Genetic analysis of microcin H47 immunity

1998 ◽  
Vol 44 (7) ◽  
pp. 692-697 ◽  
Author(s):  
Eliana Rodríguez ◽  
Magela Laviña
Keyword(s):  
Gene Fusion ◽  
Genetic System ◽  
Cellular Membrane ◽  
Peptide Analysis ◽  
Extracellular Medium ◽  
Hybrid Proteins ◽  
Site Of Action ◽  
Membrane Peptide ◽  
Highly Hydrophobic

Microcin H47 is a bactericidal antibiotic produced by a natural Escherichia coli isolate. The genetic system encoding microcin production and immunity consists of at least seven clustered genes. Four of these are devoted to microcin biosynthesis and two genes are required for its secretion into the extracellular medium. The product of the seventh gene, mchI, determines the cell's self-immunity. This gene was shown to encode a highly hydrophobic 69-residue peptide. Analysis of the MchI amino acid sequence, as well as the characterization of MchI–PhoA hybrid proteins, indicated that the microcin immunity product is probably exported out of the cytoplasm and remains an integral membrane peptide. This localization of the immunity peptide points to the cellular membrane as the site of action of microcin H47. Key words: microcin H47, microcin immunity, phoA gene fusion, membrane peptide.

The Structural Gene for Microcin H47 Encodes a Peptide Precursor with Antibiotic Activity

1999 ◽  
Vol 43 (9) ◽  
pp. 2176-2182 ◽  
Author(s):  
Eliana Rodríguez ◽  
Carina Gaggero ◽  
Magela Laviña
Keyword(s):  
Escherichia Coli ◽  
Gene Fusion ◽  
Genetic System ◽  
Antibiotic Activity ◽  
Peptide Antibiotic ◽  
Bifunctional Protein ◽  
Naturally Occurring ◽  
Hydrophobic Peptide ◽  
Peptide Precursor ◽  
Highly Hydrophobic

ABSTRACT Microcin H47 is a bactericidal antibiotic produced by a naturally occurring Escherichia coli strain isolated in Uruguay. The microcin genetic system is located in the chromosome and extends over a 10-kb DNA segment containing the genes required for microcin synthesis, secretion, and immunity. The smallest microcin synthesis gene,mchB, was sequenced and shown to encode a highly hydrophobic peptide. An mchB-phoA gene fusion, which directed the synthesis of a hybrid bifunctional protein with both PhoA and microcin H47-like activities, was isolated. The results presented herein lead us to propose that microcin H47 is indeed a ribosomally synthesized peptide antibiotic and that its peptide precursor already has antibiotic activity of the same specificity as that of mature microcin.

scholarly journals Molecular cloning and analysis of l(1)ogre, a locus of Drosophila melanogaster with prominent effects on the postembryonic development of the central nervous system.

Genetics ◽  
1990 ◽  
Vol 126 (4) ◽  
pp. 1033-1044 ◽  
Author(s):  
T Watanabe ◽  
D R Kankel
Keyword(s):  
Central Nervous System ◽  
Nervous System ◽  
Postembryonic Development ◽  
P Element ◽  
Reading Frame ◽  
Isolation And Characterization ◽  
The Central Nervous System ◽  
Highly Hydrophobic ◽  
Conceptual Translation

Abstract Previous genetic studies have shown that wild-type function of the l(1)ogre (lethal (1) optic ganglion reduced) locus is essential for the generation and/or maintenance of the postembryonic neuroblasts including those from which the optic lobe is descended. In the present study molecular isolation and characterization of the l(1)ogre locus was carried out to study the structure and expression of this gene in order to gain information about the nature of l(1)ogre function and its relevance to the development of the central nervous system. About 70 kilobases (kb) of genomic DNA were isolated that spanned the region where l(1)ogre was known to reside. Southern analysis of a l(1)ogre mutation and subsequent P element-mediated DNA transformation mapped the l(1)ogre+ function within a genomic fragment of 12.5 kb. Northern analyses showed that a 2.9-kb message transcribed from this 12.5-kb region represented l(1)ogre. A 2.15-kb portion of a corresponding cDNA clone was sequenced. An open reading frame (ORF) of 1,086 base paris was found, and a protein sequence of 362 amino acids with one highly hydrophobic segment was deduced from conceptual translation of this ORF.

scholarly journals A g-Type Lysozyme from Deep-Sea Hydrothermal Vent Shrimp Kills Selectively Gram-Negative Bacteria

Molecules ◽  
2021 ◽  
Vol 26 (24) ◽  
pp. 7624
Author(s):  
Jing-Chang Luo ◽  
Jian Zhang ◽  
Li Sun
Keyword(s):  
Deep Sea ◽  
Hydrothermal Vent ◽  
Binding Capacity ◽  
Cellular Membrane ◽  
Structural Features ◽  
Gram Negative Bacteria ◽  
Gram Negative ◽  
Bacterial Binding ◽  
Muramidase Activity

