Disruption of c-MYC Binding and Chromosomal Looping Involving Genetic Variants Associated With Ankylosing Spondylitis Upstream of the RUNX3 Promoter

Background: Ankylosing Spondylitis (AS) is a common form of inflammatory spinal arthritis with a complex aetiology and high heritability, involving more than 100 genetic associations. These include several AS-associated single nucleotide polymorphisms (SNPs) upstream of RUNX3, which encodes the multifunctional RUNT-related transcription factor (TF) 3. The lead associated SNP rs6600247 (p = 2.6 × 10−15) lies ∼13kb upstream of the RUNX3 promoter adjacent to a c-MYC TF binding-site. The effect of rs6600247 genotype on DNA binding and chromosome looping were investigated by electrophoretic mobility gel shift assays (EMSA), Western blotting-EMSA (WEMSA) and Chromosome Conformation Capture (3C).Results: Interrogation of ENCODE published data showed open chromatin in the region overlapping rs6600247 in primary human CD14+ monocytes, in contrast to the Jurkat T cell line or primary human T-cells. The rs6600247 AS-risk allele is predicted to specifically disrupt a c-MYC binding-site. Using a 50bp DNA probe spanning rs6600247 we consistently observed reduced binding to the AS-risk “C” allele of both purified c-MYC protein and nuclear extracts (NE) from monocyte-like U937 cells. WEMSA on U937 NE and purified c-MYC protein confirmed these differences (n = 3; p < 0.05). 3C experiments demonstrated negligible interaction between the region encompassing rs6600247 and the RUNX3 promoter. A stronger interaction frequency was demonstrated between the RUNX3 promoter and the previously characterised AS-associated SNP rs4648889.Conclusion: The lead SNP rs6600247, located in an enhancer-like region upstream of the RUNX3 promoter, modulates c-MYC binding. However, the region encompassing rs6600247 has rather limited physical interaction with the promoter of RUNX3. In contrast a clear chromatin looping event between the region encompassing rs4648889 and the RUNX3 promoter was observed. These data provide further evidence for complexity in the regulatory elements upstream of the RUNX3 promoter and the involvement of RUNX3 transcriptional regulation in AS.

Structural insights into inhibitor regulation of the DNA repair protein DNA-PKcs

The DNA-dependent protein kinase catalytic subunit (DNA-PKcs) has a central role in non-homologous end joining, one of the two main pathways that detect and repair DNA double-strand breaks (DSBs) in humans1,2. DNA-PKcs is of great importance in repairing pathological DSBs, making DNA-PKcs inhibitors attractive therapeutic agents for cancer in combination with DSB-inducing radiotherapy and chemotherapy3. Many of the selective inhibitors of DNA-PKcs that have been developed exhibit potential as treatment for various cancers4. Here we report cryo-electron microscopy (cryo-EM) structures of human DNA-PKcs natively purified from HeLa cell nuclear extracts, in complex with adenosine-5′-(γ-thio)-triphosphate (ATPγS) and four inhibitors (wortmannin, NU7441, AZD7648 and M3814), including drug candidates undergoing clinical trials. The structures reveal molecular details of ATP binding at the active site before catalysis and provide insights into the modes of action and specificities of the competitive inhibitors. Of note, binding of the ligands causes movement of the PIKK regulatory domain (PRD), revealing a connection between the p-loop and PRD conformations. Electrophoretic mobility shift assay and cryo-EM studies on the DNA-dependent protein kinase holoenzyme further show that ligand binding does not have a negative allosteric or inhibitory effect on assembly of the holoenzyme complex and that inhibitors function through direct competition with ATP. Overall, the structures described in this study should greatly assist future efforts in rational drug design targeting DNA-PKcs, demonstrating the potential of cryo-EM in structure-guided drug development for large and challenging targets.

Proteomic analysis identifies ZMYM2 as endogenous binding partner of TBX18 protein in 293 and A549 cells

The TBX18 transcription factor regulates patterning and differentiation programs in the primordia of many organs yet the molecular complexes in which TBX18 resides to exert its crucial transcriptional function in these embryonic contexts have remained elusive. Here, we used 293 and A549 cells as an accessible cell source to search for endogenous protein interaction partners of TBX18 by an unbiased proteomic approach. We tagged endogenous TBX18 by CRISPR/Cas9 targeted genome editing with a triple FLAG peptide, and identified by anti-FLAG affinity purification and subsequent LC-MS analysis the ZMYM2 protein to be statistically enriched together with TBX18 in both 293 and A549 nuclear extracts. Using a variety of assays, we confirmed binding of TBX18 to ZMYM2, a component of the CoREST transcriptional corepressor complex. Tbx18 is coexpressed with Zmym2 in the mesenchymal compartment of the developing ureter of the mouse, and mutations in TBX18and in ZMYM2 were recently linked to congenital anomalies in the kidney and urinary tract (CAKUT) in line with a possible in vivo relevance of TBX18-ZMYM2 protein interaction in ureter development.

