scholarly journals Using Circ-ANAPC7 As a Novel Type of Biomarker in the Monitoring of Acute Myeloid Leukemia

Blood ◽  
2019 ◽  
Vol 134 (Supplement_1) ◽  
pp. 5179-5179
Author(s):  
Ying Shen ◽  
Yachun Jia ◽  
Ru Zhang ◽  
Hongli Chen ◽  
Yuandong Feng ◽  
...  
Keyword(s):  
Bone Marrow ◽  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Expression Level ◽  
Circular Rnas ◽  
Newly Diagnosed ◽  
Free Survival ◽  
Non Coding Rnas ◽  
Acute Myeloid

Introduction: Acute myeloid leukemia (AML) is a heterogeneous disease characterized by the clonal proliferation of immature myeloid progenitor cells in the bone marrow, compressing normal blood cell production and leading to bone marrow failure ultimately. Overwhelming evidence has established that non-coding RNAs (ncRNAs), such as long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) have great role in AML pathogenesis. Circular RNAs (circRNAs) that occupy gene expression at the transcriptional or post-transcriptional level have great potential to be biomarker for types of cancers. We have screened one altered circRNA named circ-ANAPC7 in AML before. In this study, we aimed to validate its expression by enlarging sample size and illuminating the diagnostic and monitoring value of circ-ANAPC7 in AML. Methods: Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was supposed to confirm the expression of circ-ANAPC7 of AML patients. The sequences of circ-ANAPC7 primers were as follows: 5′- GGGAGCAGCACTTAGGAACAT -3′ (sense) and 5′-AAAGCTGGTACTTCTGAGGTGG-3′ (antisense). Receiver operating characteristic (ROC) curve was carried out to evaluate the diagnostic value. Overall survival rate and event-free survival rate were estimated by the Kplan-Meier analysis and compared using the log-rank test. All tests were two-sided, and P < 0.05 was defined as a significant difference. Results: The expression level of circ-ANAPC7 in newly diagnosed AML was significantly higher than CR patients and iron deficiency anemia (IDA) control group (P < 0.001) (Figure 1A). Furthermore, we chose 24 AML patients who undergo the condition of newly diagnosed AML, CR and relapse to dynamical monitor the expression of circ-ANAPC7. We discovered that circ-ANAPC7 expression level changed accompanied with the disease condition transformation. It was high expressed in newly diagnosed and relapsed AML patients. When patients got CR, the expression level of circ-ANAPC7 decreased (P < 0.05). In the continuous CR patients, it remained in a minimal level (Figure 1C). ROC curve analysis revealed that circ-ANAPC7 has significant value of AML diagnosis (AUC = 0.915, P < 0.001) (Figure 1B). Moreover, we conducted survival analysis to explore long-term effect of circ-ANAPC7 expression in AML patients. The result revealed that circ-ANAPC7 expression was not related to overall survival (OS) and disease-free survival (DFS) of AML patients (P > 0.05) (Figure 1D). Conclusions: We validated that circ-ANAPC7 was upregulated in AML patients. The clinical analysis revealed that circ-ANAPC7 may be a predictive index for diagnosing and supervising early recurrence of AML. What's more, additional molecular mechanisms and biological functions of circ-ANAPC7 merit deeper investigation. Figure 1 Disclosures No relevant conflicts of interest to declare.

Intensively timed induction therapy followed by autologous or allogeneic bone marrow transplantation for children with acute myeloid leukemia or myelodysplastic syndrome: a Childrens Cancer Group pilot study.

1993 ◽  
Vol 11 (8) ◽  
pp. 1448-1457 ◽  
Author(s):  
W G Woods ◽  
N Kobrinsky ◽  
J Buckley ◽  
S Neudorf ◽  
J Sanders ◽  
...  
Keyword(s):  
Bone Marrow ◽  
Acute Myeloid Leukemia ◽  
Induction Therapy ◽  
Myeloid Leukemia ◽  
Allogeneic Bone Marrow Transplantation ◽  
Allogeneic Bone ◽  
Newly Diagnosed ◽  
Free Survival ◽  
Cancer Group ◽  
Acute Myeloid

