scholarly journals Visiting Bitter Gourd (Momordica charantia) from a Breeding Perspective: A Review

2020 ◽  
Author(s):  
Hari Kesh ◽  
Prashant Kaushik
Keyword(s):  
Abiotic Stresses ◽  
Essential Role ◽  
Bitter Gourd ◽  
Biotic And Abiotic Stresses ◽  
Early Maturity ◽  
Breeding Programs ◽  
Know How ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
The Family

Bitter gourd is an important vegetable of the family Cucurbitaceae, cultivated mainly in humid and subtropical Asia. Bitter gourd is vegetable with immense health benefits due to the presence of medicinal compounds such as charatin, vicine, and polypeptide-p, which play an essential role in lessening the blood glucose levels. Moreover, bitter gourd fruits are particularly rich in vitamin C, minerals, and carotenes. Here, an effort has been made to critically evaluate the extent of achievements during the enhancement and enactment of bitter gourd breeding programs with the use of latest technologies. Broadening of the genetic base of cultivated bitter groud varieties as a result of enrichment of the existing resources by using the wild species in the breeding programs. Practical seed production technological know-how along with the use of the MS system (male sterility)/chemical-induced sterility procedure is nonetheless vital to cope up with the market demands. Superior yielding bitter gourd hybrids combining early maturity and resistance to biotic and abiotic stresses are regularly needed to cope up with the challenge of bitter gourd production.

scholarly journals Nitric oxide ameliorates stress responses in plants

2011 ◽  
Vol 57 (No. 3) ◽  
pp. 95-100 ◽  
Author(s):  
A.N. Misra ◽  
M. Misra ◽  
R. Singh
Keyword(s):  
Nitric Oxide ◽  
Reactive Oxygen Species ◽  
Unpaired Electron ◽  
Stress Responses ◽  
Abiotic Stresses ◽  
Essential Role ◽  
Oxygen Species ◽  
Biotic And Abiotic Stresses ◽  
Physiological Processes

Nitric oxide (NO) is a gaseous diatomic molecule with a wide variety of physiological and pathological implications in plants. Presence of unpaired electron in its molecular orbital makes it highly reactive; it can react directly with metal complexes, radicals, DNA, proteins, lipids and other biomolecules. Nitric oxide (NO) and reactive oxygen species (ROS) are known to play essential role in a number of important plant physiological processes. This manuscript reviews the role of NO on these processes during various biotic and abiotic stresses.  

scholarly journals Drug-Herb Interaction between Metformin and Momordica charantia in Diabetic Mice

2019 ◽  
Vol 3 (2) ◽  
pp. 81
Author(s):  
Asri Dwi Endah Dewi Pramesthi ◽  
Mirhansyah Ardana ◽  
Niken Indriyanti
Keyword(s):  
Fruit Juice ◽  
Negative Control ◽  
Momordica Charantia ◽  
Bitter Gourd ◽  
Diabetic Mice ◽  
Once Daily ◽  
Glucose Lowering ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Significant Difference

Background: Bitter gourd has various metabolites, such as momordicosides, polypeptide-P, v-insulin, charantin, and vicine that have antidiabetic effect. It has synergistically effect while combined with oral diabetic drugs, such as metformin as glucose lowering agent. The aim of this study is to investigate the interaction of bitter gourd fruit juice and metformin as glucose lowering agent in mice.Materials and Methods: Alloxan-induced diabetic mice were treated with bitter gourd fruit juice, metformin, and the combination of those two for 21 days. Glucose level was checked on first and last day of treatment.Results: Furthermore, blood glucose levels measurement showed no significant difference between groups compared with negative control, which was p>0.05. The stomach of groups that treated with metformin and bitter gourd fruit juice histopathologically showed no significant differences.Conclusion: The use of bitter gourd once daily together with metformin is a better choice, while twice daily might induce hypoglycemia and mice death. There is no interaction between them on lowering blood glucose.Keywords: metformin, Momordica charantia, diabetes mellitus

scholarly journals Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples

2020 ◽  
Vol 3 (2) ◽  
pp. 48-53
Author(s):  
Hindah Sabrina Amin ◽  
Miftahul Mushlih
Keyword(s):  
Diabetes Mellitus ◽  
Nadh Dehydrogenase ◽  
Insulin Production ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
The Family ◽  
Impaired Insulin ◽  
Mitochondrial Genotype ◽  
Mitochondrial Nd1

