The Role of the Slit-Robo Family in Adult Patients with Acute Myeloid Leukemia

Abstract Introduction: SLIT-ROBO is newly discovered ligand-receptor family of neuronal guidance molecules. Recently, it has been proved that these proteins are involved in both, physiologic and pathologic angiogenesis. In animal models, it was shown both, pro-and antiangiogenic of SLIT-ROBO signaling. Moreover, the interaction of SLIT ligands with their roundabout receptors (ROBO) results in promotion of apoptosis, adhesion and blocking of cell cycle. There is evidence that SLIT-ROBO proteins are involved in pathogenesis of solid tumors, both in angiogenesis dependent and independent way. The role of SLIT-ROBO proteins in biology of acute myeloid leukemia (AML) remains unknown.The only two hitherto published studies considering ROBO4 expression in AML have revealed its increased expression in the blasts cells. The aim of the study was to evaluate the role of SLIT-ROBO proteins in AML. The expression of SLIT ligands, and their receptors ROBO was assessed in bone marrow of newly diagnosed AML patients and in the control group. The expression level of the proteins was correlated with known prognostic factors, response to treatment and overall survival (OS), as well as angiogenesis activity. To our knowledge, it has been the first study investigating the whole family of SLIT-ROBO proteins in AML. Methods: Expression SLIT-ROBO proteins was assessed in bone marrow biopsy specimens of 79 newly diagnosed AML patients with median age 59 years [18-87]. The paraffin-embedded tissue blocks were retrieved and subjected to immunohistochemistry for SLIT ligands (SLIT1, SLIT2, SLIT3), and their receptors ROBO1, ROBO2, ROBO3, and ROBO4. The positive blasts cells were semi-quantitatively analyzed according to previously published methods (Perrone et al, 2006). For the purpose of analysis the patients were divided into "low-expressers" and "high-expressers". Concurrently, all samples were immunostained for CD34 to calculate microvessel density (MVD) as an equivalent of angiogenesis. The control group was composed of 23 BM biopsies form patients with newly diagnosed lymphoma without bone marrow involvement. Results: Expression of ROBO receptors and SLIT ligands in AML patients and in the control group. In our study higher expression of ROBO1, ROBO2, and ROBO3 was observed more often in AML patients compared to the control group (p<0.0001, p<0.001, and p=0.09, respectively, Fig 1.). In contrast, low expression of SLIT1, SLIT2, and SLIT3 ligands has been shown more often in AML than in control BM samples (p<0.0001, p=0.003, and p=0.001, respectively,Fig.2.). Higher expression of ROBO1, ROBO2, and ROBO3 was more often in AML patients ≥60 years (p=0.04, p=0.008, and p=0.02, respectively).Conversely, low expression of ROBO4 was more often observed in elderly AML (p=0.06). The majority of patients with de novo AML had low expression of SLIT1 and SLIT2 (p=0.053 and p=0.055, respectively). As to ROBO, higher expression of ROBO2 in the group with secondary AML was more frequent (p=0.09). No significant correlations between the SLIT-ROBO proteins' expression,neither cytogenetic risk group nor clinical stage parameters such as WBC, hemoglobin level, proportion of leukemic blasts in BM, or LDH activity were found. Similarly, neither of the SLIT-ROBO proteins influenced the complete remission rate (CR) and overall survival (OS). Relationship between SLIT-ROBO expression and angiogenesis activity in AML patients and control group. Significantly higher MVD in BM of AML patients than in control group (Me 51 [9-140] vs 16 [4-78], p<0.0001) has been observed. ROBO4was the only protein that expression correlated significantly with MVD. Higher expression of ROBO4 was associated with higher MVD in both, AML and the control group (p=0.05 and p=0.01, respectively). Conclusions: SLIT-ROBO family members play a role in biology of AML. ROBO4 is involved in both, physiologic and pathologic angiogenesis A better understanding of SLIT-ROBO signaling pathway in leukemic blasts may create new optionsfor AML therapy. Acknowledgments: AG and DJ-K both equally contributed to the study. This work was supported by grants from Medical University of Lodz, Lodz, Poland (502-03/1-093-01/502-14-077 and 503/1-093-01/503-11-001). Disclosures Robak: Eisai Inc: Research Funding. Wierzbowska:Janssen, Celgene: Consultancy.

