or if the source was a seedborne virus, the coat protein gene was sequenced and compared to published sequences of RBDV. RNA was extracted from leaves of R. multibracteatus and subjected to reverse transcription-polymerase chain reaction (RT-PCR) using primers that flank the coat protein gene. Products from four separate PCR reactions were sequenced directly or were cloned into the plasmid vector pCR 2.1 (Invitrogen, Carlsbad, CA) and then sequenced. The coding sequence of the coat protein gene of RBDV-China was 87.5% (722/825) identical to that isolated from black raspberry (Genbank Accession No. s55890). The predicted amino acid sequences were 91.6% (251/274) identical. Previously, a maximum of five amino acid differences had been observed in the coat proteins of different RBDV strains (1). The 23 differences observed between RBDV-China and the isolate from black raspberry (s55890) confirm that the RBDV in R. multibracteatus is not a greenhouse contaminant but is indeed a unique strain of RBDV. In addition, monoclonal antibodies (MAbs) to RBDV (2) were tested against RBDV-China. In these tests, MAb D1 did not detect RBDV-China, whereas MAb R2 and R5 were able to detect the strain. This is the first strain of RBDV that has been clearly differentiated by MAbs using standard TAS-ELISA tests. Although RBDV is common in commercial Rubus spp. worldwide, to our knowledge, this is the first report of RBDV in R. multibracteatus, and the first report of RBDV from China. The effects of this new strain of RBDV could be more or less severe, or have a different host range than previously studied strains. It is more divergent from the type isolate than any other strain that has been studied to date. Phylogenetic analysis of coat protein genes of RBDV may be useful in understanding the evolution and spread of this virus. References: (1) A. T. Jones et al. Eur. J. Plant Pathol. 106:623, 2000. (2) R. R. Martin. Can. J. Plant. Pathol. 6:264, 1984. (3) A. F. Murant. Raspberry Bushy Dwarf. Page 229 in: Virus Diseases of Small Fruits. R. H. Converse, ed. U.S. Dep. Agric. Agric. Handb. 631, 1987. (4) B. Strik and R. R. Martin. Plant Dis. 87:294, 2003.

scholarly journals First Report of Raspberry bushy dwarf virus on Red Raspberry and Grapevine in Slovenia

Plant Disease ◽  
2003 ◽  
Vol 87 (9) ◽  
pp. 1148-1148 ◽  
Author(s):  
I. Mavrič ◽  
M. Viršček Marn ◽  
D. Koron ◽  
I. Žežlina
Keyword(s):  
Polyclonal Antiserum ◽  
Rubus Idaeus ◽  
Dwarf Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Natural Occurrence ◽  
Red Raspberry ◽  
Rt Pcr ◽  
First Report ◽  
Raspberry Bushy Dwarf Virus ◽  
Das Elisa

In 2002, severe vein yellowing and partial or complete yellowing of leaves was observed on some shoots of red raspberry (Rubus idaeus) cvs. Golden Bliss and Autumn Bliss. Sap of infected plants of cv. Golden Bliss was inoculated onto Chenopodium quinoa and Nicotiana benthamiana. Faint chlorotic spots were observed on inoculated leaves of C. quinoa approximately 14 days after inoculation but no systemic symptoms appeared. No symptoms were observed on N. benthamiana. Raspberry bushy dwarf virus (RBDV) was detected in the original raspberry plant using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with polyclonal antiserum (Loewe Biochemica, Sauerlach, Germany). Systemic infections of inoculated C. quinoa and N. benthaminana were confirmed using DAS-ELISA. In 2001 and 2002, unusual virus symptoms were observed on grapevine grafts (Vitis vinifera) of cv. Laški Rizling. Symptoms appeared as curved line patterns and yellowing of the leaves. No nepoviruses were found in symptomatic plants, but RBDV was confirmed using DAS-ELISA. RBDV infection was later confirmed in grapevine cv. Štajerska Belina with similar symptoms. RBDV was transmitted mechanically from grapevine to C. quinoa where it was detected by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR). IC-RT-PCR was used to amplify a part of the coat protein gene of the virus from raspberry and grapevine, and the amplification products were sequenced (1). The obtained sequence shared at least 93% nucleotide sequence identity with other known RBDV sequences, which confirmed the serological results. To our knowledge, this is the first report of the natural occurrence of RBDV in grapevine and also of RBDV infection of red raspberry in Slovenia. Reference: (1) H. I. Kokko et al. Biotechniques 20:842, 1996.

