scholarly journals Complete genome sequence of a Brome Mosaic Virus isolate from the Czech Republic

2010 ◽  
Vol 46 (No. 4) ◽  
pp. 178-182 ◽  
Author(s):  
S. Gadiou ◽  
J.K. Kundu
Keyword(s):  
Czech Republic ◽  
Mosaic Virus ◽  
Virus Isolate ◽  
Broad Bean ◽  
Brome Mosaic Virus ◽  
Full Length ◽  
The Czech Republic ◽  
Sequence Identity ◽  
Full Length Genome ◽  
Broad Bean Mottle Virus

An isolate of Brome mosaic virus (BMV) was originally isolated from Agropyron repens and maintained in Hordeum vulgare. The full-length genome of this isolate (BMV-CZ) was sequenced. Phylogenetic analysis revealed that BMV-CZ shared a minimum of 95.6% sequence identity, localized in the 5′-UTR of RNA-1 with the other BMV isolates from the database, and a maximum of divergence of 30.8% with Broad bean mottle virus localized in the 5′-UTR of RNA-3. This is the first sequence report of full-length BMV from the Czech Republic.

scholarly journals First Report of Squash Mosaic Virus in Ornamental Pumpkin in the Czech Republic

Plant Disease ◽  
2011 ◽  
Vol 95 (10) ◽  
pp. 1321-1321 ◽  
Author(s):  
J. Svoboda ◽  
L. Leisova-Svobodova
Keyword(s):  
United States ◽  
Czech Republic ◽  
Nucleotide Sequence ◽  
Mosaic Virus ◽  
Nucleotide Sequence Identity ◽  
The United States ◽  
The Czech Republic ◽  
Sequence Identity ◽  
Blast Analysis ◽  
Das Elisa

In August 2010, yellow mosaic and leaf deformation were observed on leaves of field planted ornamental pumpkin (Cucurbita pepo L. convar. microcarpina Grebenščikov) plants near Tasovice Village in the Znojmo District of the Czech Republic. These symptoms were typical of a virus infection. Nine leaf samples were collected and examined for the presence of commonly occurring cucurbit viruses by double-antibody sandwich (DAS)-ELISA. Eight samples were infected with Zucchini yellow mosaic virus (ZYMV), seven with Watermelon mosaic virus-2 (WMV-2), five with Cucumber mosaic virus (CMV), and two with Squash mosaic virus (SqMV). Some aphid species were observed on inspected plants but we did not carried out a search for vectors. SqMV isolates, Tas-1 and Tas-5, were also infected with ZYMV and WMV-2. SqMV was separated from the other viruses by mechanical inoculation onto the resistant plant species Cucumis sativus L. ‘Taichung Mou Gua-1’, which is resistant to ZYMV and WMV-2 (3). The virus was transmitted back to C. pepo plants, and DAS-ELISA used for testing for multiple viruses proved the presence of SqMV alone. A C. pepo leaf sample was examined by electron microscopy to validate the presence of the virus. Isometric particles of approximately 30 nm in diameter, corresponding in size and shape to the described particles of SqMV (2), were observed. The presence of SqMV was verified by reverse transcription (RT)-PCR using specific primers designed on the sequence for coat proteins of SqMV found in NCBI and EMBL databases (SqMV-F: TGTGTACAAGATTGGTGGAGATGC; SqMV-R: AGGCTTCTAAAGCGAACTGGG). The obtained amplicons of approximately 1,900 bp were sequenced (GenBank Accession No. JF922966), and by using nucleotide blast analysis (4), identified as a part of RNA-2 genome. Blast analysis showed that the Czech SqMV isolates, Tas-1 and Tas-5, were identical and similar to published SqMV sequences from the United States, Japan, and China. The highest similarity was found between the Czech isolates and one isolate from the United States (Accession No. M96148; E = 0, nucleotide sequence identity = 90%) and one from China (Accession No. AF059533; E = 0, nucleotide sequence identity = 90%). To our knowledge, this is the first report of a natural occurrence of SqMV in the Czech Republic. SqMV can be transmitted via infected seeds by as much as 35% (1); therefore, protection against epidemics should be based on clean seed programs. References: (1) M. Alvarez et al. Phytopathology 68:257, 1978. (2) H. M. Mazzone et al. Biochim. Biophys. Acta 55:164, 1962. (3) T. Wai et al. J. Hered. 88:454, 1997. (4) Z. Zhang et al. J. Comput. Biol. 7:203, 2000.