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.

scholarly journals ROLE OF FAMILY IN IMPLEMENTATION OF DIABETES EXERCISE IN TYPE 2 DIABETES MELITUS PATIENTS

2018 ◽  
Vol 7 (2) ◽  
pp. 152-157
Author(s):  
Lono Wijayanti
Keyword(s):  
Diabetes Mellitus ◽  
Type 2 Diabetes ◽  
Blood Glucose ◽  
Health Center ◽  
Family Members ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
The Family

Introduction: Diabetes mellitus is a group of metabolic diseases characterized by an increase in blood glucose levels (hyperglycemia), which occurs due to abnormal insulin secretion, insulin activity and both (Brunner & Suddarth, 2014). The role of the family is needed for diabetics related to well-being and health where the family environment is a place for individuals to learn for life (Friedman, 2010). The role of the family is the most powerful indicator in giving a positive impact on the implementation of diabetes exercise which acts as a glicemic control which is controlling and regulating blood sugar levels.Objective: The aim of the study was to describe the role of families in implementing diabetes exercise in type 2 Diabetes Mellitus (DM) patients at Gayungan Health Center, Dukuh Menanggal, Surabaya.Method: The design of this study used descriptive research. The population is all families who have family members with diabetes mellitus cases with a large sample of 4O people. Sampling using the Total sampling technique The variables studied were the role of family in implementing diabetes exercise. Data collection is done by distributing questionnaires.Results: The results of the study showed that of the 40 respondents in the Gayungan Community Health Center working area in Dukuh Menanggal dated 40% the role of good family, 32.5% was sufficient, 27.5 was lacking in supporting the implementation of diabetes exerciseConclusion: The family role of almost half is in the good category. The family should play an active role in the management of diabetes exercises in family members who suffer from diabetes mellitus so that blood glucose levels can be controlled properly. Keywords: The role of the family, diabetes exercise, diabetes mellitus.

scholarly journals Introgressions of Vitis rotundifolia Michx. to obtain grapevine genotypes with complex resistance to biotic and abiotic stresses

2021 ◽  
Vol 25 (7) ◽  
pp. 693-700
Author(s):  
V. A. Volynkin ◽  
V. V. Likhovskoi ◽  
I. A. Vasylyk ◽  
N. A. Rybachenko ◽  
E. A. Lushchay ◽  
...  
Keyword(s):  
Powdery Mildew ◽  
Abiotic Stresses ◽  
Biotic And Abiotic Stresses ◽  
Paternal Genome ◽  
Vitis Rotundifolia ◽  
Maternal Genotype ◽  
The Family ◽  
M 31 ◽  
Almost All ◽  
High Degree

Vitis rotundifolia Michx. is one of the species of the family Vitaceae, with resistance to both biotic and abiotic stresses. The present study reports new scientific knowledge about the inheritance of resistance to downy mildew, powdery mildew and frost by V. vinifera varieties from V. rotundifolia. Recombinant lines of three hybrid populations from the crossing of the maternal genotype ♀M. 31-77-10 with V. rotundifolia hybrids were used as the object of the study. As a result of laboratory screening, more than 40 % of recombinants of the ♀M. 31-77-10× ×[DRX-M5-734+DRX-M5-753+DRX-M5-790] population showed a high degree of frost resistance (–24 °C), while 6 % of transgressive recombinants were characterized by a very high degree of resistance (–27 °С). The maternal genotype ♀M. 31-77-10 does not carry alleles of resistance to powdery mildew at the Run1 locus and in the field suffers from powdery mildew much more than the paternal genotypes. The prevalence of powdery mildew on vegetative organs in the three recombinant populations over the years varies on average between 3.2–17.1, 0.3–17.7 and 0.6–5.2 %, respectively. As a result, almost all recombinant genotypes that received a resistant allele from the paternal genome are highly resistant to powdery mildew.

