scholarly journals C-Terminal Domain Swapping of SSB Changes the Size of the ssDNA Binding Site

2014 ◽  
Vol 2014 ◽  
pp. 1-16 ◽  
Author(s):  
Yen-Hua Huang ◽  
Cheng-Yang Huang
Keyword(s):  
Binding Site ◽  
Domain Swapping ◽  
Mobility Shift ◽  
Interaction Domain ◽  
Ssdna Binding ◽  
Protein Protein Interaction ◽  
Terminal Domain ◽  
Serovar Typhimurium ◽  
Mobility Shift Assay ◽  
Oligomerization Domain

Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism, including DNA replication, repair, and recombination, and is therefore essential for cell survival. Bacterial SSB consists of an N-terminal ssDNA-binding/oligomerization domain and a flexible C-terminal protein-protein interaction domain. We characterized the ssDNA-binding properties ofKlebsiella pneumoniaeSSB (KpSSB),Salmonella entericaSerovar Typhimurium LT2 SSB (StSSB),Pseudomonas aeruginosaPAO1 SSB (PaSSB), and two chimeric KpSSB proteins, namely, KpSSBnStSSBc and KpSSBnPaSSBc. The C-terminal domain of StSSB or PaSSB was exchanged with that of KpSSB through protein chimeragenesis. By using the electrophoretic mobility shift assay, we characterized the stoichiometry of KpSSB, StSSB, PaSSB, KpSSBnStSSBc, and KpSSBnPaSSBc, complexed with a series of ssDNA homopolymers. The binding site sizes were determined to be26±2,21±2,29±2,21±2, and29±2nucleotides (nt), respectively. Comparison of the binding site sizes of KpSSB, KpSSBnStSSBc, and KpSSBnPaSSBc showed that the C-terminal domain swapping of SSB changes the size of the binding site. Our observations suggest that not only the conserved N-terminal domain but also the C-terminal domain of SSB is an important determinant for ssDNA binding.

scholarly journals Characterization of the Chimeric PriB-SSBc Protein

2021 ◽  
Vol 22 (19) ◽  
pp. 10854
Author(s):  
En-Shyh Lin ◽  
Yen-Hua Huang ◽  
Cheng-Yang Huang
Keyword(s):  
Replication Fork ◽  
Structural Similarity ◽  
Binding Properties ◽  
Interaction Domain ◽  
Ssdna Binding ◽  
Initiator Protein ◽  
Protein Protein Interaction ◽  
Binding Behavior ◽  
Oligomerization Domain

PriB is a primosomal protein required for the replication fork restart in bacteria. Although PriB shares structural similarity with SSB, they bind ssDNA differently. SSB consists of an N-terminal ssDNA-binding/oligomerization domain (SSBn) and a flexible C-terminal protein–protein interaction domain (SSBc). Apparently, the largest difference in structure between PriB and SSB is the lack of SSBc in PriB. In this study, we produced the chimeric PriB-SSBc protein in which Klebsiella pneumoniae PriB (KpPriB) was fused with SSBc of K. pneumoniae SSB (KpSSB) to characterize the possible SSBc effects on PriB function. The crystal structure of KpSSB was solved at a resolution of 2.3 Å (PDB entry 7F2N) and revealed a novel 114-GGRQ-117 motif in SSBc that pre-occupies and interacts with the ssDNA-binding sites (Asn14, Lys74, and Gln77) in SSBn. As compared with the ssDNA-binding properties of KpPriB, KpSSB, and PriB-SSBc, we observed that SSBc could significantly enhance the ssDNA-binding affinity of PriB, change the binding behavior, and further stimulate the PriA activity (an initiator protein in the pre-primosomal step of DNA replication), but not the oligomerization state, of PriB. Based on these experimental results, we discuss reasons why the properties of PriB can be retrofitted when fusing with SSBc.