PURPOSE Childrens Cancer Group (CCG) protocol 2861 was designed to test the feasibility of aggressively timed induction therapy followed by autologous or allogeneic bone marrow transplantation (BMT) as the sole postremission therapy for newly diagnosed children with acute myeloid leukemia (AML) or myelodysplastic syndrome (MDS). PATIENTS AND METHODS Between April 1988 and October 1989, 142 patients were eligible for study. All patients entered received a timing-intensive five-drug induction of dexamethasone, cytarabine (Ara-C), thioguanine, etoposide, and daunorubicin (DCTER) over 4 days with a second cycle administered after 6 days of rest, irrespective of hematologic status at that time. Most patients subsequently received a second two-cycle induction course. Those who achieved remission were eligible for bone marrow ablative therapy with busulfan and cyclophosphamide, followed by 4-hydroperoxy-cyclophosphamide (4-HC)-purged autologous or allogeneic BMT rescue. RESULTS One hundred eight (76%) patients achieved remission: 19 (13%) died of complications of the leukemia and/or chemotherapy, and 15 (11%) failed to achieve remission. Seventy-four patients subsequently underwent BMT with either autologous (n = 58) or allogeneic (n = 16) rescue. For patients who received autologous rescue with 4-HC-purged grafts, the actuarial disease-free survival (DFS) rate at 3 years from the day of transplant is 51%, compared with 55% for patients who received allogeneic grafts (P = .92). At 3 years, the overall actuarial survival rate for all 142 patients entered on this study is 45%, with an event-free survival (EFS) rate of 37%. Adverse prognostic factors for outcome included an elevated WBC count or the presence of CNS leukemia at the time of AML diagnosis. CONCLUSION Results suggest that aggressively timed induction therapy followed by marrow ablation and BMT rescue with either autologous or allogeneic grafts for children with newly diagnosed AML or MDS is both feasible and effective.

The Impact of Bone Marrow Hematogones on Umbilical Cord Blood Transplant Outcomes in Acute Myeloid Leukemia Patients,

Blood ◽  
2011 ◽  
Vol 118 (21) ◽  
pp. 4148-4148
Author(s):  
Theodore Honebrink ◽  
Vanessa J. Dayton ◽  
Karen Larsen ◽  
Qing Cao ◽  
Claudio Brunstein ◽  
...  
Keyword(s):  
Bone Marrow ◽  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Donor Number ◽  
Free Survival ◽  
Cord Blood Transplant ◽  
Differential Counts ◽  
Related Mortality ◽  
Acute Myeloid