Download Full-text

Limitations of Performance Status (PS) Assignment in Predicting Outcomes of Acute Myeloid Leukemia (AML) and the Role of Objective Parameters in Predicting PS Assignment,

Blood ◽

10.1182/blood.v118.21.4191.4191 ◽

2011 ◽

Vol 118 (21) ◽

pp. 4191-4191

Author(s):

Kathleen Wren Phelan ◽

Sucha Nand ◽

Laura C Michaelis

Keyword(s):

Bone Marrow ◽

Overall Survival ◽

Acute Myeloid Leukemia ◽

Myeloid Leukemia ◽

Performance Status ◽

Albumin Level ◽

Clinical Parameters ◽

The Relationship ◽

Acute Myeloid

Abstract Abstract 4191 Background: Performance status is traditionally used to judge fitness in cancer patients. It is often a key factor in determining appropriateness for chemotherapy and entry into clinical trials. Most research on PS has been in solid tumor patients, but it is generally assumed to be valid in hematologic malignancies as well. However, PS assessment can be problematic, especially in patients who have become ill quickly or where there are conflicting parameters; e.g. patients whose function is limited but who are still actively working. We explored the role of PS in patients with AML to determine if alternative, more objectively determined parameters, could predict PS. We evaluated the relationship between PS and rates of complete remission (CR) and duration of overall survival (OS) as well as the relationship between objectively determined pretreatment parameters and these outcomes. Methods: Approval for retrospective data collection was obtained by the institutional IRB. A randomly selected cohort of 145 patients with newly diagnosed AML was identified using pharmacy records of treatment with induction agents cytarabine, daunorubicin or azacitidine. We excluded patients with acute promyelocytic leukemia. Pretreatment data was collected from the electronic medical record of each subject, including AML subtype, age, gender, PS, presence of infection at diagnosis, peripheral blood white blood cell count, peripheral blood blast percentage, hemoglobin, lactate dehydrogenase, aspartate transaminase, alanine transaminase, creatinine, albumin, left ventricular ejection fraction (LVEF), bone marrow cellularity, bone marrow blast percentage and cytogenetics. Achievement of complete remission was assessed and overall survival was calculated in months from diagnosis to either death or date of censorship. PS was obtained from physician notes and documented as a Zubrod score. In the absence of documentation, the authors reviewed medical records for presenting symptoms, mobility and functional status and made an assignment. Retrospective assignment of PS was reviewed and confirmed by at least two of the authors. Logistic regression was performed to examine the relationship between pretreatment characteristics and CR, and the effect of pretreatment characteristics and the assignment of PS, dichotomized as good (0–1) vs. poor (2–4). Linear regression analysis was used to investigate the relationship between pretreatment characteristics and OS. Results: A total of 120/145 (83%) were assigned a PS of 0, 1. Twenty patients were considered to have a PS of 2 and five patients had a PS of 3. There was a statistically significant relationship between a good PS assignment and a higher albumin level (OR 5.32, p=0.000, 95% CI 2.32, 12.22). There was no significant relationship between the remaining clinical parameters and PS assignment, including age at diagnosis. Ninety-three patients (64%) achieved a CR. There was no relationship between PS, assigned either contemporarily or retrospectively, with the achievement of CR. The median overall survival was 15 months (range 0 to 92 months). PS did not predict the duration of OS. As is well reported, CR was significantly more likely in younger (< 60 yrs) patients and patients with favorable cytogenetics. Median OS was also prolonged in these patients. No additional pretreatment characteristics were significantly related to CR or OS except LVEF. Patients with an LVEF greater than 50% were more likely to achieve a CR (P=0.0001) and had a longer OS. Conclusions: We found that, among pretreatment characteristics, a higher albumin level was associated with a good performance status. Age was not a predictor of PS. Contrary to expectations, in this population of treated AML patients, PS did not predict either CR or OS. In addition to the association of younger age and favorable cytogenetics with better outcomes, we found that a higher LVEF is also associated with higher CR rates, but this is likely explained by choice of chemotherapeutic agents. Our data calls into question the use of PS as a tool to guide therapy in routine clinical management of acute myeloid leukemia. Prospective studies should evaluate the utility of more objective and more reliably documented clinical parameters than PS for predicting patient outcome. Disclosures: No relevant conflicts of interest to declare.