Identification of a killer cell-specific regulatory element of the mouse perforin gene: an Ets-binding site-homologous motif that interacts with Ets-related proteins

1993 ◽  
Vol 13 (11) ◽  
pp. 6690-6701
Author(s):  
H Koizumi ◽  
M F Horta ◽  
B S Youn ◽  
K C Fu ◽  
B S Kwon ◽  
...  
Keyword(s):  
Gene Expression ◽  
Dna Binding ◽  
Binding Site ◽  
Protein Interactions ◽  
Regulatory Element ◽  
Killer Cell ◽  
Mobility Shift ◽  
Specific Expression ◽  
Native Molecular Mass ◽  
Mobility Shift Assay

The gene encoding the cytolytic protein perforin is selectively expressed by activated killer lymphocytes. To understand the mechanisms underlying the cell-type-specific expression of this gene, we have characterized the regulatory functions and the DNA-protein interactions of the 5'-flanking region of the mouse perforin gene (Pfp). A region extending from residues +62 through -141, which possesses the essential promoter activity, and regions further upstream, which are able to either enhance or suppress gene expression, were identified. The region between residues -411 and -566 was chosen for further characterization, since it contains an enhancer-like activity. We have identified a 32-mer sequence (residues -491 to -522) which appeared to be capable of enhancing gene expression in a killer cell-specific manner. Within this segment, a 9-mer motif (5'-ACAGGAAGT-3', residues -505 to -497; designated NF-P motif), which is highly homologous to the Ets proto-oncoprotein-binding site, was found to interact with two proteins, NF-P1 and NF-P2. NF-P2 appears to be induced by reagents known to up-regulate the perforin message level and is present exclusively in killer cells. Electrophoretic mobility shift assay and UV cross-linking experiments revealed that NF-P1 and NF-P2 may possess common DNA-binding subunits. However, the larger native molecular mass of NF-P1 suggests that NF-P1 contains an additional non-DNA-binding subunit(s). In view of the homology between the NF-P motif and other Ets proto-oncoprotein-binding sites, it is postulated that NF-P1 and NF-P2 belong to the Ets protein family. Results obtained from the binding competition assay, nevertheless, suggest that NF-P1 and NF-P2 are related to but distinct from Ets proteins, e.g., Ets-1, Ets-2, and NF-AT/Elf-1, known to be expressed in T cells.

scholarly journals Functions of PIT1 in GATA2-dependent transactivation of the thyrotropin β promoter

2008 ◽  
Vol 42 (3) ◽  
pp. 225-237 ◽  
Author(s):  
Yumiko Kashiwabara ◽  
Shigekazu Sasaki ◽  
Akio Matsushita ◽  
Koji Nagayama ◽  
Kenji Ohba ◽  
...  
Keyword(s):  
Transcription Factors ◽  
Binding Site ◽  
Electrophoretic Mobility Shift Assay ◽  
Electrophoretic Mobility ◽  
Nuclear Factor ◽  
Mobility Shift ◽  
Minimal Sequence ◽  
Mobility Shift Assay ◽  
Β Chain

Thyrotropin (TSH) is a heterodimer consisting of α and β chains, and the β chain (TSHβ) is specific to TSH. The coexistence of two transcription factors, PIT1 and GATA2, is known to be essential for TSHβ expression. Using kidney-derived CV1 cells, we investigated the role of PIT1 in the expression of Tshb gene. GATA2 Zn finger domain, which is known to recognize GATA-responsive elements (GATA-REs), is essential for cooperation by PIT1. Transactivation of TSHβ promoter requires PIT1-binding site upstream to GATA-REs (PIT1-US), and the spacing between PIT1-US and GATA-REs strictly determines the cooperation between PIT1 and GATA2. Moreover, truncation of the sequence downstream to GATA-REs enabled GATA2 to transactivate the TSHβ promoter without PIT1. The deleted region (nt −82/−52) designated as a suppressor region (SR) was considered to inhibit transactivation by GATA2. The cooperation of PIT1 with GATA2 was not conventional synergism but rather counteracted SR-induced suppression (derepression). The minimal sequence for SR was mapped to the 9 bp sequence downstream to GATA-REs. Electrophoretic mobility shift assay suggested that some nuclear factor exists in CV1 cells, which binds with SR and this interaction was blocked by recombinant PIT1. Our study indicates that major activator for the TSHβ promoter is GATA2 and that PIT1 protects the function of GATA2 from the inhibition by SR-binding protein.

scholarly journals Molecular regulation of the human IL-3 gene: inducible T cell-restricted expression requires intact AP-1 and Elf-1 nuclear protein binding sites.