Abstract Abstract 4148 Hematogones are B-lymphocyte precursors which reside in the marrow and undergo an orderly maturation sequence to give rise to mature B cells. (McKenna, Blood 2001) Recently, the percentage of hematogones detected in the bone marrow (BM) after induction therapy for acute myeloid leukemia (AML) has been associated with improved leukemia-free survival and overall survival. (Chantepie, Blood 2011) Early after umbilical cord blood transplant (UCBT), patients show marked differences in BM hematogone percentages. Little is known about whether such differences are clinically relevant, which may explain why hematogones are not routinely reported in BM differential counts and are, instead, combined with other lymphocytes. We hypothesized that increased hematogones would be associated with superior transplant outcomes. Two independent reviewers assessed hematogone percentages in BM aspirates performed on day 21 and 100 post-UCBT (i.e. D21 & D100) from 88 patients with AML undergoing myeloablative UCBT at the University of Minnesota between 02/1999 and 07/2008. Patients with evidence of relapse at the time of the marrow analysis were excluded. Because of the morphological similarity between hematogones and leukemic lymphoblasts, only patients with AML were included in this analysis. The reviewers were blinded to clinical outcomes. Correlation coefficients for the morphologic assessment of hematogones at D21 and D100 were each >0.8, confirming good interobserver reproducibility (p<0.01). Prospective outcome data for patients in the lowest marrow hematogone quartile (0% at D21 after UCBT and ≤0.9% at D100 after UCBT) were compared with those of patients in the upper three quartiles using a multivariate analysis (MVA) model. This model incorporated donor number (single vs. double), recipient age (<21 vs. ≥ 21), recipient CMV status (negative vs. positive), total, post-thaw CD34 (<0.50 vs. ≥0.50), total, post-thaw CFU (<0.042 vs. ≥ 0.042), and total nucleated cell (TNC) (<0.38 vs. ≥0.38). Endpoints studied included time to neutrophil and platelet recovery, overall survival, disease free survival (DFS), transplant related mortality (TRM), risk of relapse, acute GVHD (aGVHD), and chronic GVHD (cGVHD). At D21 after UCBT, the percentage of marrow hematogones varied from 0 to 10.8% (N = 85). In MVA, a high percentage of hematogones at D21 was associated less aGVHD grade 3–4 (RR=0.3 [0.15–0.59], p=0.01). At D100 after UCBT the percentage of marrow hematogones varied from 0 to 29.8% (N = 69). In MVA, a high percentage of BM hematogones at D100 was associated with improved overall survival (p=0.02) and this was due to a lower treatment related mortality (p=<0.01). (See Table 1) Table 1: MVA examining the percentage hematogones detected in the BM at D100 after UCBT. Outcome Variable RR (95% CI) p value Overall Survival Hem @ Day 100 <0.9 1.00 >=0.9 0.20 (0.05–0.76) 0.02 Donor number 1 1.00 2 0.19 (0.04–0.84) 0.03 Transplant Age <20.5 1.00 >=20.5 4.89 (1.11–21.51) 0.04 Relapse Hem @ Day 100 <0.9 1.00 >=0.9 2.84 (0.32–24.91) 0.35 TRM Hem @ Day 100 <0.9 1.00 >=0.9 0.03 (0–0.34) <0.01 HLA (engrafting unit) 4/6 1.00 5/6 0.61 (0.05–7.13) 0.69 6/6 0 <0.01 CGVHD Hem @ Day 100 <0.9 1.00 >=0.9 0.44 (0.11–1.69) 0.23 Transplant Age <20.5 1.00 >=20.5 3.61 (1.18–11.06) 0.02 RR = relative risk. Hem = percentage hematogones. TRM = transplant-related mortality. HLA = human leukocyte antigen; values correspond to number of matched allelic loci for HLA-A, HLA-B and HLA-DR between recipient and engrafting donor. CGVHD = chronic graft vs. host disease. This study shows that BM hematogone percentage may be a useful prognostic indicator in AML patients following UCBT. We propose that hematogones be routinely reported in BM differential counts. Disclosures: No relevant conflicts of interest to declare.

scholarly journals High Expression of Myocyte Enhancer Factor 2C (MEF2C) Is Associated with Adverse Risk Features and Poor Outcome in Pediatric Acute Myeloid Leukemia: A Report from the Children's Oncology Group

Blood ◽  
2015 ◽  
Vol 126 (23) ◽  
pp. 2570-2570
Author(s):  
George S. Laszlo ◽  
Todd A. Alonzo ◽  
Chelsea J. Gudgeon ◽  
Kimberly H. Harrington ◽  
Alex Kentsis ◽  
...  
Keyword(s):  
Bone Marrow ◽  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Research Funding ◽  
Event Free Survival ◽  
Free Survival ◽  
Expression Levels ◽  
Acute Myeloid ◽  
Enhancer Factor