Download Full-text

Using Circ-ANAPC7 As a Novel Type of Biomarker in the Monitoring of Acute Myeloid Leukemia

Blood ◽

10.1182/blood-2019-128179 ◽

2019 ◽

Vol 134 (Supplement_1) ◽

pp. 5179-5179

Author(s):

Ying Shen ◽

Yachun Jia ◽

Ru Zhang ◽

Hongli Chen ◽

Yuandong Feng ◽

...

Keyword(s):

Bone Marrow ◽

Overall Survival ◽

Acute Myeloid Leukemia ◽

Myeloid Leukemia ◽

Expression Level ◽

Circular Rnas ◽

Newly Diagnosed ◽

Free Survival ◽

Non Coding Rnas ◽

Acute Myeloid

Introduction: Acute myeloid leukemia (AML) is a heterogeneous disease characterized by the clonal proliferation of immature myeloid progenitor cells in the bone marrow, compressing normal blood cell production and leading to bone marrow failure ultimately. Overwhelming evidence has established that non-coding RNAs (ncRNAs), such as long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) have great role in AML pathogenesis. Circular RNAs (circRNAs) that occupy gene expression at the transcriptional or post-transcriptional level have great potential to be biomarker for types of cancers. We have screened one altered circRNA named circ-ANAPC7 in AML before. In this study, we aimed to validate its expression by enlarging sample size and illuminating the diagnostic and monitoring value of circ-ANAPC7 in AML. Methods: Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was supposed to confirm the expression of circ-ANAPC7 of AML patients. The sequences of circ-ANAPC7 primers were as follows: 5′- GGGAGCAGCACTTAGGAACAT -3′ (sense) and 5′-AAAGCTGGTACTTCTGAGGTGG-3′ (antisense). Receiver operating characteristic (ROC) curve was carried out to evaluate the diagnostic value. Overall survival rate and event-free survival rate were estimated by the Kplan-Meier analysis and compared using the log-rank test. All tests were two-sided, and P < 0.05 was defined as a significant difference. Results: The expression level of circ-ANAPC7 in newly diagnosed AML was significantly higher than CR patients and iron deficiency anemia (IDA) control group (P < 0.001) (Figure 1A). Furthermore, we chose 24 AML patients who undergo the condition of newly diagnosed AML, CR and relapse to dynamical monitor the expression of circ-ANAPC7. We discovered that circ-ANAPC7 expression level changed accompanied with the disease condition transformation. It was high expressed in newly diagnosed and relapsed AML patients. When patients got CR, the expression level of circ-ANAPC7 decreased (P < 0.05). In the continuous CR patients, it remained in a minimal level (Figure 1C). ROC curve analysis revealed that circ-ANAPC7 has significant value of AML diagnosis (AUC = 0.915, P < 0.001) (Figure 1B). Moreover, we conducted survival analysis to explore long-term effect of circ-ANAPC7 expression in AML patients. The result revealed that circ-ANAPC7 expression was not related to overall survival (OS) and disease-free survival (DFS) of AML patients (P > 0.05) (Figure 1D). Conclusions: We validated that circ-ANAPC7 was upregulated in AML patients. The clinical analysis revealed that circ-ANAPC7 may be a predictive index for diagnosing and supervising early recurrence of AML. What's more, additional molecular mechanisms and biological functions of circ-ANAPC7 merit deeper investigation. Figure 1 Disclosures No relevant conflicts of interest to declare.