1993 ◽  
Vol 178 (5) ◽  
pp. 1681-1692 ◽  
Author(s):  
L R Gottschalk ◽  
D M Giannola ◽  
S G Emerson
Keyword(s):  
T Cells ◽  
Transcription Factors ◽  
T Cell ◽  
Protein Binding ◽  
Binding Site ◽  
Binding Sites ◽  
Nuclear Protein ◽  
Mobility Shift ◽  
Nuclear Extracts ◽  
Mobility Shift Assay

Interleukin 3 (IL-3) is a hematopoietic stem-cell growth and differentiation factor that is expressed solely in activated T and NK cells. Studies to date have identified elements 5' to the IL-3 coding sequences that regulate its transcription, but the sequences that confer T cell-specific expression remain to be clearly defined. We have now identified DNA sequences that are required for T cell-restricted IL-3 gene transcription. A series of transient transfections performed with human IL-3-chloramphenicol acetyltransferase (CAT) reporter plasmids in T and non-T cells revealed that a plasmid containing 319 bp of 5' flanking sequences was active exclusively in T cells. Deletion analysis revealed that T cell specificity was conferred by a 49-bp fragment (bp -319 to -270) that included a potential binding site for AP-1 transcription factors 6 bp upstream of a binding site for Elf-1, a member of the Ets family of transcription factors. DNaseI footprint and electrophoretic mobility shift assay analyses performed with MLA-144 T cell nuclear extracts demonstrated that this 49-bp region contains a nuclear protein binding region that includes consensus AP-1 and Elf-1 binding sites. In addition, extracts prepared from purified human T cells contained proteins that bound to synthetic oligonucleotides corresponding to the AP-1 and Elf-1 binding sites. In vitro-transcribed and -translated Elf-1 protein bound specifically to the Elf-1 site, and Elf-1 antisera competed and super shifted nuclear protein complexes present in MLA-144 nuclear extracts. Moreover, addition of anti-Jun family antiserum in electrophoretic mobility shift assay reactions completely blocked formation of the AP-1-related complexes. Transient transfection studies in MLA-144 T cells revealed that constructs containing mutations in the AP-1 site almost completely abolished CAT activity while mutation of the Elf-1 site or the NF-IL-3 site, a previously described nuclear protein binding site (bp. -155 to -148) in the IL-3 promoter, reduced CAT activity to < 25% of the activity given by wild-type constructs. We conclude that expression of the human IL-3 gene requires the AP-1 and Elf-1 binding sites; however, unlike other previously characterized cytokine genes such as IL-2, the AP-1 and Elf-1 factors can bind independently in the IL-3 gene.(ABSTRACT TRUNCATED AT 400 WORDS)

scholarly journals Role of the IE62 Consensus Binding Site in Transactivation by the Varicella-Zoster Virus IE62 Protein

2010 ◽  
Vol 84 (8) ◽  
pp. 3767-3779 ◽  
Author(s):  
Kris White ◽  
Hua Peng ◽  
John Hay ◽  
William T. Ruyechan
Keyword(s):  
Dna Binding ◽  
Varicella Zoster Virus ◽  
Binding Site ◽  
Consensus Sequence ◽  
Binding Domain ◽  
Dna Binding Domain ◽  
Consensus Binding Site ◽  
Mobility Shift ◽  
Varicella Zoster ◽  
Mobility Shift Assay

ABSTRACT The varicella-zoster virus (VZV) IE62 protein is the major transcriptional activator. IE62 is capable of associating with DNA both nonspecifically and in a sequence-specific manner via a consensus binding site (5′-ATCGT-3′). However, the function of the consensus site is poorly understood, since IE62 efficiently transactivates promoter elements lacking this sequence. In the work presented here, sequence analysis of the VZV genome revealed the presence of 245 IE62 consensus sites throughout the genome. Some 54 sites were found to be present within putative VZV promoters. Electrophoretic mobility shift assay (EMSA) experiments using an IE62 fragment containing the IE62 DNA-binding domain and duplex oligonucleotides that did or did not contain the IE62 consensus binding sequence yielded KD (equilibrium dissociation constant) values in the nanomolar range. Further, the IE62 DNA binding domain was shown to have a 5-fold-increased affinity for its consensus site compared to nonconsensus sequences. The effect of consensus site presence and position on IE62-mediated activation of native VZV and model promoters was examined using site-specific mutagenesis and transfection and superinfection reporter assays. In all promoters examined, the consensus sequence functioned as a distance-dependent repressive element. Protein recruitment assays utilizing the VZV gI promoter indicated that the presence of the consensus site increased the recruitment of IE62 but not Sp1. These data suggest a model where the IE62 consensus site functions to down-modulate IE62 activation, and interaction of IE62 with this sequence may result in loss or decrease of the ability of IE62 to recruit cellular factors needed for full promoter activation.

