scholarly journals Stress Resistance Heat Shock Protein 70 (HSP70) Analysis in Sorghum (Sorghum bicolor L.) at Genome-Wide Level

2021 ◽  
Author(s):  
Kasahun Amare ◽  
Mulugeta Kebede
Keyword(s):  
Heat Shock ◽  
Subcellular Localization ◽  
Physicochemical Properties ◽  
Sorghum Bicolor ◽  
Gene Family ◽  
Gene Structure ◽  
Promoter Region ◽  
Hsp70 Gene ◽  
Cis Acting ◽  
Region Analysis

Heat shock proteins (HSP70) play an important role in many biological processes. However, as typical in Sorghum bicolor, the systematic identification of the HSP70 gene is very limited, and the role of the Hsp70 gene in the evolution of Sorghum bicolor has not been described systematically a lot. To overcome the gap, Insilco analysis of HSP70 gene family was conducted.The investigation was utilizing the bioinformatics method to analyze the HSP70 gene family and it has been identified that 30 HSP70 genes from the genome sequence of Sorghum bicolor. A comprehensive analysis of these 30 identified genes undertaking the analysis of gene structure, phylogeny, and physicochemical properties, subcellular localization, and promoter region analysis. The gene structure visualization analyses revealed that 22 genes contains both 5’ and 3’ UTRS and one 5’ and one 3’ gene and 6 genes without UTR. The highest number of introns was recorded as 12 and those genes have shown that without in any intron. In the promoter region analysis, ten protein motifs are identified and characterized and 2219 cis-acting elements are identified. Among those, the promoter enhancer elements share the highest number (1411) and light-responsive elements share the next value (335). The physicochemical properties analysis revealed that 23 families have an acidic nature while four families are basic and the rests are neutral. In general, the different analyses performed disclosed their structural organization, subcellular localization, physicochemical properties, cis-acting elements, phylogenetic, and understress conditions. This study provides further information for the functional characterization of HSP70 and helps to understand the mechanisms of abiotic stress tolerance under diverse stress conditions in Sorghum bicolor.

scholarly journals Genome-Wide Identification and Characterization of the RCI2 Gene Family in Allotetraploid Brassica napus Compared with Its Diploid Progenitors

2022 ◽  
Vol 23 (2) ◽  
pp. 614
Author(s):  
Weiqi Sun ◽  
Mengdi Li ◽  
Jianbo Wang
Keyword(s):  
Brassica Napus ◽  
Gene Family ◽  
Gene Structure ◽  
Stress Responses ◽  
Stress Protein ◽  
Purifying Selection ◽  
Cis Acting ◽  
Genome Wide ◽  
Duplication Events

Brassica napus and its diploid progenitors (B. rapa and B. oleracea) are suitable for studying the problems associated with polyploidization. As an important anti-stress protein, RCI2 proteins widely exist in various tissues of plants, and are crucial to plant growth, development, and stress response. In this study, the RCI2 gene family was comprehensively identified and analyzed, and 9, 9, and 24 RCI2 genes were identified in B. rapa, B. oleracea, and B. napus, respectively. Phylogenetic analysis showed that all of the identified RCI2 genes were divided into two groups, and further divided into three subgroups. Ka/Ks analysis showed that most of the identified RCI2 genes underwent a purifying selection after the duplication events. Moreover, gene structure analysis showed that the structure of RCI2 genes is largely conserved during polyploidization. The promoters of the RCI2 genes in B. napus contained more cis-acting elements, which were mainly involved in plant development and growth, plant hormone response, and stress responses. Thus, B. napus might have potential advantages in some biological aspects. In addition, the changes of RCI2 genes during polyploidization were also discussed from the aspects of gene number, gene structure, gene relative location, and gene expression, which can provide reference for future polyploidization analysis.

scholarly journals Identification and sequence analysis of a new member of the mouse HSP70 gene family and characterization of its unique cellular and developmental pattern of expression in the male germ line.

