scholarly journals Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

PLoS ONE ◽  
2015 ◽  
Vol 10 (3) ◽  
pp. e0119573 ◽  
Author(s):  
Yuan Jiang ◽  
Zhongqi Yang ◽  
Xiaoyi Wang ◽  
Yuxia Hou
Author(s):  
Yangrae Rho ◽  
◽  
Hoyeon Lee ◽  
Hiyoung Kim ◽  
Inho Yang ◽  
...  

The current study reports the cytochrome oxidase subunit 1 sequence of Gastropoda Ergalatax contracta from Busan, Korea. Four specimens were collected and extracted to obtain genomic DNA for the sequencing analysis. This is the first E. contracta sequence from Korea submitted to the NCBI for an accession number.


ISRN Zoology ◽  
2012 ◽  
Vol 2012 ◽  
pp. 1-8 ◽  
Author(s):  
Hiroko Somura ◽  
Hiroshi Hori ◽  
Yoshinobu Manome

The slow loris (Nycticebus) is a prosimian that is popular among exotic pet lovers. In Japan, many slow lorises have been imported illegally. Prosimians that have been confiscated in raids are protected in Japanese zoos, and the number of such animals has increased. In most cases, the country of origin remains unknown and even the species can be difficult to identify from the animal’s physical appearance alone. We have attempted to resolve this problem by using DNA analysis. DNA samples of five species, consisting of the Pygmy slow loris (Nycticebus pygmaeus), Bengal slow loris (Nycticebus bengalensis), Sunda slow loris (Nycticebus coucang), Javan slow loris (Nycticebus javanicus), and Bornean slow loris (Nycticebus menagensis), were extracted, amplified, and the nucleotide sequences of mitochondrial 12S rRNA, 16S rRNA, and the cytochrome oxidase subunit 1(COI) regions were compared. Differences of nucleic acid sequences of representative individuals were demonstrated.


Zoosymposia ◽  
2019 ◽  
Vol 14 (1) ◽  
pp. 189-192
Author(s):  
JULIANNE E. MCLAUGHLIN ◽  
PAUL B. FRANDSEN ◽  
WOLFRAM MEY ◽  
STEFFEN U. PAULS

The phylogeny of Rhyacophilidae was explored with 28S ribosomal RNA (rRNA) and Cytochrome Oxidase Subunit I (COI) mitochondrial DNA (mtDNA). Eighty one rhyacophilids were included in the analysis. We found that although Rhyacophilidae was recovered as monophyletic, intrafamilial relationships are not well-resolved using this dataset. Bootstrap support was poor for intrageneric relationships and additional data will be required to present a more robust hypothesis. The recovered phylogeny places Fansipangana as the sister taxon of the rest of Rhyacophilidae. We found that Himalopsyche was nested inside the genus Rhyacophila with the verrula group sister to Himalopsyche and remaining Rhyacophila. These results and possible relationships should be tested with a more extensive data set.


Zootaxa ◽  
2005 ◽  
Vol 1049 (1) ◽  
pp. 19 ◽  
Author(s):  
ENDRE WILLASSEN

Undescribed females representing four morphological types were found in a collection of adult Diamesa from about 5000 m altitude in Rongbuk, Tibet. Short DNA sequences of cytochrome oxidase subunit 2 were used to associate two single males in the material with conspecific females. Diamesa solhoyi n.sp. and Diamesa aculeata n.sp. are described. The complete type material and additional specimens have been deposited in the Insect Collection at the Institute of Zoology, Academia Sinica, Beijing (IZAS). The sequences are deposited in Genbank with accession numbers AM051227–AM051233.


2017 ◽  
Vol 5 (1) ◽  
pp. 62
Author(s):  
Andre Wehantouw ◽  
Elvy Ginting ◽  
Stenly Wullur

Populasi ikan hiu global menunjukkan penurunan yang signifikan karena; penangkapan yang masif dan tak terkontrol, karakter biologi reproduksi yang lambat serta fekunditas yang rendah.  Indonesia merupakan salah satu negara kontributor terbesar dalam perdagangan sirip ikan hiu dunia. Tingginya aktifitas perdagangan sirip tersebut berpengaruh terhadap populasi ikan hiu dan berdampak pada turunnya kualitas keseimbangan ekosistem laut. Tujuan penelitian ini untuk mengidentifikasi ikan hiu dari potongan sirip yang didapat dari pengumpul di Tumbak, Minahasa Tenggara menggunakan DNA barcode.  Ekstraksi DNA genom sirip hiu kering dilakukan dengan menggunakan prosedur DNeasy Blood & Tissue kit, amplifikasi gen Cytochrome Oxidase Subunit 1 (COI) dilakukan dengan menggunakan primer Fish BCL5 (TCAACYAATCAYAAAGATATYGGCAC) dan HCO2198 (TAAACTTCAGGGTGACCAAAAAA TCA). Pengolahan data sekuens dilakukan dengan menggunakan program ABsequence3 dan MEGA ver 6.  Pencocokan karakter nukleotida gen COI dilakukan dengan menggunakan program nBLAST yang terintegrasi pada laman GenBank. Sampel sirip yang berhasil dikoleksi berasal dari 4 individu yang berbeda.  Hasil nBLAST menunjukkan bahwa keempat sampel sirip hiu tersebut teridentifikasi sebagai spesies Triaenodon obesus.  Nilai keakuratan pensejajaran sekuens, nilai dugaan, prosentase panjang nukleotida yang selaras, dan prosentase tingkat kemiripan, masing-masing pada nilai antara 604-1245, 0.0, 70-99% dan 92-99%.


Sign in / Sign up

Export Citation Format

Share Document