SYBR Green I based RT-qPCR assays for the detection of RNA viruses of cereals and grasses

2014 ◽  
Vol 65 (12) ◽  
pp. 1323 ◽  
Author(s):  
T. Dráb ◽  
E. Svobodová ◽  
J. Ripl ◽  
J. Jarošová ◽  
F. Rabenstein ◽  
...  
Keyword(s):  
Czech Republic ◽  
Mosaic Virus ◽  
Rna Viruses ◽  
Brome Mosaic Virus ◽  
Sybr Green ◽  
Sybr Green I ◽  
Mottle Virus ◽  
The Czech Republic ◽  
High Prevalence ◽  
One Step

Less prevalent viruses of family Poaceae are usually excluded from the focus of interest, even though they represent a possible threat to agricultural production. We designed and validated a set of primer pairs suitable for detection and quantification of five RNA viruses, Lolium latent virus (LoLV), Oat necrosis mottle virus (ONMV), Ryegrass mosaic virus (RgMV), Soil-borne cereal mosaic virus (SBCMV), and Spartina mottle virus (SpMV), by means of one-step RT-qPCR based on SYBR Green I. These primers were used together with primers for Brome mosaic virus (BMV) and Wheat streak mosaic virus (WSMV) described elsewhere to screen grass and cereal samples from the Czech Republic. The results revealed a high prevalence of WSMV and RgMV, which pointed to possible local epidemics. We also make the first report of LoLV presence in the Czech Republic.

Full-length genome sequence of the tospovirus melon severe mosaic virus

2017 ◽  
Vol 162 (5) ◽  
pp. 1419-1422 ◽  
Author(s):  
M. Ciuffo ◽  
L. Nerva ◽  
M. Turina
Keyword(s):  
Mosaic Virus ◽  
Genome Sequence ◽  
Full Length ◽  
Full Length Genome

Eriophyid mite transmission and host range of a Brome streak mosaic virus isolate derived from a full-length cDNA clone

2007 ◽  
Vol 153 (1) ◽  
pp. 181-185 ◽  
Author(s):  
D. Stephan ◽  
I. Moeller ◽  
A. Skoracka ◽  
F. Ehrig ◽  
E. Maiss
Keyword(s):  
Host Range ◽  
Mosaic Virus ◽  
Cdna Clone ◽  
Virus Isolate ◽  
Full Length ◽  
Eriophyid Mite ◽  
Full Length Cdna

scholarly journals Occurrence of viruses on pepper plantations in the Czech Republic – Short communication

2012 ◽  
Vol 39 (No. 3) ◽  
pp. 139-143 ◽  
Author(s):  
J. Svoboda ◽  
L. Svobodová-Leišová
Keyword(s):  
Czech Republic ◽  
Mosaic Virus ◽  
Short Communication ◽  
Alfalfa Mosaic Virus ◽  
Sources Of Resistance ◽  
Pepper Mild Mottle Virus ◽  
The Czech Republic ◽  
Tomato Spotted Wilt ◽  
Wilt Virus ◽  
Broad Bean Wilt Virus