Abstract Background: Myocyte enhancer factor 2C (MEF2C) was initially identified as essential transcription factor for cardiac muscle development. However, subsequent studies have indicated that MEF2C plays a much broader biological role, including in the normal hematopoietic system. Recent studies have now identified MEF2C as cooperating oncogene in acute myeloid leukemia (AML) and suggested a contribution to the aggressive nature of at least some subtypes of AML. These findings raised the possibility that MEF2C could serve as marker of poor-risk disease and, therefore, have prognostic significance in AML. To test this hypothesis, we retrospectively quantified MEF2C expression in participants of the AAML0531 trial and correlated expression levels with disease characteristics and clinical outcome. Patients and Methods: AAML0531 (NCT00372593) was a multicenter phase 3 study that determined the addition of gemtuzumab ozogamicin to intensive chemotherapy among 1,022 eligible patients aged <30 yearswith newly diagnosed de novo non-APL AML, excluding those with bone marrow failure syndromes, juvenile myelomonocytic leukemia, or Down syndrome (if ≤3 years of age) between 2006 and 2010. Cryopreserved pretreatment ("diagnostic") specimens from patients enrolled on AAML0531 who consented to the biology studies and had bone marrow samples were available were included in this study. Total RNA from unsorted specimens was extracted, quantified, and subjected to quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) using TaqMan primers to determine expression of MEF2C and, for normalization, the housekeeping gene, β-glucuronidase (GUSB). Patient samples were run in duplicate, and the ΔΔCT method quantified as 2(-ΔΔCT) was used to determine the expression levels of MEF2C relative to GUSB. Results: In all 751 available patient specimens, MEF2C mRNA was detectable and varied >3,000-fold relative to GUSB (0.0091-29.1272 [median: 0.7978]). Patients with the highest relative MEF2C expression (4th quartile) less likely achieved a complete remission after one course of chemotherapy than the other patients (67% vs. 78%, P=0.005). They also had an inferior overall survival (P=0.014; at 5 years: 55±8% vs. 67±4%), inferior event-free survival (P<0.001; at 5 years: 38±7% vs. 54±4%), and higher relapse risk than patients within the lower 3 quartiles of MEF2C expression (P<0.001; at 5 years: 53±9% vs. 35±5%). Of note, exploratory multiple cutpoint analyses for overall and event-free survival indicated that the most statistically significant results were centered around the Q4 cutpoint region, supporting our approach of comparing patients with the highest quartile of relative MEF2C expression with those having lower relative MEF2C expression. Importantly, MEF2C expression was strongly associated with cytogenetic and molecular abnormalities. Specifically, patients with high MEF2C expression less likely had CBF translocations (inv(16): P=0.007, and t(8;21): P<0.001) or normal karyotype AML (P<0.001); conversely, they were more likely to have leukemia with monosomy 7 (P<0.001) and abnormalities involving 11q23 (P<0.001). Furthermore, patients with high MEF2C less likely had a FLT3/ITD (P =0.018) or a mutation in either NPM1 (P=0.010) or CEBPA (P =0.002). Consistently, patients with high MEF2C expression less likely had low-risk disease (16% vs. 46%, P<0.001) and more likely had standard-risk disease (68% vs. 42%, P <0.001) than those with lower MEF2C expression. Indeed, after adjustment for disease risk, age, FAB category, and treatment arm, high MEF2C expression was no longer statistically significantly associated with inferior overall survival (hazard ratio [HR]=0.99 [95% confidence interval: 0.72-1.36], P=0.929), inferior event-free survival (HR: 1.14 [0.86-1.49], P=0.365), or higher relapse risk (HR: 1.32 [0.91-1.92], P=0.137), suggesting that MEF2C cooperates with additional pathogenic abnormalities. Conclusion: High MEF2C expression identifies a subset of AML patients with adverse-risk disease features and poor outcome. These findings provide the rationale for therapeutic targeting of MEF2C transcriptional activation in AML. Disclosures Walter: AstraZeneca, Inc.: Consultancy; Covagen AG: Consultancy; Seattle Genetics, Inc.: Research Funding; Amgen, Inc.: Research Funding; Pfizer, Inc.: Consultancy; Amphivena Therapeutics, Inc.: Consultancy, Research Funding.

Response Rate, Event-Free Survival, and Overall Survival in Newly Diagnosed Acute Myeloid Leukemia: US Food and Drug Administration Trial-Level and Patient-Level Analyses

2021 ◽  
Author(s):  
Kelly J. Norsworthy ◽  
Xin Gao ◽  
Chia-Wen Ko ◽  
E. Dianne Pulte ◽  
Jiaxi Zhou ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Strong Association ◽  
Intensive Chemotherapy ◽  
Newly Diagnosed ◽  
Event Free Survival ◽  
Free Survival ◽  
Patient Level ◽  
Acute Myeloid