scholarly journals First Report of Black raspberry necrosis virus in Rubus canadensis in Tennessee

Plant Disease ◽  
2008 ◽  
Vol 92 (8) ◽  
pp. 1254-1254 ◽  
Author(s):  
S. Sabanadzovic ◽  
N. Abou Ghanem-Sabanadzovic
Keyword(s):  
Ringspot Virus ◽  
Dwarf Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Cdna Clones ◽  
Black Raspberry ◽  
Necrosis Virus ◽  
Reading Frame ◽  
First Report ◽  
Biodiversity Inventory ◽  
Satsuma Dwarf Virus

Symptoms that resembled virus infection were observed on several smooth blackberry (Rubus canadensis L.) plants in the Great Smoky Mountain National Park (GSMNP) during a project carried out in the summer and fall of 2006 as part of All Taxa Biodiversity Inventory (ATBI) activities (2). Diseased specimens showed chlorosis and mottling as well as deformation of younger leaves. Symptomatic leaves were collected, and preliminary screening by double-antibody sandwich (DAS)-ELISA did not detect Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), Tomato spotted wilt virus (TSWV), Raspberry bushy dwarf virus (RBDV), or Impatiens necrotic spot virus (INSV) in these samples. Double-stranded RNA (dsRNA) extracted from symptomatic leaves of two diseased specimens (GSM-1 and GSM-2) revealed two bands with sizes estimated at 7.5 and 6.5 kb. Purified dsRNAs from specimen GSM-1 were used as a template to generate random-primed cDNA clones. Several clones were sequenced and analysis of approximately 3 kb of contiguous sequence (GenBank Accession No. EU419645) revealed the presence of a single open reading frame encoding a protein containing the complete proteinase and partial polymerase domains. BLAST analysis showed that the virus from R. canadensis shared 77 and 87% nucleotide and amino acid sequence identity, respectively, with the recently described putative sadwavirus Black raspberry necrosis virus (BRNV) (GenBank Accession No. NC_008182) (1), suggesting that this virus is a distinct isolate of BRNV. The virus shared a lower degree of identity with the analogous sequences of other viruses belonging to the genus Sadwavirus, with only 48 and 37% identity with Strawberry mottle virus (GenBank Accession No. NC_003445) and Satsuma dwarf virus (GenBank Accession No. NC_003785), respectively. To our knowledge, this is the first report of BRNV in GSMNP and Tennessee, indicating that it may be widespread in native Rubus spp. through the southeastern United States. References: (1) A. Halgren et al. Phytopathology 97:44, 2007. (2) M. J. Sharkey. Fla. Entomol. 84:556, 2001.

scholarly journals First Report of Raspberry bushy dwarf virus Infecting Grapevine in Hungary

Plant Disease ◽  
2012 ◽  
Vol 96 (10) ◽  
pp. 1582-1582 ◽  
Author(s):  
I. Mavrič Pleško ◽  
M. Viršček Marn ◽  
K. Nyerges ◽  
J. Lázár
Keyword(s):  
Natural Infection ◽  
Dwarf Virus ◽  
Molecular Characteristics ◽  
Vitis Vinifera L ◽  
Southwestern Part ◽  
First Report ◽  
Raspberry Bushy Dwarf Virus ◽  
Two Samples ◽  
Rubus Species ◽  
Das Elisa