Download Full-text

Expression of BECN1 gene in Acute Myeloid Leukemia: Association with Hematological and Clinical Parameters

QJM ◽

10.1093/qjmed/hcab091.007 ◽

2021 ◽

Vol 114 (Supplement_1) ◽

Author(s):

Mohamed Moustafa Ahmed ◽

Manal Fawzy Ghozlan ◽

Walaa Ali Mohamed ◽

Nesma Ahmed Safwat ◽

Noha Bassiouny Hassan

Keyword(s):

Gene Expression ◽

Bone Marrow ◽

Acute Myeloid Leukemia ◽

Peripheral Blood ◽

Myeloid Leukemia ◽

Control Group ◽

Fish Analysis ◽

Newly Diagnosed ◽

Significant Difference ◽

Acute Myeloid

Abstract Background In acute myeloid leukemia (AML), there is copy number loss in autophagic genes such as BECN1. Accordingly, decreased autophagy and the development of AML are related. BECN1 is a critical mediator that influences the onset and progress of autophagy. Objective To investigate the expression status of BECN1 gene in newly diagnosed adult AML patients and its association with various hematological parameters and clinical outcomes. Methods Case control study to study BECN1 gene expression variability between 50 newly diagnosed adult AML patients and 20 healthy age and sex matched controls, with follow up of the patients to detect its effect on induction therapy. All AML patients underwent full history taking, through clinical examination, laboratory investigations such as complete blood count (CBC) with examination of peripheral blood and bone marrow Leishman stained films, immunophenotyping, cytogenetic analysis (karyotyping/FISH analysis) and BECN1 gene expression analysis using real-time quantitative polymerase chain reaction (qRT-PCR). Results In our study, a highly significant difference was found as regards reduced expression of BECN1 gene in patients group compared to control group. We also found reduced BECN1 gene expression in both intermediate and adverse risk groups compared to favorable risk group. Reduced expression of BECN1 gene was associated with increasing age and total leukocytic count (TLC), peripheral blood (PB) and bone marrow (BM) blasts, the presence of FLT3-ITD mutation, CD34 and CD117 and in non-responders group. No statistically significant difference was found as regards haemoglobin (Hb) level, platelet (PLT) count and FAB subtypes. Conclusion Autophagy plays an important role in the pathogenesis of AML. Furthermore; the reductive regulation of the BECN1 gene may carry a poor prognosis and is associated with many well established bad prognostic factors especially FLT3-ITD mutation. Targeting autophagy pathways especially its major regulator (BECN1 gene) may become an effective and promising new line of therapy for AML patients.

Download Full-text

Faculty Opinions recommendation of Azacitidine prolongs overall survival compared with conventional care regimens in elderly patients with low bone marrow blast count acute myeloid leukemia.

Faculty Opinions – Post-Publication Peer Review of the Biomedical Literature ◽

10.3410/f.2362957.1991055 ◽

2010 ◽

Author(s):

Arati Rao

Keyword(s):

Bone Marrow ◽

Overall Survival ◽

Acute Myeloid Leukemia ◽

Elderly Patients ◽

Myeloid Leukemia ◽

Conventional Care ◽

Bone Marrow Blast ◽

Blast Count ◽

Acute Myeloid

Download Full-text

Enasidenib: First Mutant IDH2 Inhibitor for the Treatment of Refractory and Relapsed Acute Myeloid Leukemia

Anti-Cancer Agents in Medicinal Chemistry ◽

10.2174/1871520618666181025091128 ◽

2019 ◽

Vol 18 (14) ◽

pp. 1936-1951 ◽

Cited By ~ 5

Author(s):