PURPOSE To explore trial-level and patient-level associations between response (complete remission [CR] and CR + CR with incomplete hematologic [CRi] or platelet [CRp] recovery), event-free survival (EFS), and overall survival (OS) in newly diagnosed acute myeloid leukemia (AML) trials of intensive chemotherapy. METHODS We identified data from eight randomized, active-controlled trials of intensive chemotherapy submitted to the US Food and Drug Administration for treatment of newly diagnosed AML (N = 4,482). Associations between trial-level odds ratios (ORs) for CR and CR + CRi or CRp, and hazard ratios (HRs) for EFS and OS were analyzed using weighted linear regression models. We performed patient-level responder analyses to compare OS by response using pooled data from all studies. RESULTS In trial-level analyses, association between HR for OS and OR for CR was moderate (R2 = 0.49; 95% CI, 0.05 to 0.86), as was the association with OR for CR + CRi or CRp (R2 = 0.48; 95% CI, 0.05 to 0.99). For OS versus EFS, a strong association was observed (R2 = 0.87; 95% CI, 0.47 to 0.98) when EFS definitions were harmonized across trials using raw data. In the patient-level responder analyses, patients who achieved CR had better OS compared with CRi or CRp responders (0.73; 95% CI, 0.64 to 0.84) and nonresponders (HR, 0.33; 95% CI, 0.31 to 0.37). CONCLUSION On a trial level, there is a moderate association between OS and CR rate. A strong association between EFS and OS was observed. However, CIs were wide, and results became moderate using alternative definitions for EFS. Patient-level analyses showed CR responders have better OS compared with CRi or CRp responders and nonresponders. A therapy in newly diagnosed AML with benefit in EFS or substantial benefit in CR rate would be likely to have an OS effect.

scholarly journals The Role of the Slit-Robo Family in Adult Patients with Acute Myeloid Leukemia

Blood ◽  
2015 ◽  
Vol 126 (23) ◽  
pp. 3816-3816
Author(s):  
Aleksandra Golos ◽  
Dorota Jesionek-Kupnicka ◽  
Tadeusz Robak ◽  
Ewa Wawrzyniak ◽  
Lidia Anna Gil ◽  
...  
Keyword(s):  
Bone Marrow ◽  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Bone Marrow Involvement ◽  
Control Group ◽  
Newly Diagnosed ◽  
Low Expression ◽  
Acute Myeloid

Abstract Introduction: SLIT-ROBO is newly discovered ligand-receptor family of neuronal guidance molecules. Recently, it has been proved that these proteins are involved in both, physiologic and pathologic angiogenesis. In animal models, it was shown both, pro-and antiangiogenic of SLIT-ROBO signaling. Moreover, the interaction of SLIT ligands with their roundabout receptors (ROBO) results in promotion of apoptosis, adhesion and blocking of cell cycle. There is evidence that SLIT-ROBO proteins are involved in pathogenesis of solid tumors, both in angiogenesis dependent and independent way. The role of SLIT-ROBO proteins in biology of acute myeloid leukemia (AML) remains unknown.The only two hitherto published studies considering ROBO4 expression in AML have revealed its increased expression in the blasts cells. The aim of the study was to evaluate the role of SLIT-ROBO proteins in AML. The expression of SLIT ligands, and their receptors ROBO was assessed in bone marrow of newly diagnosed AML patients and in the control group. The expression level of the proteins was correlated with known prognostic factors, response to treatment and overall survival (OS), as well as angiogenesis activity. To our knowledge, it has been the first study investigating the whole family of SLIT-ROBO proteins in AML. Methods: Expression SLIT-ROBO proteins was assessed in bone marrow biopsy specimens of 79 newly diagnosed AML patients with median age 59 years [18-87]. The paraffin-embedded tissue blocks were retrieved and subjected to immunohistochemistry for SLIT ligands (SLIT1, SLIT2, SLIT3), and their receptors ROBO1, ROBO2, ROBO3, and ROBO4. The positive blasts cells were semi-quantitatively analyzed according to previously published methods (Perrone et al, 2006). For the purpose of analysis the patients were divided into "low-expressers" and "high-expressers". Concurrently, all samples were immunostained for CD34 to calculate microvessel density (MVD) as an equivalent of angiogenesis. The control group was composed of 23 BM biopsies form patients with newly diagnosed lymphoma without bone marrow involvement. Results: Expression of ROBO receptors and SLIT ligands in AML patients and in the control group. In our study higher expression of ROBO1, ROBO2, and ROBO3 was observed more often in AML patients compared to the control group (p<0.0001, p<0.001, and p=0.09, respectively, Fig 1.). In contrast, low expression of SLIT1, SLIT2, and SLIT3 ligands has been shown more often in AML than in control BM samples (p<0.0001, p=0.003, and p=0.001, respectively,Fig.2.). Higher expression of ROBO1, ROBO2, and ROBO3 was more often in AML patients ≥60 years (p=0.04, p=0.008, and p=0.02, respectively).Conversely, low expression of ROBO4 was more often observed in elderly AML (p=0.06). The majority of patients with de novo AML had low expression of SLIT1 and SLIT2 (p=0.053 and p=0.055, respectively). As to ROBO, higher expression of ROBO2 in the group with secondary AML was more frequent (p=0.09). No significant correlations between the SLIT-ROBO proteins' expression,neither cytogenetic risk group nor clinical stage parameters such as WBC, hemoglobin level, proportion of leukemic blasts in BM, or LDH activity were found. Similarly, neither of the SLIT-ROBO proteins influenced the complete remission rate (CR) and overall survival (OS). Relationship between SLIT-ROBO expression and angiogenesis activity in AML patients and control group. Significantly higher MVD in BM of AML patients than in control group (Me 51 [9-140] vs 16 [4-78], p<0.0001) has been observed. ROBO4was the only protein that expression correlated significantly with MVD. Higher expression of ROBO4 was associated with higher MVD in both, AML and the control group (p=0.05 and p=0.01, respectively). Conclusions: SLIT-ROBO family members play a role in biology of AML. ROBO4 is involved in both, physiologic and pathologic angiogenesis A better understanding of SLIT-ROBO signaling pathway in leukemic blasts may create new optionsfor AML therapy. Acknowledgments: AG and DJ-K both equally contributed to the study. This work was supported by grants from Medical University of Lodz, Lodz, Poland (502-03/1-093-01/502-14-077 and 503/1-093-01/503-11-001). Disclosures Robak: Eisai Inc: Research Funding. Wierzbowska:Janssen, Celgene: Consultancy.