scholarly journals Regulation of lactase–phlorizin hydrolase gene expression by the caudal-related homoeodomain protein Cdx-2

1997 ◽  
Vol 322 (3) ◽  
pp. 833-838 ◽  
Author(s):  
Jesper T. TROELSEN ◽  
Cathy MITCHELMORE ◽  
Nikolaj SPODSBERG ◽  
Anette M. JENSEN ◽  
Ove NORÉN ◽  
...  
Keyword(s):  
Gene Expression ◽  
Small Intestine ◽  
Binding Site ◽  
Electrophoretic Mobility Shift Assay ◽  
Gene Transcription ◽  
Transcriptional Activity ◽  
Nuclear Factor ◽  
Mobility Shift ◽  
Cis Element ◽  
Mobility Shift Assay

Lactase–phlorizin hydrolase is exclusively expressed in the small intestine and is often used as a marker for the differentiation of enterocytes. The cis-element CE-LPH1 found in the lactase–phlorizin hydrolase promoter has previously been shown to bind an intestinal-specific nuclear factor. By electrophoretic mobility-shift assay it was shown that the factor Cdx-2 (a homoeodomain-protein related to caudal) binds to a TTTAC sequence in the CE-LPH1. Furthermore it was demonstrated that Cdx-2 is able to activate reporter gene transcription by binding to CE-LPH1. A mutation in CE-LPH1, which does not affect Cdx-2 binding, results in a higher transcriptional activity, indicating that the CE-LPH1 site contains other binding site(s) in addition to the Cdx-2-binding site.

scholarly journals PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

2015 ◽  
Vol 81 (23) ◽  
pp. 8084-8092 ◽  
Author(s):  
Minggen Cheng ◽  
Kai Chen ◽  
Suhui Guo ◽  
Xing Huang ◽  
Jian He ◽  
...  
Keyword(s):  
Binding Site ◽  
Gene Cluster ◽  
Transcriptional Start Site ◽  
Transcriptional Activator ◽  
Transcriptional Regulators ◽  
Mobility Shift ◽  
Content Type ◽  
Dnase I Footprinting ◽  
Dioxygenase Gene ◽  
Mobility Shift Assay

ABSTRACTThe 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2Bcluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed inSphingobium wenxiniaestrain JZ-1Tby its substrate 3-PBA. In this study, we identified a transcriptional activator of thepbaA1A2Bcluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 inSphingomonassp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of thepbaA1A2Bcluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component genepbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in thepbaA1A2Bpromoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

scholarly journals Identification of a killer cell-specific regulatory element of the mouse perforin gene: an Ets-binding site-homologous motif that interacts with Ets-related proteins.

1993 ◽  
Vol 13 (11) ◽  
pp. 6690-6701 ◽  
Author(s):  
H Koizumi ◽  
M F Horta ◽  
B S Youn ◽  
K C Fu ◽  
B S Kwon ◽  
...  
Keyword(s):  
Gene Expression ◽  
Dna Binding ◽  
Binding Site ◽  
Protein Interactions ◽  
Regulatory Element ◽  
Killer Cell ◽  
Mobility Shift ◽  
Specific Expression ◽  
Native Molecular Mass ◽  
Mobility Shift Assay