A survey of viruses on capsicum plants in the Czech Republic was carried out in the years 2006–2010. Altogether, 375 leaf samples with symptoms suggesting viral infection were collected both from open fields and greenhouses. These samples were examined for the presence of Alfalfa mosaic virus (AMV), Broad bean wilt virus-1 (BBWV-1), Cucumber mosaic virus (CMV), Pepper mild mottle virus (PMMoV), Potato virus Y (PVY), Tobacco mosaic virus (TMV) and Tomato spotted wilt virus (TSWV) by ELISA. Viruses detected in the samples were AMV, BBWV-1, CMV and PVY. The most prevalent were CMV and PVY which were present in 24 and 29% of tested samples, respectively. In some cases a complex infection of two viruses was detected. Gene sources of resistance against CMV and PVY are mentioned. The relation of virus occurrence on aphid incidence is discussed.

scholarly journals First Report of Kudzu mosaic virus on Pueraria montana (Kudzu) in China

Plant Disease ◽  
2013 ◽  
Vol 97 (1) ◽  
pp. 148-148 ◽  
Author(s):  
J. Zhang ◽  
Z. J. Wu
Keyword(s):  
Sequence Analysis ◽  
Nucleotide Sequence ◽  
Mosaic Virus ◽  
Nucleotide Sequence Identity ◽  
Southern China ◽  
Full Length ◽  
Yellow Vein ◽  
Mosaic Symptom ◽  
First Report ◽  
Sequence Identity

Kudzu (Pueraria montana), a weed widely distributed in southern China, is common in the Fuzhou region of Fujian Province, where many plants show yellow vein mosaic disease. In September 2008, four leaf samples from different plants exhibiting yellow vein mosaic symptom were collected in suburban district of Fuzhou (25°15′ N, 118°08′ E). Whitefly (Bemisia tabaci) infestation was also observed in this region. Total DNA was extracted from all samples using a CTAB method (4). Universal primers (PA/PB) were used to amplify part of the intergenic region and coat protein gene of DNA-A of begomoviruses (1). An amplicon of approximately 500 bp was obtained from all four samples and then sequenced. Comparison of 500-bp fragments (GenBank Accession Nos. FJ539016-18 and FJ539014) revealed the presence of the same virus (98.8 to 99.4%). A pair of back-to-back primers (Yg3FL-F: 5′-GGATCCTTTGTTGAACGCCTTTCC-3′/Yg3FL-R: 5′-GGATCCCACATGTTTAAAGTAAAGC-3′) were designed to amplify the full-length DNA-A from the Chinese isolate identified as Yg3. Sequence analysis showed that full-length DNA-A of Yg3 isolate comprised 2,729 nucleotides (GenBank Accession No. FJ539014) and shared the highest nucleotide sequence identity (91.9%) with Kudzu mosaic virus (KuMV, GenBank Accession No. DQ641690) from Vietnam. To further test the association of DNA-B fragments with the four samples from southern China, rolling circle amplification (RCA) was performed (3). When RCA products were digested with Sph I, approximately 2.7 kb was obtained from all samples. Yg3 isolate was chosen to be sequenced. Sequence analysis showed that full-length DNA-B of Yg3 isolate comprised 2,677 nucleotides (GenBank Accession No. FJ539015) and shared the highest nucleotide sequence identity (76.8%) with KuMV DNA-B (GenBank Accession No. DQ641691) from Vietnam. Based on the current convention of begomovirus species demarcation of <89% sequence identity cut-off criterion (2), Yg3 was identified as an isolate of KuMV. To our knowledge, this is the first report of association of KuMV with yellow vein mosaic symptom of kudzu in China. References: (1). D. Deng et al. Annals Appl. Biol. 125:327, 1994. (2). C. M. Fauquet et al. Arch. Virol. 148:405, 2003. (3). D. Haible et al. J. Virol. Methods 135:9, 2006. (4). Y. Xie et al. Chinese Sci. Bull. 47:197, 2002.

scholarly journals Survey of virus pathogens in gladiolus, iris and tulips in the Czech Republic