Serine ADP-ribosylation marks nucleosomes for ALC1-dependent chromatin remodeling

Serine ADP-ribosylation (ADPr) is a DNA damage-induced post-translational modification catalyzed by the PARP1/2:HPF1 complex. As the list of PARP1/2:HPF1 substrates continues to expand, there is a need for technologies to prepare mono- and poly-ADP-ribosylated proteins for biochemical interrogation. Here we investigate the unique peptide ADPr activities catalyzed by PARP1 in the absence and presence of HPF1. We then exploit these activities to develop a method that facilitates installation of ADP-ribose polymers onto peptides with precise control over chain length and modification site. Importantly, the enzymatically mono- and poly-ADP-ribosylated peptides are fully compatible with protein ligation technologies. This chemoenzymatic protein synthesis strategy was employed to assemble a series of full-length, ADP-ribosylated histones and show that ADPr at H2BS6 or H3S10 converts nucleosomes into robust substrates for the chromatin remodeler ALC1. We found ALC1 preferentially remodels 'activated' substrates within heterogeneous mononucleosome populations and asymmetrically ADP-ribosylated dinucleosome substrates, and that nucleosome serine ADPr is sufficient to stimulate ALC1 activity in nuclear extracts. Our study identifies a biochemical function for nucleosome serine ADPr and describes a new, highly modular approach to explore the impact that site-specific serine mono- and poly-ADPr have on protein function.

Exposure of Microglia to Interleukin-4 Represses NF-κB-Dependent Transcription of Toll-Like Receptor-Induced Cytokines

Interleukin (IL)-4 is a cytokine that affects both adaptive and innate immune responses. In the central nervous system, microglia express IL-4 receptors and it has been described that IL-4-exposed microglia acquire anti-inflammatory properties. We here demonstrate that IL-4 exposure induces changes in the cell surface protein expression profile of primary rhesus macaque microglia and enhances their potential to induce proliferation of T cells with a regulatory signature. Moreover, we show that Toll like receptor (TLR)-induced cytokine production is broadly impaired in IL-4-exposed microglia at the transcriptional level. IL-4 type 2 receptor-mediated signaling is shown to be crucial for the inhibition of microglial innate immune responses. TLR-induced nuclear translocalization of NF-κB appeared intact, and we found no evidence for epigenetic modulation of target genes. By contrast, nuclear extracts from IL-4-exposed microglia contained significantly less NF-κB capable of binding to its DNA consensus site. Further identification of the molecular mechanisms that underlie the inhibition of TLR-induced responses in IL-4-exposed microglia may aid the design of strategies that aim to modulate innate immune responses in the brain, for example in gliomas.

Effects of 5′,8′-Cyclo-2′-Deoxypurines on the Base ExcisionRepair of Clustered DNA Lesions in Nuclear Extracts of the XPC Cell Line

Clustered DNA lesions (CDL) containing 5′,8-cyclo-2′-deoxypurines (cdPus) are an example of extensive abnormalities occurring in the DNA helix and may impede cellular repair processes. The changes in the efficiency of nuclear base excision repair (BER) were investigated using (a) two cell lines, one of the normal skin fibroblasts as a reference (BJ) and the second from Xeroderma pigmentosum patients’ skin (XPC), and (b) synthetic oligonucleotides with single- and double-stranded CDL (containing 5′,8-cyclo-2′-deoxyadenosine (cdA) and the abasic (AP) site at various distances between lesions). The nuclear BER has been observed and the effect of both cdA isomers (5′R and 5′S) presence in the DNA was tested. CdPus affected the repair of the second lesion within the CDL. The BER system more efficiently processed damage in the vicinity of the ScdA isomer and changes located in the 3′-end direction for dsCDL and in the 5′-end direction for ssCDL. The presented study is the very first investigation of the repair processes of the CDL containing cdPu considering cells derived from a Xeroderma pigmentosum patient.

