scholarly journals Salmonella and Escherichia coli O157:H7 Survival in Soil and Translocation into Leeks (Allium porrum) as Influenced by an Arbuscular Mycorrhizal Fungus (Glomus intraradices)

2013 ◽  
Vol 79 (6) ◽  
pp. 1813-1820 ◽  
Author(s):  
Joshua B. Gurtler ◽  
David D. Douds ◽  
Brian P. Dirks ◽  
Jennifer J. Quinlan ◽  
April M. Nicholson ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Glomus Intraradices ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Allium Porrum ◽  
Escherichia Coli O157 ◽  
Content Type ◽  
E Coli ◽  
The Mean

ABSTRACTA study was conducted to determine the influence of arbuscular mycorrhizal (AM) fungi onSalmonellaand enterohemorrhagicEscherichia coliO157:H7 (EHEC) in autoclaved soil and translocation into leek plants. Six-week-old leek plants (with [Myc+] or without [Myc−] AM fungi) were inoculated with composite suspensions ofSalmonellaor EHEC at ca. 8.2 log CFU/plant into soil. Soil, root, and shoot samples were analyzed for pathogens on days 1, 8, 15, and 22 postinoculation. Initial populations (day 1) were ca. 3.1 and 2.1 log CFU/root, ca. 2.0 and 1.5 log CFU/shoot, and ca. 5.5 and 5.1 CFU/g of soil forSalmonellaand EHEC, respectively. Enrichments indicated that at days 8 and 22, only 31% of root samples were positive for EHEC, versus 73% positive forSalmonella. The meanSalmonellalevel in soil was 3.4 log CFU/g at day 22, while EHEC populations dropped to ≤0.75 log CFU/g by day 15. Overall,Salmonellasurvived in a greater number of shoot, root, and soil samples, compared with the survival of EHEC. EHEC was not present in Myc− shoots after day 8 (0/16 samples positive); however, EHEC persisted in higher numbers (P= 0.05) in Myc+ shoots (4/16 positive) at days 15 and 22.Salmonella, likewise, survived in statistically higher numbers of Myc+ shoot samples (8/8) at day 8, compared with survival in Myc− shoots (i.e., only 4/8). These results suggest that AM fungi may potentially enhance the survival ofE. coliO157:H7 andSalmonellain the stems of growing leek plants.

Frequent cultivation prior to planting to prevent weed competition results in an opportunity for the use of arbuscular mycorrhizal fungus inoculum

2011 ◽  
Vol 27 (4) ◽  
pp. 251-255 ◽  
Author(s):  
David D. Douds ◽  
Gerald Nagahashi ◽  
John E. Shenk
Keyword(s):  
Management Practices ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Indigenous Populations ◽  
Paspalum Notatum ◽  
Allium Porrum ◽  
Potential Yield ◽  
Greenhouse Production ◽  
Synthetic Chemicals

AbstractInoculation with arbuscular mycorrhizal (AM) fungi is a potentially useful tool in agricultural systems with limited options regarding use of synthetic chemicals for fertility and pest control. We tested the response ofAllium porrumcv. Lancelot to inoculation with AM fungi in a field high in available P (169 μg g−1soil) that had been repeatedly cultivated to control weeds. Seedlings were inoculated during the greenhouse production period with a mixed species inoculum produced on-farm in a compost and vermiculite medium withPaspalum notatumFlugge as a nurse host. Inoculated and uninoculated seedlings were the same size at outplanting. Inoculated seedlings were over 2.5-fold greater in shoot weight and shoot P content than uninoculated seedlings at harvest. These results demonstrate the potential yield benefits from inoculation with AM fungi in situations where farm management practices may negatively impact on indigenous populations of AM fungi.

scholarly journals Fecal Metagenome Sequences from Lactating Dairy Cows Shedding Escherichia coli O157:H7

2018 ◽  
Vol 7 (18) ◽  
Author(s):  
Serajus Salaheen ◽  
Seon Woo Kim ◽  
Jeffrey S. Karns ◽  
Bradd J. Haley ◽  
Jo Ann S. Van Kessel
Keyword(s):  
Escherichia Coli ◽  
Dairy Cows ◽  
Causative Agent ◽  
Public Domain ◽  
Escherichia Coli O157 ◽  
Content Type ◽  
The Public ◽  
E Coli ◽  
Lactating Dairy Cows ◽  
Human Infections

Cattle are primary reservoirs of Escherichia coli O157:H7, a causative agent of severe human infections. To facilitate analyses of the communities in which this pathogen is found, we sequenced the fecal metagenomes of 10 dairy cows shedding E. coli O157:H7 and added them to the public domain.