Raghav Dogra ◽

Rohit Bhatia ◽

Ravi Shankar ◽

Parveen Bansal ◽

Ravindra K. Rawal

Keyword(s):

Clinical Trial ◽

Bone Marrow ◽

Overall Survival ◽

Acute Myeloid Leukemia ◽

Adverse Effects ◽

Blood Cells ◽

Myeloid Leukemia ◽

White Blood Cells ◽

Phase Iii ◽

Acute Myeloid

Background: Acute myeloid leukemia is the collective name for different types of leukemias of myeloid origin affecting blood and bone marrow. The overproduction of immature myeloblasts (white blood cells) is the characteristic feature of AML, thus flooding the bone marrow and reducing its capacity to produce normal blood cells. USFDA on August 1, 2017, approved a drug named Enasidenib formerly known as AG-221 which is being marketed under the name Idhifa to treat R/R AML with IDH2 mutation. The present review depicts the broad profile of enasidenib including various aspects of chemistry, preclinical, clinical studies, pharmacokinetics, mode of action and toxicity studies. Methods: Various reports and research articles have been referred to summarize different aspects related to chemistry and pharmacokinetics of enasidenib. Clinical data was collected from various recently published clinical reports including clinical trial outcomes. Result: The various findings of enasidenib revealed that it has been designed to allosterically inhibit mutated IDH2 to treat R/R AML patients. It has also presented good safety and efficacy profile along with 9.3 months overall survival rates of patients in which disease has relapsed. The drug is still under study either in combination or solely to treat hematological malignancies. Molecular modeling studies revealed that enasidenib binds to its target through hydrophobic interaction and hydrogen bonding inside the binding pocket. Enasidenib is found to be associated with certain adverse effects like elevated bilirubin level, diarrhea, differentiation syndrome, decreased potassium and calcium levels, etc. Conclusion: Enasidenib or AG-221was introduced by FDA as an anticancer agent which was developed as a first in class, a selective allosteric inhibitor of the tumor target i.e. IDH2 for Relapsed or Refractory AML. Phase 1/2 clinical trial of Enasidenib resulted in the overall survival rate of 40.3% with CR of 19.3%. Phase III trial on the Enasidenib is still under process along with another trial to test its potency against other cell lines. Edasidenib is associated with certain adverse effects, which can be reduced by investigators by designing its newer derivatives on the basis of SAR studies. Hence, it may come in the light as a potent lead entity for anticancer treatment in the coming years.

Download Full-text

Leukemia stem cell-bone marrow microenvironment interplay in acute myeloid leukemia development

Experimental Hematology and Oncology ◽

10.1186/s40164-021-00233-2 ◽

2021 ◽

Vol 10 (1) ◽

Author(s):

Yiyi Yao ◽

Fenglin Li ◽

Jiansong Huang ◽

Jie Jin ◽

Huafeng Wang

Keyword(s):

Bone Marrow ◽

Acute Myeloid Leukemia ◽

Myeloid Leukemia ◽

Chemotherapy Resistance ◽

Bone Marrow Microenvironment ◽

Cytotoxic Effects ◽

High Relapse Rate ◽

Underlying Mechanisms ◽

Acute Myeloid

AbstractDespite the advances in intensive chemotherapy regimens and targeted therapies, overall survival (OS) of acute myeloid leukemia (AML) remains unfavorable due to inevitable chemotherapy resistance and high relapse rate, which mainly caused by the persistence existence of leukemia stem cells (LSCs). Bone marrow microenvironment (BMM), the home of hematopoiesis, has been considered to play a crucial role in both hematopoiesis and leukemogenesis. When interrupted by the AML cells, a malignant BMM formed and thus provided a refuge for LSCs and protecting them from the cytotoxic effects of chemotherapy. In this review, we summarized the alterations in the bidirectional interplay between hematopoietic cells and BMM in the normal/AML hematopoietic environment, and pointed out the key role of these alterations in pathogenesis and chemotherapy resistance of AML. Finally, we focused on the current potential BMM-targeted strategies together with future prospects and challenges. Accordingly, while further research is necessary to elucidate the underlying mechanisms behind LSC–BMM interaction, targeting the interaction is perceived as a potential therapeutic strategy to eradicate LSCs and ultimately improve the outcome of AML.