Lysozyme is a key effector molecule of the innate immune system in both vertebrate and invertebrate. It is classified into six types, one of which is the goose-type (g-type). To date, no study on g-type lysozyme in crustacean has been documented. Here, we report the identification and characterization of a g-type lysozyme (named LysG1) from the shrimp inhabiting a deep-sea hydrothermal vent in Manus Basin. LysG1 possesses conserved structural features of g-type lysozymes. The recombinant LysG1 (rLysG1) exhibited no muramidase activity and killed selectively Gram-negative bacteria in a manner that depended on temperature, pH, and metal ions. rLysG1 bound target bacteria via interaction with bacterial cell wall components, notably lipopolysaccharide (LPS), and induced cellular membrane permeabilization, which eventually caused cell lysis. The endotoxin-binding capacity enabled rLysG1 to alleviate the inflammatory response induced by LPS. Mutation analysis showed that the bacterial binding and killing activities of rLysG1 required the integrity of the conserved α3 and 4 helixes of the protein. Together, these results provide the first insight into the activity and working mechanism of g-type lysozyme in crustacean and deep-sea organisms.

scholarly journals Sorbitol Transporter Expression in Apple Sink Tissues: Implications for Fruit Sugar Accumulation and Watercore Development

2005 ◽  
Vol 130 (2) ◽  
pp. 261-268 ◽  
Author(s):  
Zhifang Gao ◽  
Sastry Jayanty ◽  
Randolph Beaudry ◽  
Wayne Loescher
Keyword(s):  
Membrane Transport ◽  
Sour Cherry ◽  
Apium Graveolens ◽  
Sugar Accumulation ◽  
Isolation And Characterization ◽  
Photosynthetic Product ◽  
Highly Hydrophobic ◽  
Major Facilitator ◽  
Transporter Expression

In apple (Malus ×domestica Borkh.), where sorbitol is a primary photosynthetic product that is translocated throughout the plant, accumulation of sorbitol in sink cells appears to require an active carrier-mediated membrane transport step. Recent progress in isolation and characterization of genes for sorbitol transporters in sour cherry (Prunus cerasus L.) and mannitol transporters in celery (Apium graveolens L.) suggested that similar transporters may be present in apple tissues. A defect in these transporters could also explain the occurrence of the fruit disorder watercore, characterized by the accumulation of fluids and sorbitol in the apoplasmic free space. Our objectives therefore included isolation and characterization of genes for sorbitol transporters in apple tissues and comparisons of expression of transporter genes, especially in various sink tissues including watercored and non-watercored fruit tissues. We have isolated and characterized two sorbitol transporter genes, MdSOT1 and MdSOT2. Sequence analyses indicated that these are members of the major facilitator transporter superfamily that gives rise to highly hydrophobic integral membrane proteins. Heterologous expression and measurement of sorbitol uptake in yeast indicated that these are specific and with high affinities for sorbitol, with Kms for sorbitol of 1.0 and 7.8 mm for MdSOT1 and MdSOT2, respectively. Sorbitol transporter expression was evident in all sink tissues tested with the exception of watercore-affected fruit tissues. Sorbitol accumulation in apple sink tissues thus involves an apoplasmic active membrane transport step and watercore results from a defect in that process.

Characterization of a rarely reported STAT5B/RARA gene fusion in a young adult with newly diagnosed acute promyelocytic leukemia with resistance to ATRA therapy

2019 ◽  
Vol 237 ◽  
pp. 51-54
Author(s):  
Jess F. Peterson ◽  
Rui R. He ◽  
Hassan Nayer ◽  
Raymund S. Cuevo ◽  
James B. Smadbeck ◽  
...  
Keyword(s):  
Young Adult ◽  
Acute Promyelocytic Leukemia ◽  
Gene Fusion ◽  
Promyelocytic Leukemia ◽  
Newly Diagnosed

Purification of heat shock protein 90 from calf uterus and rat liver and characterization of the highly hydrophobic region

1989 ◽  
Vol 992 (1) ◽  
pp. 1-8 ◽  
Author(s):  
Masaomi Iwasaki ◽  
Hiroyuki Saito ◽  
Masahide Yamamoto ◽  
Kenneth S. Korach ◽  
Tsuneyoshi Hirogome ◽  
...  
Keyword(s):  
Heat Shock ◽  
Heat Shock Protein ◽  
Rat Liver ◽  
Heat Shock Protein 90 ◽  
Hydrophobic Region ◽  
Highly Hydrophobic

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis

Microbiology ◽  
2011 ◽  
Vol 157 (9) ◽  
pp. 2670-2680 ◽  
Author(s):  
Iria Uhía ◽  
Beatriz Galán ◽  
Francisco Javier Medrano ◽  
José Luis García
Keyword(s):  
Mycobacterium Smegmatis ◽  
Transcription Start ◽  
Promoter Regions ◽  
Degradative Pathway ◽  
Terminal Domain ◽  
Heterologous System ◽  
Highly Hydrophobic ◽  
Extension Analysis

The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSDMS) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P5228 promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5′ untranslated region (5′UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the −5 and −35 positions with respect to the transcription start site. This region overlaps with the −10 and −35 boxes of the P5228 promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P5228 –β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P5228 promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism.

Isolation and Characterization of a Highly Hydrophobic New Bacteriocin (Gassericin A) fromLactobacillus gasseriLA39

1994 ◽  
Vol 58 (7) ◽  
pp. 1218-1221 ◽  
Author(s):  
Yasushi Kawai ◽  
Tadao Saito ◽  
Takahiro Toba ◽  
Shantanu K. Samant ◽  
Takatoshi Itoh
Keyword(s):  
Isolation And Characterization ◽  
Highly Hydrophobic
Sign in / Sign up

Export Citation Format

Share Document