scholarly journals Intraradical Dynamics of Two Coexisting Isolates of the Arbuscular Mycorrhizal Fungus Glomus intraradices Sensu Lato as Estimated by Real-Time PCR of Mitochondrial DNA

2012 ◽  
Vol 78 (10) ◽  
pp. 3630-3637 ◽  
Author(s):  
Karol Krak ◽  
Martina Janoušková ◽  
Petra Caklová ◽  
Miroslav Vosátka ◽  
Helena Štorchová
Keyword(s):  
Mitochondrial Dna ◽  
Real Time ◽  
Real Time Pcr ◽  
Glomus Intraradices ◽  
Large Subunit ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Content Type ◽  
Copy Numbers ◽  
Pcr Assays

ABSTRACTReal-time PCR in nuclear ribosomal DNA (nrDNA) is becoming a well-established tool for the quantification of arbuscular mycorrhizal (AM) fungi, but this genomic region does not allow the specific amplification of closely related genotypes. The large subunit of mitochondrial DNA (mtDNA) has a higher-resolution power, but mtDNA-based quantification has not been previously explored in AM fungi. We applied real-time PCR assays targeting the large subunit of mtDNA to monitor the DNA dynamics of two isolates ofGlomus intraradicessensu lato coexisting in the roots of medic (Medicago sativa). The mtDNA-based quantification was compared to quantification in nrDNA. The ratio of copy numbers determined by the nrDNA- and mtDNA-based assays consistently differed between the two isolates. Within an isolate, copy numbers of the nuclear and the mitochondrial genes were closely correlated. The two quantification approaches revealed similar trends in the dynamics of both isolates, depending on whether they were inoculated alone or together. After 12 weeks of cultivation, competition between the two isolates was observed as a decrease in the mtDNA copy numbers of one of them. The coexistence of two closely related isolates, which cannot be discriminated by nrDNA-based assays, was thus identified as a factor influencing the dynamics of AM fungal DNA in roots. Taken together, the results of this study show that real-time PCR assays targeted to the large subunit of mtDNA may become useful tools for the study of coexisting AM fungi.

scholarly journals Physical Covering for Control of Escherichia coli O157:H7 and Salmonella spp. in Static and Windrow Composting Processes

2015 ◽  
Vol 81 (6) ◽  
pp. 2063-2074 ◽  
Author(s):  
Jitendra R. Patel ◽  
Irene Yossa ◽  
Dumitru Macarisin ◽  
Patricia Millner
Keyword(s):  
Escherichia Coli ◽  
Escherichia Coli O157 ◽  
Bacterial Reduction ◽  
Salmonella Spp ◽  
Rapid Reduction ◽  
Content Type ◽  
E Coli ◽  
Windrow Composting ◽  
Composting Systems ◽  
Feedstock Material

ABSTRACTThis study investigated the effect of a 30-cm covering of finished compost (FC) on survival ofEscherichia coliO157:H7 andSalmonellaspp. in active static and windrow composting systems. Feedstocks inoculated withE. coliO157:H7 (7.41 log CFU/g) andSalmonella(6.46 log CFU/g) were placed in biosentry tubes (7.5-cm diameter, 30-cm height) at three locations: (i and ii) two opposing sides at the interface between the FC cover layer (where present) and the feedstock material (each positioned approximately 10 cm below the pile's surface) and (iii) an internal location (top) (approximately 30 cm below the surface). On specific sampling days, surviving populations of inoculatedE. coliO157:H7 andSalmonella, genericE. coli, and coliforms in compost samples were determined.Salmonellaspp. were reduced significantly within 24 h in windrow piles and were below the detection limit after 3 and 7 days at internal locations of windrow and static piles containing FC covering, respectively. Likewise,E. coliO157:H7 was undetectable after 1 day in windrow piles covered with finished compost. Use of FC as a covering layer significantly increased the number of days that temperatures in the windrows remained ≥55°C at all locations and in static piles at internal locations. These time-temperature exposures resulted in rapid reduction of inoculated pathogens, and the rate of bacterial reduction was rapid in windrow piles. The sample location significantly influenced the survival of these pathogens at internal locations compared to that at interface locations of piles. Finished compost covering of compost piles aids in the reduction of pathogens during the composting process.