2009 ◽  
Vol 57 (5) ◽  
pp. 79-86 ◽  
Author(s):  
Ganesh Selvaraj Duraisamy ◽  
Radovan Pokorný
Keyword(s):  
Czech Republic ◽  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Ornamental Plants ◽  
Tobacco Rattle Virus ◽  
Yellow Spot ◽  
Yellow Mosaic Virus ◽  
Spot Virus ◽  
The Czech Republic ◽  
Aerial Parts

The occurrence of Bean yellow mosaic virus (BYMV), Cucumber mosaic virus (CMV) Tobacco rattle virus (TRV) in gladiolus, iris, tulip and Iris yellow spot virus (IYSV) in iris was investigated by examining the plants by the means of serological techniques (ELISA). ELISA was applied to determine the presence of BYMV, CMV, TRV infections in both aerial and underground parts of gladiolus, iris, and tulip, and IYSV on the aerial parts of iris, respectively. 262 gladiolus plants were tested. 63.7% was infected by BYMV, 29.4 % by CMV, and 2.7 % by TRV. Out of 180 plants of iris, 1.1% was infected by BYMV, 6.7% by CMV, 2.8% by TRV, and 0% by IYSV. Out of 28 plants of tulip, 28.6% was infected by CMV, and 7.1% by TRV. ELISA proved to be a suitable method for detection of viruses in leaves of these ornamental plants, but it often failed to detect viruses in flowers and corms. A high transmission of BYMV by gladiolus cormlets was also found.

scholarly journals First Report of Cucurbit aphid-borne yellows virus in Squash in the Czech Republic

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 220-220 ◽  
Author(s):  
J. Svoboda ◽  
L. Leisova-Svobodova ◽  
H. Lecoq
Keyword(s):  
Czech Republic ◽  
Cucurbita Pepo ◽  
Sandwich Elisa ◽  
Yellow Mosaic Virus ◽  
Research Report ◽  
Natural Occurrence ◽  
The Czech Republic ◽  
First Report ◽  
Sequence Identity ◽  
Three Samples

A yellowing of buttercup squash (Cucurbita pepo L. var. oleifera Pietsch) leaves was observed on plants in southern Moravia, the main squash-growing area of the Czech Republic. Forty leaf samples were collected in September 2009 and examined for the presence of possible cucurbit viruses by double-antibody sandwich-ELISA. Thirty-three samples were infected with Zucchini yellow mosaic virus and five with Cucurbit aphid-borne yellows virus (CABYV). The positive samples of CABYV originated near the villages of Josefov and Prušánky (one per sample) and Rakvice (three samples), and the virus isolates were named Jos-5, Pr-15, Rak-1, Rak-4, and Rak-5, respectively. CABYV was immediately transmitted from leaves collected in the field to summer squash (Cucurbita pepo L. convar. giromontiina Grebenšcikov) plants by aphids in a persistent manner. Green peach aphids, Myzus persicae (Sulzer), were used to inoculate squash plants with acquisition and inoculation feeding times of 2 and 5 days, respectively. Twenty-one plants were inoculated with 20 aphids per plant. Transmission was successful in 25% of the plants as assessed by ELISA. Infected plants showed very mild yellowing 2 weeks after transmission and were shorter compared with noninoculated controls. Leaf samples of newly infected plants were examined by electron microscopy and isometric particles of approximately 25 nm in diameter, corresponding in size and shape to described particles of CABYV (3), were observed. The presence of CABYV was verified by reverse transcription (RT)-PCR using a primer pair specific to the CABYV coat protein gene (2). The amplicons were sequenced (GenBank Accession Nos. HM771269–HM771273) and 100% sequence identity was found between isolates Jos-5 and Pr-15 and among the isolates Rak-1, Rak-2, and Rak-3. Sequence identity between these two groups was 99.3%. Blast analysis (4) showed that the Czech CABYV isolates are closely related to the Slovak isolates SK-1 (Accession No. FJ428797) and IR-3 (Accession No. FJ428800) with nucleotide sequence identities of 99.6 and 99.1%, respectively. These results indicate a similar origin between the Czech and Slovak isolates. To our knowledge, this is the first report of the natural occurrence of CABYV in the Czech Republic. CABYV is a widespread virus that reduces the yield of cucurbit vegetables (1). Protection against epidemics should be based on the control of aphid vectors, protecting plants with very fine mesh netting, keeping the cultivation area free of weeds, or planting cultivars resistant to CABYV. References: (1) Anonymous. Research Report 1995-1996, 117. Vegetable Breeding Station, INRA, Montfavet, France, 1998. (2) M. Juarez at al., Plant Dis. 88:907, 2004. (3) H. Lecoq et al. Plant Pathol. 41:749, 1992. (4) Z. Zhang Z. et al. J. Comput. Biol. 7:203, 2000.