Prospective Randomized Comparison of Idarubicin and High-Dose Daunorubicin in Induction Chemotherapy for Newly Diagnosed Acute Myeloid Leukemia

2017 ◽  
Vol 35 (24) ◽  
pp. 2754-2763 ◽  
Author(s):  
Je-Hwan Lee ◽  
Hawk Kim ◽  
Young-Don Joo ◽  
Won-Sik Lee ◽  
Sung Hwa Bae ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Phase Iii ◽  
High Dose ◽  
Newly Diagnosed ◽  
Survival Times ◽  
Event Free Survival ◽  
Free Survival ◽  
Acute Myeloid

Purpose We compared two induction regimens, idarubicin (12 mg/m2/d for 3 days) versus high-dose daunorubicin (90 mg/m2/d for 3 days), in young adults with newly diagnosed acute myeloid leukemia (AML). Patients and Methods A total of 299 patients (149 randomly assigned to cytarabine plus idarubicin [AI] and 150 assigned to cytarabine plus high-dose daunorubicin [AD]) were analyzed. All patients received cytarabine (200 mg/m2/d for 7 days). Results Complete remission (CR) was induced in 232 patients (77.6%), with no difference in CR rates between the AI and AD arms (80.5% v 74.7%, respectively; P = .224). At a median follow-up time of 34.9 months, survival and relapse rates did not differ between the AI and AD arms (4-year overall survival, 51.1% v 54.7%, respectively; P = .756; cumulative incidence of relapse, 35.2% v 25.1%, respectively; P = .194; event-free survival, 45.5% v 50.8%, respectively; P = .772). Toxicity profiles were also similar in the two arms. Interestingly, overall and event-free survival times of patients with FLT3 internal tandem duplication (ITD) mutation were significantly different (AI v AD: median overall survival, 15.5 months v not reached, respectively; P = .030; event-free survival, 11.9 months v not reached, respectively; P = .028). Conclusion This phase III trial comparing idarubicin with high-dose daunorubicin did not find significant differences in CR rates, relapse, and survival. Significant interaction between the treatment arm and the FLT3-ITD mutation was found, and high-dose daunorubicin was more effective than idarubicin in patients with FLT3-ITD mutation.