Raspberry bushy dwarf virus (RBDV) is the sole member of genus Idaeovirus and naturally infects Rubus species worldwide. It can be experimentally transmitted to many dicotyledonous plant species from different families. In Slovenia it has been reported to naturally infect grapevine, the first known non-Rubus natural host (3). However, RBDV from red raspberry and grapevine were found to be different in biological, serological, and molecular characteristics (4). From 2007 to 2010, grapevine (Vitis vinifera L.) vineyards were sampled in different parts of Hungary and tested for RBDV infection by double antibody sandwich (DAS)-ELISA using commercial reagents (Bioreba, Reinach, Switzerland). Overall, 181 samples were collected from 10 vineyards around Csörnyeföld, Badacsony, Eger, Tolcsva (Orémus), and Nagyréde. Samples were taken randomly unless plants showing virus-like symptoms were present, which were preferentially included in the survey. Two samples collected in 2010, each consisting of five leaves from five individual plants, tested positive by DAS-ELISA. They originated from a small private vineyard of Italian Riesling, Pinot Gris, and Rhein Riesling in the southwestern part of Hungary near Csörnyeföld where 29 samples were collected. All leaves were asymptomatic. Total RNA was extracted from positive samples using a RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). cDNA was synthesized using primer RNA12 as described (4) and further amplified by PCR using primers RBDVUP1/RBDVLO4 that amplified an 872-bp fragment of RBDV coat protein and 3′ non-translated region (2). Amplification products from both samples were directly sequenced (Macrogen, Seoul, Korea). The sequences showed 98.6% identity between each other and were deposited in GenBank (Accession Nos. JQ928628 and JQ928629). Sequences were also compared with RBDV sequences deposited in GenBank. They showed 97.7 to 99.3% identity with RBDV sequences from grapevine from Slovenia and 94.2 to 96.1% with RBDV sequences from Rubus sp. Natural infection of grapevine with RBDV was first reported from Slovenia in 2003 (3) and was recently reported also from Serbia (1). To our knowledge, this is the first report of RBDV infection of grapevine in Hungary and suggests a wider presence of the virus in the region. References: (1) D. Jevremovic and S. Paunovic. Pestic. Phytomed. (Belgrade) 26:55, 2011. (2) H. I. Kokko et al. BioTechniques 20:842, 1996. (3) I. Mavric Pleško et al. Plant Dis. 87:1148, 2003. (4) I. Mavric Pleško et al. Eur. J. Plant Pathol. 123:261, 2009.

scholarly journals First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
S. Khankhum ◽  
P. Bollich ◽  
R. A. Valverde
Keyword(s):  
Common Bean ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Ringspot Virus ◽  
Wild Plants ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
First Report ◽  
Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

scholarly journals Raspberry bushy dwarf virus in Slovenia - geographic distribution, genetic diversity and population structure

2020 ◽  
Vol 158 (4) ◽  
pp. 1033-1042
Author(s):  
Irena Mavrič Pleško ◽  
Janja Lamovšek ◽  
Andreja Lešnik ◽  
Mojca Viršček Marn
Keyword(s):  
Population Structure ◽  
Geographic Distribution ◽  
Protein Sequences ◽  
Population Diversity ◽  
Dwarf Virus ◽  
Substantial Part ◽  
Stabilizing Selection ◽  
Red Raspberry ◽  
Raspberry Bushy Dwarf Virus ◽  
Distribution Studies