Inactivation of Escherichia coli O157:H7 in Minute Steaks Cooked under Selected Conditions

2017 ◽  
Vol 80 (10) ◽  
pp. 1641-1647
Author(s):  
Xianqin Yang ◽  
Julia Devos ◽  
Mark D. Klassen
Keyword(s):  
Escherichia Coli ◽  
Cooking Time ◽  
Escherichia Coli O157 ◽  
Time Intervals ◽  
Hot Plate ◽  
E Coli ◽  
Cooking Practices ◽  
Medium Level ◽  
The Mean ◽  
Pan Frying

ABSTRACT A national survey was conducted in Canada to determine consumer cooking practices for minute steaks (thin, mechanically tenderized beef cutlets). Results indicate that most Canadians prefer cooking minute steaks by pan frying and to a medium level of doneness. To identify safe cooking conditions, retail minute steaks (∼125 g), inoculated at three sites per steak with a five-strain cocktail of nontoxigenic Escherichia coli O157:H7 (6.1 log CFU per site), were cooked on a hot plate (200°C), mimicking a pan-frying scenario. The steaks (n = 5) were cooked for 4, 6, 8, or 10 min with turning over (flipping) up to four times at equal time intervals; or to 63 or 71°C at the thickest area with or without a tinfoil lid. When cooked for 4 min, E. coli O157:H7 was recovered from all inoculation sites, and the mean reductions at various sites (1.2 to 3.4 log CFU per site) were not different (P > 0.05), irrespective of the flipping frequency. When cooked for 6 min with flipping once or twice, or for 8 min with flipping once, E. coli O157:H7 was recovered from most sites; the mean reductions (3.8 to 5.3 log CFU per site) were not different (P > 0.05), but they were higher (P < 0.05) than those for steaks cooked for 4 min. When cooked for 10, 8, or 6 min with flipping once, twice, or three times, respectively, E. coli O157:H7 was eliminated from most sites, but sites with <5-log reductions were found. Reductions of E. coli O157:H7 by >5 log at all inoculation sites were attained when the steaks were cooked for 10 or 8 min with two or more or three or more flippings, respectively, or for 6 min with four flippings. When flipped twice during cooking to 63 or 71°C, E. coli O157:H7 was recovered from three or fewer sites; however, >5-log reductions throughout the steaks were only attained for the latter temperature, irrespective of whether the hot plate was covered with the tinfoil lid. Thus, turning over minute steaks twice during cooking to 71°C or flipping two, three, or four times with a cooking time of 10, 8, or 6 min could achieve 5-log reductions throughout the steaks.

scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

scholarly journals Complete Genome Sequences of Novel Bovine T4, rv5-Like, and Dhillonviruses Effective against Escherichia coli O157

2021 ◽  
Vol 10 (1) ◽  
Author(s):  
Domonkos Sváb ◽  
Linda Falgenhauer ◽  
Trinad Chakraborty ◽  
István Tóth
Keyword(s):  
Escherichia Coli ◽  
Complete Genome ◽  
Escherichia Coli O157 ◽  
Genome Sequences ◽  
Content Type ◽  
E Coli ◽  
Zoonotic Pathogens

ABSTRACT Enterohemorrhagic Escherichia coli (EHEC) isolates of serotype O157:H7 are serious foodborne zoonotic pathogens and prime targets for biocontrol using bacteriophages. We report on the complete genome sequences of 11 novel lytic bacteriophages, representing three viral genera, isolated from cattle in Hungary that target E. coli O157 strains.

scholarly journals Genetic Exchange in an Arbuscular Mycorrhizal Fungus Results in Increased Rice Growth and Altered Mycorrhiza-Specific Gene Transcription

2011 ◽  
Vol 77 (18) ◽  
pp. 6510-6515 ◽  
Author(s):  
Alexandre Colard ◽  
Caroline Angelard ◽  
Ian R. Sanders
Keyword(s):  
Plant Growth ◽  
Gene Transcription ◽  
Glomus Intraradices ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Genetic Exchange ◽  
Fungal Colonization ◽  
Specific Gene ◽  
Content Type ◽  
Rice Growth

ABSTRACTArbuscular mycorrhizal fungi (AMF) are obligate symbionts with most terrestrial plants. They improve plant nutrition, particularly phosphate acquisition, and thus are able to improve plant growth. In exchange, the fungi obtain photosynthetically fixed carbon. AMF are coenocytic, meaning that many nuclei coexist in a common cytoplasm. Genetic exchange recently has been demonstrated in the AMFGlomus intraradices, allowing nuclei of differentGlomus intraradicesstrains to mix. Such genetic exchange was shown previously to have negative effects on plant growth and to alter fungal colonization. However, no attempt was made to detect whether genetic exchange in AMF can alter plant gene expression and if this effect was time dependent. Here, we show that genetic exchange in AMF also can be beneficial for rice growth, and that symbiosis-specific gene transcription is altered by genetic exchange. Moreover, our results show that genetic exchange can change the dynamics of the colonization of the fungus in the plant. Our results demonstrate that the simple manipulation of the genetics of AMF can have important consequences for their symbiotic effects on plants such as rice, which is considered the most important crop in the world. Exploiting natural AMF genetic variation by generating novel AMF genotypes through genetic exchange is a potentially useful tool in the development of AMF inocula that are more beneficial for crop growth.