scholarly journals First Report of Tobacco streak virus on Dahlia in the Czech Republic

Plant Disease ◽  
2008 ◽  
Vol 92 (3) ◽  
pp. 484-484 ◽  
Author(s):  
V. Mokra ◽  
B. Gotzova ◽  
V. Bezdekova ◽  
P. Dedic ◽  
J. Ptacek
Keyword(s):  
Czech Republic ◽  
Mosaic Virus ◽  
Rna Extraction ◽  
Chenopodium Quinoa ◽  
Spherical Particles ◽  
Tobacco Streak Virus ◽  
Streak Virus ◽  
Rt Pcr ◽  
The Czech Republic ◽  
Dahlia Mosaic Virus

Dahlia is an important ornamental crop in the Czech Republic where they have been grown for more than 150 years. New dahlia cultivars have been selected by Czech plant breeders. Virus diseases, including mosaic and stunt caused mostly by Dahlia mosaic virus, have been a problem. From 2003 to 2005, color breaking was observed in several dahlia cultivars of foreign and Czech origin. White stripes in blossoms were most frequently expressed in the second half of the flowering season. No symptoms are visible in flowers of white and yellow cultivars. It was difficult to characterize symptoms on leaves because most cultivars were infected simultaneously by Dahlia mosaic virus. Sap inoculations of Chenopodium quinoa produced local lesions after 5 to 7 days, followed by systemic chlorosis, necrosis of younger leaves, and death of the shoot apex, indicating possible Tobacco streak virus (TSV) infection (2). Spherical particles (25 to 30 nm) were observed in leaf-dip preparations of samples from experimentally infected C. quinoa plants and analyzed by using transmission electron microscopy. These particles became decorated when using immunoelectron microscopy with TSV IgG (Bioreba, Reinach, Switzerland and Neogen, Ayrshire, Scotland). Samples of 80 dahlia cultivars were tested for TSV infection by ELISA using commercially available kits (Bioreba and Neogen). Most of the samples were grown in a collection of dahlia cultivars of Czech and foreign origin and some were obtained from growers in the Czech Republic. Fifty six dahlia cultivars were shown to be TSV infected. ELISA also indicated a higher concentration of the virus in flowers. The identity of the virus isolated from symptomatic plants was confirmed by reverse transcription (RT)-PCR using total RNA extraction from symptomatic plants. RT-PCR (4), using a primer pair (1) derived from the coat protein gene sequence of TSV (3), was followed by electrophoresis on 1.0% agarose gels. Products of the predicted size (approximately 700 bp) were found in naturally infected dahlia plants (n = 10), systemically infected host plants C. quinoa (n = 10), and symptomatic Nicotina megalosiphon (n = 10) that scored as TSV positive by ELISA. No bands of this size were seen in negative controls. To our knowledge, this is the first detection of TSV in the Czech Republic. References: (1) A. I. Bhat et al. Arch. Virol. 147:651, 2002. (2) A. A. Brunt Plant Pathol. 17:119, 1968. (3) B. J. C. Cornelissen et al. Nucleic Acids Res.12:2427, 1984. (4) S. S. Pappu et al. J. Virol. Methods 4:9, 1993.

Sign in / Sign up

Export Citation Format

Share Document