Download Full-text

High HSPA8 expression predicts adverse outcomes of acute myeloid leukemia

BMC Cancer ◽

10.1186/s12885-021-08193-w ◽

2021 ◽

Vol 21 (1) ◽

Author(s):

Jun Li ◽

Zheng Ge

Keyword(s):

Overall Survival ◽

Acute Myeloid Leukemia ◽

Prognostic Factor ◽

Myeloid Leukemia ◽

Cell Function ◽

Adverse Outcomes ◽

High Expression ◽

Micro Rnas ◽

Acute Myeloid

Abstract Background Acute myeloid leukemia (AML) remains one of the most common hematological malignancies, posing a serious challenge to human health. HSPA8 is a chaperone protein that facilitates proper protein folding. It contributes to various activities of cell function and also is associated with various types of cancers. To date, the role of HSPA8 in AML is still undetermined. Methods In this study, public datasets available from the TCGA (Cancer Genome Atlas) and GEO (Gene Expression Omnibus) were mined to discover the association between the expression of HSPA8 and clinical phenotypes of CN-AML. A series of bioinformatics analysis methods, including functional annotation and miRNA-mRNA regulation network analysis, were employed to investigate the role of HSPA8 in CN-AML. Results HSPA8 was highly expressed in the AML patients compared to the healthy controls. The high HSPA8 expression had lower overall survival (OS) rate than those with low HSPA8 expression. High expression of HSPA8 was also an independent prognostic factor for overall survival (OS) of CN-AML patients by multivariate analysis. The differential expressed genes (DEGs) associated with HSPA8 high expression were identified, and they were enriched PI3k-Akt signaling, cAMP signaling, calcium signaling pathway. HSPA8 high expression was also positively associated with micro-RNAs (hsa-mir-1269a, hsa-mir-508-3p, hsa-mir-203a), the micro-RNAs targeted genes (VSTM4, RHOB, HOBX7) and key known oncogenes (KLF5, RAN, and IDH1), and negatively associated with tumor suppressors (KLF12, PRKG1, TRPS1, NOTCH1, RORA). Conclusions Our research revealed HSPA8 as a novel potential prognostic factor to predict the survival of CN-AML patients. Our data also revealed the possible carcinogenic mechanism and the complicated microRNA-mRNA network associated with the HSPA8 high expression in AML.

Download Full-text

Isolated Gastric Myeloid Sarcoma: A Case Report and Review of the Literature

Case Reports in Hematology ◽

10.1155/2014/541807 ◽

2014 ◽

Vol 2014 ◽

pp. 1-4 ◽

Cited By ~ 3

Author(s):

Pankit Vachhani ◽

Prithviraj Bose

Keyword(s):

Bone Marrow ◽

Acute Myeloid Leukemia ◽

Case Report ◽

Myeloid Leukemia ◽

Bone Marrow Involvement ◽

Myeloid Sarcoma ◽

Review Of The Literature ◽

Aged Woman ◽

Middle Aged Woman ◽

Acute Myeloid

Myeloid sarcoma represents the proliferation of myeloblasts of acute myeloid leukemia (AML) at extramedullary sites. While extramedullary involvement in AML is uncommon in itself, isolated myeloid sarcomas, that is, myeloid sarcomas without any bone marrow involvement, are extremely rare and pose a diagnostic and therapeutic challenge. Here, we present the case of a middle-aged woman with isolated myeloid sarcoma in the stomach—an organ seldom involved by this disease. Additionally, the literature on the epidemiology, diagnosis, pathology, prognosis, and therapeutic options in myeloid sarcomas has been reviewed.

Download Full-text