The gene encoding the cytolytic protein perforin is selectively expressed by activated killer lymphocytes. To understand the mechanisms underlying the cell-type-specific expression of this gene, we have characterized the regulatory functions and the DNA-protein interactions of the 5'-flanking region of the mouse perforin gene (Pfp). A region extending from residues +62 through -141, which possesses the essential promoter activity, and regions further upstream, which are able to either enhance or suppress gene expression, were identified. The region between residues -411 and -566 was chosen for further characterization, since it contains an enhancer-like activity. We have identified a 32-mer sequence (residues -491 to -522) which appeared to be capable of enhancing gene expression in a killer cell-specific manner. Within this segment, a 9-mer motif (5'-ACAGGAAGT-3', residues -505 to -497; designated NF-P motif), which is highly homologous to the Ets proto-oncoprotein-binding site, was found to interact with two proteins, NF-P1 and NF-P2. NF-P2 appears to be induced by reagents known to up-regulate the perforin message level and is present exclusively in killer cells. Electrophoretic mobility shift assay and UV cross-linking experiments revealed that NF-P1 and NF-P2 may possess common DNA-binding subunits. However, the larger native molecular mass of NF-P1 suggests that NF-P1 contains an additional non-DNA-binding subunit(s). In view of the homology between the NF-P motif and other Ets proto-oncoprotein-binding sites, it is postulated that NF-P1 and NF-P2 belong to the Ets protein family. Results obtained from the binding competition assay, nevertheless, suggest that NF-P1 and NF-P2 are related to but distinct from Ets proteins, e.g., Ets-1, Ets-2, and NF-AT/Elf-1, known to be expressed in T cells.

Protection of telomeres 1 (POT1) of Pinus tabuliformis bound the telomere ssDNA

2019 ◽  
Vol 40 (1) ◽  
pp. 119-127 ◽  
Author(s):  
Mei Luo ◽  
Xiaotong Teng ◽  
Bing Wang ◽  
Jiaxue Zhang ◽  
Yadi Liu ◽  
...  
Keyword(s):  
Essential Role ◽  
Functional Divergence ◽  
Genomic Stability ◽  
Mobility Shift ◽  
Ssdna Binding ◽  
Pinus Tabuliformis ◽  
Mobility Shift Assay ◽  
Protection Of Telomeres 1 ◽  
Insight Into ◽  
Telomeric Protein

Abstract Protection of telomeres 1 (POT1) is a telomeric protein that binds to the telomere single-stranded (ss) region. It plays an essential role in maintaining genomic stability in both plants and animals. In this study, we investigated the properties of POT1 in Pinus tabuliformis Carr. (PtPOT1) through electrophoretic mobility shift assay. PtPOT1 harbored affinity for telomeric ssDNA and could bind plant- and mammalian-type ssDNA sequences. Notably, there were two oligonucleotide/oligosaccharide binding (OB) folds, and OB1 or OB2 alone, or both together, could bind ssDNA, which is significantly different from human POT1. Based on our data, we hypothesized that the two OB folds of PtPOT1 bound the same ssDNA. This model not only provides new insight into the ssDNA binding of PtPOT1 but also sheds light on the functional divergence of POT1 proteins in gymnosperms and humans.

scholarly journals The C-terminal domain of Brd2 is important for chromatin interaction and regulation of transcription and alternative splicing

2013 ◽  
Vol 24 (22) ◽  
pp. 3557-3568 ◽  
Author(s):  
Jarmila Hnilicová ◽  
Samira Hozeifi ◽  
Eva Stejskalová ◽  
Eva Dušková ◽  
Ina Poser ◽  
...  
Keyword(s):  
Alternative Splicing ◽  
Target Genes ◽  
Live Cell ◽  
Chromatin Interaction ◽  
Regulation Of Transcription ◽  
Interaction Domain ◽  
Protein Protein Interaction ◽  
Terminal Domain ◽  
A Genome ◽  
Bet Protein

Brd2 is a member of the bromodomain extra terminal (BET) protein family, which consists of four chromatin-interacting proteins that regulate gene expression. Each BET protein contains two N-terminal bromodomains, which recognize acetylated histones, and the C-terminal protein–protein interaction domain. Using a genome-wide screen, we identify 1450 genes whose transcription is regulated by Brd2. In addition, almost 290 genes change their alternative splicing pattern upon Brd2 depletion. Brd2 is specifically localized at promoters of target genes, and our data show that Brd2 interaction with chromatin cannot be explained solely by histone acetylation. Using coimmunoprecipitation and live-cell imaging, we show that the C-terminal part is crucial for Brd2 association with chromatin. Live-cell microscopy also allows us to map the average binding time of Brd2 to chromatin and quantify the contributions of individual Brd2 domains to the interaction with chromatin. Finally, we show that bromodomains and the C-terminal domain are equally important for transcription and splicing regulation, which correlates with the role of these domains in Brd2 binding to chromatin.

Sign in / Sign up

Export Citation Format

Share Document