Enasidenib: First Mutant IDH2 Inhibitor for the Treatment of Refractory and Relapsed Acute Myeloid Leukemia

2019 ◽  
Vol 18 (14) ◽  
pp. 1936-1951 ◽  
Author(s):  
Raghav Dogra ◽  
Rohit Bhatia ◽  
Ravi Shankar ◽  
Parveen Bansal ◽  
Ravindra K. Rawal
Keyword(s):  
Clinical Trial ◽  
Bone Marrow ◽  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Adverse Effects ◽  
Blood Cells ◽  
Myeloid Leukemia ◽  
White Blood Cells ◽  
Phase Iii ◽  
Acute Myeloid

Background: Acute myeloid leukemia is the collective name for different types of leukemias of myeloid origin affecting blood and bone marrow. The overproduction of immature myeloblasts (white blood cells) is the characteristic feature of AML, thus flooding the bone marrow and reducing its capacity to produce normal blood cells. USFDA on August 1, 2017, approved a drug named Enasidenib formerly known as AG-221 which is being marketed under the name Idhifa to treat R/R AML with IDH2 mutation. The present review depicts the broad profile of enasidenib including various aspects of chemistry, preclinical, clinical studies, pharmacokinetics, mode of action and toxicity studies. Methods: Various reports and research articles have been referred to summarize different aspects related to chemistry and pharmacokinetics of enasidenib. Clinical data was collected from various recently published clinical reports including clinical trial outcomes. Result: The various findings of enasidenib revealed that it has been designed to allosterically inhibit mutated IDH2 to treat R/R AML patients. It has also presented good safety and efficacy profile along with 9.3 months overall survival rates of patients in which disease has relapsed. The drug is still under study either in combination or solely to treat hematological malignancies. Molecular modeling studies revealed that enasidenib binds to its target through hydrophobic interaction and hydrogen bonding inside the binding pocket. Enasidenib is found to be associated with certain adverse effects like elevated bilirubin level, diarrhea, differentiation syndrome, decreased potassium and calcium levels, etc. Conclusion: Enasidenib or AG-221was introduced by FDA as an anticancer agent which was developed as a first in class, a selective allosteric inhibitor of the tumor target i.e. IDH2 for Relapsed or Refractory AML. Phase 1/2 clinical trial of Enasidenib resulted in the overall survival rate of 40.3% with CR of 19.3%. Phase III trial on the Enasidenib is still under process along with another trial to test its potency against other cell lines. Edasidenib is associated with certain adverse effects, which can be reduced by investigators by designing its newer derivatives on the basis of SAR studies. Hence, it may come in the light as a potent lead entity for anticancer treatment in the coming years.

Phase 3 VERONA study of venetoclax with azacitidine to assess change in complete remission and overall survival in treatment-naïve higher-risk myelodysplastic syndromes.

2021 ◽  
Vol 39 (15_suppl) ◽  
pp. TPS7054-TPS7054
Author(s):  
Amer Methqal Zeidan ◽  
Jacqueline Suen Garcia ◽  
Pierre Fenaux ◽  
Uwe Platzbecker ◽  
Yasushi Miyazaki ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Hypomethylating Agents ◽  
Newly Diagnosed ◽  
Phase 3 ◽  
Transfusion Independence ◽  
Treatment Naïve ◽  
The U.S ◽  
Acute Myeloid