1988 ◽  
Vol 8 (7) ◽  
pp. 2925-2932 ◽  
Author(s):  
Z F Zakeri ◽  
D J Wolgemuth ◽  
C R Hunt
Keyword(s):  
Heat Shock ◽  
Gene Family ◽  
Developmental Stages ◽  
Germ Line ◽  
Cell Lineage ◽  
Hsp70 Gene ◽  
Coding Region ◽  
Male Germ Line ◽  
Sequence Organization

A unique member of the mouse HSP70 gene family has been isolated and characterized with respect to its DNA sequence organization and expression. The gene contains extensive similarity to a heat shock-inducible HSP70 gene within the coding region but diverges in both 3' and 5' nontranslated regions. The gene does not yield transcripts in response to heat shock in mouse L cells. Rather, the gene appears to be activated uniquely in the male germ line. Analysis of RNA from different developmental stages and from enriched populations of spermatogenic cells revealed that this gene is expressed during the prophase stage of meiosis. A transcript different in size from the major heat-inducible mouse transcripts is most abundant in meiotic prophase spermatocytes and decreases in abundance in postmeiotic stages of spermatogenesis. This pattern of expression is distinct from that observed for another member of this gene family, which was previously shown to be expressed abundantly in postmeiotic germ cells. These observations suggest that specific HSP70 gene family members play distinct roles in the differentiation of the germ cell lineage in mammals.

scholarly journals Molecular and developmental characterization of the heat shock cognate 4 gene of Drosophila melanogaster.

1990 ◽  
Vol 10 (6) ◽  
pp. 3232-3238 ◽  
Author(s):  
L A Perkins ◽  
J S Doctor ◽  
K Zhang ◽  
L Stinson ◽  
N Perrimon ◽  
...  
Keyword(s):  
Drosophila Melanogaster ◽  
Heat Shock ◽  
Gene Family ◽  
Rapid Growth ◽  
Developmental Expression ◽  
Hsp70 Gene ◽  
Abundant Protein ◽  
Cognate Gene ◽  
Gene 4

The Drosophila heat shock cognate gene 4 (hsc4), a member of the hsp70 gene family, encodes an abundant protein, hsc70, that is more similar to the constitutively expressed human protein than the Drosophila heat-inducible hsp70. Developmental expression revealed that hsc4 transcripts are enriched in cells active in endocytosis and those undergoing rapid growth and changes in shape.

247 ASSOCIATIONS BETWEEN HEAT SHOCK PROTEIN 70 GENETIC POLYMORPHISMS AND CALVING RATES OF BRAHMAN-INFLUENCED COWS

2010 ◽  
Vol 22 (1) ◽  
pp. 281
Author(s):  
C. Rosenkrans Jr ◽  
A. Banks ◽  
S. Reiter ◽  
L. Starkey ◽  
M. Looper
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Genetic Polymorphisms ◽  
Heat Shock Protein 70 ◽  
Promoter Region ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Hsp70 Promoter ◽  
Single Nucleotide

Stress proteins and their genetic polymorphisms have been associated with decreased male and female fertility. Our objectives were to 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 (Hsp70) gene and 2) evaluate associations between Hsp70 SNP and calving rates of multiparous Brahman-influenced cows (n = 99). Genomic DNA was extracted from the buffy coats of EDTA- treated whole blood. Primers HSP-Pro749F (GCCAGGAAACCAGAGACAGA) and HSP-Pro1268R (CCTACGCAGGAGTAGGTGGT) were used for PCR amplification of a 539-base segment of the bovine Hsp70 promoter (GenBank accession number M98823). Eleven single nucleotide polymorphisms were detected: 8 transitions (G1013A, n = 2; G1045A, n = 8; C1069T, n = 4; A1096G, n = 14; G1117A, n = 12; T1134C, n = 7; C1154G, n = 11; andT1204C, n = 56), 2 transversions (A1125C, n = 53; and G1128T, n = 51), and 1 deletion at base position 895 (n = 37). Within an SNP, calving percentages were compared by chi-square analysis. Concentrations of Hsp70 and Julian date were analyzed by ANOVA, with each SNP represented as the main effect in the model. Cows that were homozygous for the minor allele at both transversion (A1125C and G1128T) sites had lower (P < 0.05) calving rates when compared with cows that were homozygous for the primary allele (48 v. 75%). Homozygous and heterozygous deletion of cytosine at base 895 resulted in lower (P < 0.05) calving percentages than homozygous cytosine cows (8, 50, 82%; respectively). In addition, DD cows had the latest (P < 0.05) Julian calving date. Eighteen Hsp70 promoter haplotypes were deduced, and 7 of those haplotypes (n = 37) included the deletion at base 895. Thirty-two cows had the haplotype consistent with the sequence deposited at GenBank, and the remaining 30 cows had an SNP other than the deletion. Cows with the deletion haplotypes had greater (P < 0.05) serum Hsp70 concentrations and lower (P < 0.05) calving rates (5.1, 4.7, and 3.5 MSE 0.5 ng mL-1; and 35, 78, and 87%; respectively, for Deletion, No, and Yes). Furthermore, cows with the deletion haplotypes had the latest (P < 0.05) Julian calving date (85, 77, and 73 d, respectively, for Deletion, No, and Yes). Our results suggest that the promoter region of the bovine Hsp70 gene is polymorphic and might be useful in selecting cows with greater fertility.