scholarly journals Identification and Characterization of Spontaneous Deletions within the Sp11-Sp12 Prophage Region of Escherichia coli O157:H7 Sakai

2013 ◽  
Vol 79 (6) ◽  
pp. 1934-1941 ◽  
Author(s):  
Chun Chen ◽  
Carrie R. Lewis ◽  
Kakolie Goswami ◽  
Elisabeth L. Roberts ◽  
Chitrita DebRoy ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Type Iii Secretion ◽  
Genomic Region ◽  
Escherichia Coli O157 ◽  
Content Type ◽  
E Coli ◽  
Food Borne ◽  
Genes Encoding ◽  
Identification And Characterization

ABSTRACTProphages make up 12% of the enterohemorrhagicEscherichia coligenome and play prominent roles in the evolution and virulence of this food-borne pathogen. Acquisition and loss of and rearrangements within prophage regions are the primary causes of differences in pulsed-field gel electrophoresis (PFGE) patterns among strains ofE. coliO157:H7. Sp11 and Sp12 are two tandemly integrated and putatively defective prophages carried byE. coliO157:H7 strain Sakai. In this study, we identified 3 classes of deletions that occur within the Sp11-Sp12 region, at a frequency of ca. 7.74 × 10−4. One deletion resulted in a precise excision of Sp11, and the other two spanned the junction of Sp11 and Sp12. All deletions resulted in shifts in the XbaI fragment pattern observed by PFGE. We sequenced the inducible prophage pool of Sakai but did not identify any mature phage particles corresponding to either Sp11 or Sp12. Deletions containingpchBandpsrC, which are Sp11-carried genes encoding proteins known or suspected to regulate type III secretion, did not affect the secretion levels of the EspA or EspB effector. Alignment of the Sp11-Sp12 DNA sequence with its corresponding regions in otherE. coliO157:H7 and O55:H7 strains suggested that homologous recombination rather than integrase-mediated excision is the mechanism behind these deletions. Therefore, this study provides a mechanism behind the previously observed genetic instability of this genomic region ofE. coliO157:H7.

scholarly journals Characterization of a Novel Microcin That Kills Enterohemorrhagic Escherichia coli O157:H7 and O26

2012 ◽  
Vol 78 (18) ◽  
pp. 6592-6599 ◽  
Author(s):  
Lauren J. Eberhart ◽  
James R. Deringer ◽  
Kelly A. Brayton ◽  
Ashish A. Sawant ◽  
Thomas E. Besser ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Enterohemorrhagic Escherichia Coli ◽  
Logarithmic Phase ◽  
Type I ◽  
Escherichia Coli O157 ◽  
Content Type ◽  
E Coli ◽  
Secretion Pathway ◽  
Dependent Inhibition

ABSTRACTA novel phenotype was recently identified in which specific strains ofEscherichia coliinhibit competingE. colistrains via a mechanism that was designated “proximity-dependent inhibition” (PDI). PDI-expressing (PDI+)E. coliis known to inhibit susceptible (PDI−)E. colistrains, including several enterohemorrhagic (EHEC) and enterotoxigenic (ETEC)E. colistrains. In this study, every strain from a genetically diverse panel ofE. coliO157:H7 (n= 25) and additional strains ofE. coliserovar O26 were susceptible to the PDI phenotype. LIVE/DEAD staining was consistent with inhibition by killing of susceptible cells. Comparative genome analysis identified the genetic component of PDI, which is composed of a plasmid-borne (Incl1) operon encoding a putative microcin and associated genes for transport, immunity, and microcin activation. Transfer of the plasmid to a PDI−strain resulted in transfer of the phenotype, and deletion of the genes within the operon resulted in loss of the inhibition phenotype. Deletion of chromosomally encodedtolCalso resulted in loss of the inhibitory phenotype, and this confirmed that the putative microcin is most likely secreted via a type I secretion pathway. Deletion of an unrelated plasmid gene did not affect the PDI phenotype. Quantitative reverse transcription (RT)-PCR demonstrated that microcin expression is correlated with logarithmic-phase growth. The ability to inhibit a diversity ofE. colistrains indicates that this microcin may influence gut community composition and could be useful for control of important enteric pathogens.

Sign in / Sign up

Export Citation Format

Share Document