Abstract
Dominant negative inhibition is most commonly seen when a mutant subunit of a multi-subunit protein is co-expressed with the wild-type protein so that assembly of a functional oligomer is impaired. Studies have shown that TRAF6 plays a key role in the regulation of NF-κB through the IL-1R/TLR-TRAF6-TAK1-TAB1-TAB2-IkB-NF-κB pathway. We previously demonstrated that TRAF6 is an important factor for the activation of nuclear factor (NF)-κB signaling in multiple myeloma cell proliferation through the c-Jun N-terminal kinase (JNK) pathway and the pathway can be silenced by TRAF6 siRNA. (H. Chen et al. Oncogene, 2006). We targeted the TRAF6 function domain by designing primers targeting positive 1115 to 1818 (Forward: ggctagcatgtcagaggtccggaatttggag (Nhe1) Reverse: cgaagtactgatgcaggggtatagctcgagc (Xho1)) for hTRAF6dn according to GeneBank (NCBI) nucleotide sequence of human TRAF6 (#U78798). We cloned TRAF6 negative domain cDNA into PCRII-TOPO vector and subsequently re-cloned into the pLenti6.2 expression vector (pLenti6.2-hTRAF6dn). All constructs were confirmed by sequencing. Viral titers for all transfections were determined to be 107 plaque-forming units/ml. Expression levels as determined by flow cytometric analysis were >95% for all lentivirally encoded GFP gene products. The pLenti6.2-hTRAF6dn vector continually expressed the peptide for TRAF6dn during tumor cell proliferation. We found that TRAF6dn began to inhibit MM cell proliferation in the U266 myeloma cell line after 72 hours of culture and most prominently on day 6. However, the inhibition of RPMI8226 cell proliferation by TRAFdn started after 24 hours of culture whereas effects on inducing MM cell apoptosis were most prominent at 72 hours. The decrease in cell proliferation and increase in cell apoptosis occurred in a dose-dependent fashion. We also examined the effects of TRAF6dn on the NF-κB and JNK pathway since this signaling pathway is associated with cell cycle effects in myeloma. Phosphorylated NF-κB protein levels were reduced using the TRAF6dn expression vector. We also determined the phosphorylation of JUN kinase kinase (JNKK), which activates the MAP kinase homologues SAPK and JNK in response to IL-1 receptor stimulation. The results showed that the phosphorylation of JNKK is clearly reduced following blocking the TRAF6 function domain with the TRAF6dn. Furthermore, we examined c-Jun, a component of the transcription factor complex AP-1, which binds and activates transcription at TRE/AP-1 elements. The transcriptional activity of c-Jun is regulated by SAPK/JNK binding to c-Jun and phosphorylation of c-Jun at Ser63/73. We found that total endogenous c-Jun is reduced after blocking the TRAF6 function domain with TRAF6dn in the RPMI8226 and U266 MM cell lines. Comparing TRAF6dn with TRAF6 siRNA, only the TRAF6dn inhibited the TRAF6 function domain. These studies suggest that the TRAF6dn peptide may impede myeloma cell signaling pathways resulting in inhibition of tumor cell growth and may represent a new approach to treating patients with MM.
An anti-leishmanial thiadiazine agent induces multiple myeloma cell apoptosis by suppressing the nuclear factor kappaB signalling pathway