TPS7054 Background: Patients with higher-risk myelodysplastic syndromes (HR-MDS) experience peripheral cytopenias, disease progression to acute myeloid leukemia, and high mortality with expected median overall survival of less than 2 years. Allogeneic hematopoietic cell transplantation (allo-HCT) is the only potentially curative treatment. Patients ineligible for transplantation are treated with hypomethylating agents such as azacitidine (Aza), which is not curative and provides limited improvement in clinical benefit. Venetoclax (Ven) is a selective, potent, oral B-cell lymphoma-2 (BCL-2) inhibitor that is approved in the U.S. in combination with hypomethylating agents for treating older or co-morbid patients with newly diagnosed acute myeloid leukemia ineligible for intensive chemotherapy. Ven is approved in the U.S. as first-line treatment for chronic lymphocytic leukemia or small lymphocytic lymphoma. For patients with treatment-naïve HR-MDS, Ven + Aza demonstrated manageable safety and a combined complete remission (CR)/marrow CR (mCR) rate of 79% in a single arm phase 1b study (NCT02942290). To confirm these benefits, the VERONA study, a randomized, double-blind, phase 3 study (NCT04401748) of patients with treatment-naïve HR-MDS, will assess the safety and efficacy of Ven combined with Aza including CR rate and overall survival. Methods: Patients (≥18 years) with newly diagnosed HR-MDS per WHO 2016 classification with = 20% bone marrow blasts per marrow biopsy/aspirate at screening will be enrolled at ̃200 sites globally (̃500 patients). Patients must have intermediate risk or higher IPSS-R (score > 3), ECOG ≤2, and be hematopoietic stem cell transplant (HSCT) eligible without any pre-arranged donor, or HSCT ineligible without a plan for HSCT at Study Day 1. De novo patients without prior hypomethylating agents, chemotherapy for MDS, or allogenic stem cell transplantation are eligible. Patients will be randomized 1:1 to receive placebo or Ven 400 mg oral tablet once daily on Days 1-14, both in combination with Aza 75 mg/m2 (intravenous or subcutaneous) on Days 7-0-0 or Days 5-2-2 per 28-days. Patients will receive study treatment until disease progression, unacceptable toxicity, HCT, withdrawal of consent, or discontinuation. The primary endpoints are CR rate (as adjudicated by investigator) per IWG 2006 criteria and overall survival. Secondary outcomes are red blood cell transfusion independence, platelet transfusion independence, change in fatigue as measured by Patient-Reported Outcomes Measurement Information System (PROMIS)-fatigue SF 7a scale score, time to deterioration in physical functioning domain of EORTC QLC-C30 scale, overall response (CR + partial response), and modified overall response (CR + mCR + partial response). Exploratory objectives are predictive biomarkers and pharmacokinetics. Clinical trial information: NCT04401748.

Relationship Between Cleaved L-Selectin Levels and the Outcome of Acute Myeloid Leukemia

Blood ◽  
1998 ◽  
Vol 92 (9) ◽  
pp. 3115-3122 ◽  
Author(s):  
M. Extermann ◽  
M. Bacchi ◽  
N. Monai ◽  
M. Fopp ◽  
M. Fey ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
High Plasma ◽  
Multivariate Statistical ◽  
Free Survival ◽  
The Mean ◽  
American Society ◽  
The Relationship ◽  
Acute Myeloid

Abstract High plasma levels of the shed form of L-selectin (sL-selectin) are frequently detectable in acute myeloid leukemia (AML). sL-selectin can inhibit blast cell adhesion to vascular endothelium and may thereby influence the phenotype of AML. In this study, we have investigated the relationship between sL-selectin levels and clinical presentation or disease outcome in 100 patients with AML. Fifty-eight patients were found to have sL-selectin levels ≥3.12 μg/mL (≥3 SD above the mean of healthy controls: “increased”). Patients with extramedullary disease such as lymphadenopathies, splenomegaly, hepatomegaly, and/or muco-cutaneous infiltration had significantly increased sL-selectin levels (P &lt; .001). sL-selectin levels were significantly heterogeneous in the French-American-British subtypes (P = .0003). Patients with “normal” sL-selectin levels had higher probability of achieving complete remission (CR) than with “increased” levels: 81% versus 64%, respectively (P = .06). When adjusting for clinically relevant covariates predictive for CR (sex, age, Auer rods), “normal” sL-selectin levels were significantly associated with CR (odds ratio, 3.08; 95% confidence interval [CI], 1.10 to 8.58;P = .03). Moreover, patients with “increased” sL-selectin levels (≥3.12 μg/mL) had shorter event-free survival (EFS) (median 7.3 v 12 months, P = .008) and overall survival (median 1 v 2.05 years, P = .03) than patients with sL-selectin &lt;3.12 μg/mL. Multivariate statistical analysis (adjusted for age and presence of Auer rods) indicated that sL-selectin was an independent prognostic factor for EFS (hazard ratio [HR], 1.96; 95% CI, 1.21 to 3.17, P = .006) and overall survival (HR, 1.80; 95% CI, 1.09 to 2.98; P = .02). Thus, plasma sL-selectin may be a useful prognostic marker in the evaluation of AML at diagnosis. © 1998 by The American Society of Hematology.

Sign in / Sign up

Export Citation Format

Share Document