Disruption of c-MYC binding and chromosomal looping involving genetic variants associated with ankylosing spondylitis upstream of RUNX3 promoter

ABSTRACTBackgroundAnkylosing Spondylitis (AS) is a common form of inflammatory spinal arthritis with a complex aetiology and high heritability, involving more than 100 genetic associations. These include several AS-associated single nucleotide polymorphisms (SNPs) upstream of RUNX3, which encodes the multifunctional RUNT-related transcription factor (TF) 3. The lead associated SNP rs6600247 (p= 2.6 x 10-15) lies ~13kb upstream of the RUNX3 promoter adjacent to a c-MYC TF binding-site. The effect of rs6600247 genotype on DNA binding and chromosome looping were investigated by electrophoretic mobility gel shift assays (EMSA), Western blotting-EMSA (WEMSA) and Chromosome Conformation Capture (3C).ResultsInterrogation of ENCODE published data showed open chromatin in the region overlapping rs6600247 in primary human CD14+ monocytes in contrast to Jurkat T cell line or primary T-cells. The rs6600247 AS-risk allele is predicted to specifically disrupt a c-MYC binding-site. Using a 50bp DNA probe spanning rs6600247 there was consistently less binding to the AS-risk “C” allele of both purified c-MYC protein and nuclear extracts (NE) from monocyte-like U937 cells. WEMSA on U937 NE and purified c-MYC protein confirmed these differences (n=2; p<0.05). 3C experiments demonstrated negligible interaction between the region encompassing rs6600247 and the RUNX3 promoter. A stronger interaction frequency was demonstrated between the RUNX3 promoter and the previously characterised AS-associated SNP rs4648889.ConclusionsThe lead SNP rs6600247, located in an enhancer-like region upstream of the RUNX3 promoter, modulates c-MYC binding. However, the region encompassing rs6600247 has rather limited physical interaction with the promoter of RUNX3. In contrast a clear chromatin looping event between the region encompassing rs4648889 and the RUNX3 promoter was observed. These data provide further evidence for complexity in the regulatory elements upstream of the RUNX3 promoter and the involvement of RUNX3 transcriptional regulation in AS.

Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana

Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.

Gds1 interacts with NuA4 to promote H4 acetylation at ribosomal protein genes

In our previously published studies, RNA polymerase II transcription initiation complexes were assembled from yeast nuclear extracts onto immobilized transcription templates and analyzed by quantitative mass spectrometry. In addition to the expected basal factors and coactivators, we discovered that the uncharacterized protein Gds1 showed activator- stimulated association with promoter DNA. Gds1 co-precipitated with the histone H4 acetyltransferase NuA4, and its levels often tracked with NuA4 in immobilized template experiments. GDS1 deletion led to reduction in H4 acetylation in vivo and other phenotypes consistent with partial loss of NuA4 activity. Genome-wide chromatin immunoprecipitation revealed that the reduction in H4 acetylation was strongest at ribosomal protein gene promoters and other genes with high NuA4 occupancy. Therefore, while Gds1 is not a stoichiometric subunit of NuA4, we propose that it interacts with and modulates NuA4 in specific promoter contexts. Gds1 has no obvious metazoan homolog, but structural predictions suggest it may be distantly related to the DEK protein.

Serine ADP-ribosylation marks nucleosomes for ALC1-dependent chromatin remodeling

Serine ADP-ribosylation (ADPr) is a DNA damage-induced post-translational modification catalyzed by the PARP1/2:HPF1 complex. As the list of PARP1/2:HPF1 substrates continues to expand, there is a need for technologies to prepare mono- and poly-ADP-ribosylated proteins for biochemical interrogation. Here we investigate the unique peptide ADPr activities catalyzed by PARP1 in the absence and presence of HPF1. We then exploit these activities to develop a method that facilitates installation of ADP-ribose polymers onto full-length proteins with precise control over chain length and modification site. A series of semi-synthetic ADP-ribosylated histone proteins are prepared which demonstrate that ADPr at H2BS6 or H3S10 converts nucleosomes into robust substrates for the chromatin remodeler ALC1. Importantly, we found ALC1 selectively remodels "activated" substrates within heterogeneous nucleosome populations and that nucleosome serine ADPr is sufficient to stimulate ALC1 activity in nuclear extracts. Our study identifies a biochemical function for nucleosome serine ADPr and describes a method that is broadly applicable to explore the impact that site-specific serine mono- and poly-ADPr have on protein function.