HSEAT: A Tool for Plant Heat Shock Element Analysis, Motif Identification and Analysis

2020 ◽  
Vol 15 (3) ◽  
pp. 196-203 ◽  
Author(s):  
Sarah Rizwan Qazi ◽  
Noor ul Haq ◽  
Shakeel Ahmad ◽  
Samina N. Shakeel
Keyword(s):  
Heat Shock ◽  
Differential Expression ◽  
Promoter Region ◽  
Analysis Tool ◽  
Promoter Regions ◽  
Heat Shock Element ◽  
Element Analysis ◽  
Cis Acting ◽  
Plant Genes ◽  
Hsp Genes

Background: Previous methods used to discover cis-regulatory motifs in promoter region of plant genes possess very limited performance, especially for analysis of novel and rare motifs. Different plant genes have differential expression under different environmental or experimental conditions and modular regulation of cis-regulatory sequences in promoter regions of the same or different genes. It has previously been revealed that Heat Shock Proteins (HSPs) creation is correlated with plant tolerance under heat and other stress conditions. Regulation of these HSP genes is controlled by interactions between heat shock factors (HSFs) with cis-acting motifs present in the promoter region of the genes. Differential expression of these HSP genes is because of their unique promoter architecture, cis-acting sequences and their interaction with HSFs. Objective: A versatile promoter analysis tool was proposed for identification and analysis of promoters of HSPs. Methods: Heat Shock Element Analysis Tool (HSEAT) has been implemented in java programming language using pattern recognition approach. This tool has build-in MS access database for storing different motifs. Results: HSEAT has been designed to detect different types of Heat Shock Elements (HSEs) in promoter regions of plant HSPs with integration of complete analysis of plant promoters to the tool. HSEAT is user-friendly, interactive application to discover various types of HSEs e.g. TTC Rich Types, Gap Types and Prefect HSE as well as STRE in HSPs. Here we examined and evaluated some known HSP promoters from different plants using this tool with already available tools. Conclusion: HSEAT has extensive potential to explore conserved or semi-conserved motifs or potential binding sites of different transcription factors for other stress regulating genes. This tool can be found at https://sourceforge.net/projects/heast/.

Developmental-stage-specific expression of the hsp70 gene family during differentiation of the mammalian male germ line

1987 ◽  
Vol 7 (5) ◽  
pp. 1791-1796
Author(s):  
Z F Zakeri ◽  
D J Wolgemuth
Keyword(s):  
Heat Shock ◽  
Gene Family ◽  
Germ Line ◽  
Cell Lineage ◽  
Hsp70 Gene ◽  
Developmentally Regulated ◽  
Specific Expression ◽  
Hsp70 Mrna ◽  
Somatic Tissues ◽  
Exogenous Stress

Mouse somatic tissues contain low levels of transcripts homologous to the heat shock-inducible and cognate members of the heat shock protein 70 (hsp70) gene family. An abundant, unique sized hsp70 mRNA of 2.7 kilobases (kb) is present in testes in the absence of exogenous stress. Its expression is restricted to germ cells and is developmentally regulated. The 2.7-kb transcript first appears during the haploid phase of spermatogenesis and is stable throughout the morphogenic stages of spermiogenesis. A 2.7-kb hsp70 mRNA is present in rat and human testes. These observations suggest that a member of the hsp70 gene family plays a role in the development of the mammalian male germ cell lineage.