Abstract Raspberry bushy dwarf virus (RBDV) is a long-known virus naturally infecting Rubus and grapevine. It is also one of the economically most important viruses of raspberries, but there are only a limited number of sequences covering a substantial part of the genome available in the databases. The aim of this study was: i) to study the geographic distribution of RBDV in Slovenia, and ii) to sequence RNA2 of several red raspberry and grapevine RBDV isolates and study their phylogeny and population structure. Geographic distribution studies were performed over a period of 13 years in three wine-growing regions of Slovenia (Primorska, Podravje and Posavje). The highest incidence of RBDV was found in Podravje (58.8%) and the lowest in Primorska (5.1%). Big differences were observed between Vipavska dolina (10.2%) and three other wine-growing districts of Primorska region (0.4–1.2%). Almost complete RNA2 sequences were obtained for four red raspberry isolates and seven grapevine isolates. Additionally, only coat protein sequences were obtained for three red raspberry isolates. Phylogenetic and population diversity analyses were performed on all available RBDV sequences. Phylogenetic analysis has shown clear differences in sequences from Rubus and grapevine that form two highly supported clades. In RNA2 analysis additional two sub-clades were found in grapevine clade. Two major subclades were identified also in the Rubus clade with further differentiation within these subclades. Purifying or stabilizing selection was found to be acting on both, CP and MP genes while few codons were found to be under positive selection.

Molecular detection and characterisation of black raspberry necrosis virus and raspberry bushy dwarf virus isolates in wild raspberries

2018 ◽  
Vol 173 (2) ◽  
pp. 97-111 ◽  
Author(s):  
H. Susi ◽  
M.L. Rajamäki ◽  
K. Artola ◽  
F.R. Jayaraj-Mallika ◽  
J.P.T. Valkonen
Keyword(s):  
Molecular Detection ◽  
Dwarf Virus ◽  
Black Raspberry ◽  
Necrosis Virus ◽  
Raspberry Bushy Dwarf Virus ◽  
Virus Isolates

scholarly journals Effect of Raspberry bushy dwarf virus, Raspberry leaf mottle virus, and Raspberry latent virus on Plant Growth and Fruit Crumbliness in ‘Meeker’ Red Raspberry

Plant Disease ◽  
2014 ◽  
Vol 98 (2) ◽  
pp. 176-183 ◽  
Author(s):  
Diego F. Quito-Avila ◽  
Danielle Lightle ◽  
Robert R. Martin
Keyword(s):  
British Columbia ◽  
The United States ◽  
Fruit Weight ◽  
Rubus Idaeus ◽  
Latent Virus ◽  
Dwarf Virus ◽  
Mottle Virus ◽  
Mixed Infections ◽  
Red Raspberry ◽  
Raspberry Bushy Dwarf Virus

Raspberry crumbly fruit in red raspberry (Rubus idaeus), widespread in the Pacific Northwest of the United States and British Columbia, Canada, is most commonly caused by a virus infection. Raspberry bushy dwarf virus (RBDV) has long been attributed as the causal agent of the disease. Recently, the identification of two additional viruses, Raspberry leaf mottle virus (RLMV) and Raspberry latent virus (RpLV), in northern Washington and British Columbia, suggested the existence of a possible new virus complex responsible for the increased severity of the disease. Virus testing of crumbly fruited plants from five fields in northern Washington revealed the presence of RLMV and RpLV, in addition to RBDV. Plants with less severe crumbly fruit symptoms had a much lower incidence of RLMV or RpLV. Field trials using replicated plots of ‘Meeker’ plants containing single and mixed infections of RBDV, RLMV, or RpLV, along with a virus-free control, were developed to determine the role of RLMV and RpLV in crumbly fruit. Field evaluations during establishment and two fruiting years revealed that plants infected with the three viruses or the combinations RBDV+RLMV and RBDV+RpLV had the greatest reduction in cane growth, or fruit firmness and fruit weight, respectively. Quantitative reverse transcription–polymerase chain reaction (RT-PCR) showed that the titer of RBDV was increased ~400-fold when it occurred in mixed infections with RLMV compared to RBDV in single infections. In addition, a virus survey revealed that RLMV and RpLV are present at high incidence in northern Washington; whereas the incidence in southern Washington and Oregon, where crumbly fruit is not as serious a problem, was considerably lower.

Sign in / Sign up

Export Citation Format

Share Document