Identification and sequence analysis of a new member of the mouse HSP70 gene family and characterization of its unique cellular and developmental pattern of expression in the male germ line

1988 ◽  
Vol 8 (7) ◽  
pp. 2925-2932
Author(s):  
Z F Zakeri ◽  
D J Wolgemuth ◽  
C R Hunt
Keyword(s):  
Heat Shock ◽  
Gene Family ◽  
Developmental Stages ◽  
Germ Line ◽  
Cell Lineage ◽  
Hsp70 Gene ◽  
Coding Region ◽  
Male Germ Line ◽  
Sequence Organization

A unique member of the mouse HSP70 gene family has been isolated and characterized with respect to its DNA sequence organization and expression. The gene contains extensive similarity to a heat shock-inducible HSP70 gene within the coding region but diverges in both 3' and 5' nontranslated regions. The gene does not yield transcripts in response to heat shock in mouse L cells. Rather, the gene appears to be activated uniquely in the male germ line. Analysis of RNA from different developmental stages and from enriched populations of spermatogenic cells revealed that this gene is expressed during the prophase stage of meiosis. A transcript different in size from the major heat-inducible mouse transcripts is most abundant in meiotic prophase spermatocytes and decreases in abundance in postmeiotic stages of spermatogenesis. This pattern of expression is distinct from that observed for another member of this gene family, which was previously shown to be expressed abundantly in postmeiotic germ cells. These observations suggest that specific HSP70 gene family members play distinct roles in the differentiation of the germ cell lineage in mammals.

scholarly journals RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells.

1986 ◽  
Vol 6 (11) ◽  
pp. 3984-3989 ◽  
Author(s):  
D S Gilmour ◽  
J T Lis
Keyword(s):  
Drosophila Melanogaster ◽  
Heat Shock ◽  
Rna Polymerase ◽  
Rna Polymerase Ii ◽  
Promoter Region ◽  
High Energy ◽  
Heat Shock Gene ◽  
Cross Linking ◽  
Hsp70 Gene

By using a protein-DNA cross-linking method (D. S. Gilmour and J. T. Lis, Mol. Cell. Biol. 5:2009-2018, 1985), we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation.

Molecular and developmental characterization of the heat shock cognate 4 gene of Drosophila melanogaster

1990 ◽  
Vol 10 (6) ◽  
pp. 3232-3238
Author(s):  
L A Perkins ◽  
J S Doctor ◽  
K Zhang ◽  
L Stinson ◽  
N Perrimon ◽  
...  
Keyword(s):  
Drosophila Melanogaster ◽  
Heat Shock ◽  
Gene Family ◽  
Rapid Growth ◽  
Developmental Expression ◽  
Hsp70 Gene ◽  
Abundant Protein ◽  
Cognate Gene ◽  
Gene 4

The Drosophila heat shock cognate gene 4 (hsc4), a member of the hsp70 gene family, encodes an abundant protein, hsc70, that is more similar to the constitutively expressed human protein than the Drosophila heat-inducible hsp70. Developmental expression revealed that hsc4 transcripts are enriched in cells active in endocytosis and those undergoing rapid growth and changes in shape.

scholarly journals A consensus sequence polymer inhibits in vivo expression of heat shock genes.

1986 ◽  
Vol 6 (9) ◽  
pp. 3200-3206 ◽  
Author(s):  
H Xiao ◽  
J T Lis
Keyword(s):  
Heat Shock ◽  
Consensus Sequence ◽  
Plasmid Vector ◽  
Regulatory Elements ◽  
Hsp70 Gene ◽  
Heat Shock Genes ◽  
Cis Acting ◽  
Consensus Sequences ◽  
Activity Measurements

Promoter function for hsp70 gene expression in Drosophila melanogaster was studied with an in vivo competition assay. A polymer of 40 tandem copies of the pair of regulatory elements of the hsp70 gene was constructed and cloned into a plasmid vector. Various marked genes were cotransfected with the polymer plasmid into Schneider line 2 cells, and their expression was determined by enzyme activity measurements. The polymer dramatically inhibited expression of cotransfected hsp70, hsp26, and hsp83 genes, but not cotransfected copia and histone genes. Our results indicate that in vivo, a trans-acting, positive regulatory factor, which can be titrated by heat shock consensus sequences, is required for activation of heat shock genes and is specific for these genes; the coordinate induction of different heat shock genes appears to be mediated by similar, but not identical, interactions of the trans-acting induction factor and the cis-acting heat shock consensus sequences; and the uninduced or basal level expression of the transfected hsp70 gene is also due to interaction of the consensus sequence with a positively acting factor.

Sign in / Sign up

Export Citation Format

Share Document