scholarly journals Pendidikan Kesehatan tentang Diabetes Melitus pada Keluarga di Kelurahan Pahandut Palangka Raya

2018 ◽  
Vol 4 (1) ◽  
pp. 1-7
Author(s):  
Putria Carolina ◽  
Haryadi Haryadi ◽  
Wawan Kurniawan Setiawan ◽  
Meyria Sintani ◽  
Yuliani Yuliani ◽  
...  
Keyword(s):  
Health Education ◽  
Signs And Symptoms ◽  
Predisposing Factor ◽  
Professional Students ◽  
Healthy Behaviors ◽  
Glucose Levels ◽  
Information Giving ◽  
Blood Glucose Levels ◽  
Education Community ◽  
The Family

Diabetes Mellitus (DM) is a disease characterized by blood glucose levels exceeding normal which is characterized by fasting and postprandial hyperglycemia, atherosclerosis and microangiopathic vascular disease. DM can be caused due to diet or genetic factors. Research conducted in Pahandut Palangka Raya Village showed a lack of family knowledge (67%) regarding DM can be a predisposing factor for the occurrence of DM in family members. Education is an effort to make people behave or adopt healthy behaviors by means of persuasion, persuasion, appeal, invitation, giving information, giving awareness and so on, through activities called education or health promotion. The method of implementing the activity is to use a health education strategy for families in Pahandut Palangka Raya. The activities carried out are by carrying out health education to families in Pahandut Palangka Raya. The activity is carried out with the lecture and question and answer method. The health education media used are LCD projectors and leaflets distributed to families. The material provided is about DM disease which includes understanding, causes, signs and symptoms, treatment, complications. During health education, the environment is conducive, the family enthusiastically listens to health education and actively asks when given opportunities for discussion. The results of the evaluation of health education show the family is able to mention and explain again about DM disease as described during health education. Community service activities carried out by lecturers, nurses and Ners professional students to families in Pahandut Palangka Raya can be declared successful. Through the evaluation results during health education, there is a positive response from the family and is also able to mention again about DM as described.

scholarly journals PERAN INFORMAL KELUARGA DALAM PENGENDALIAN KADAR GLUKOSA DARAH PADA PENDERITA DIABETES MELLITUS

2018 ◽  
Vol 1 (2) ◽  
pp. 5
Author(s):  
Rosalina Rosalina
Keyword(s):  
Diabetes Mellitus ◽  
Blood Glucose ◽  
Blood Sugar ◽  
Blood Glucose Control ◽  
Bivariate Analysis ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
The Family ◽  
Sugar Levels

Diabetes mellitus is a disease or disorder of chronic metabolism with multiethiology characterized by high blood sugar (hyperglycemia). Diabetes Mellitus can not be cured but can be controlled by regulating blood sugar levels. One important factor in controlling blood sugar levels is the role of the family To know the correlation between family's informal role and the control of blood glucose levels in people with diabetes mellitus at RSUD Ungaran Semarang Regency.The design of this study was descriptive correlational with cross sectional approach with the number of population of 176 people and samples of 64 respondents by using accidental sampling method. Data collection tools used questionnaires. Data analysis used SPSS version 23.0. Bivariate analysis was processed by using chi square test. The informal role of the family in people with diabetes mellitus is mostly in good category (75.0%). Control of blood glucose level in people with diabetes mellitus is mostly in good category (62,5%). There is significant correlation between family informal role and blood glucose control in patients with diabetes mellitus at RSUD Ungaran Semarang Regency, with p value 0,043 <0,05 (α). There is correlation between family's informal role and the control of blood glucose levels in people with diabetes mellitus at RSUD Ungaran Semarang Regency.We recommend that patients with DM further improve the control of blood glucose levels by increasing the role of the family so as to prevent the occurrence of complications

Effects of Maternal Flaxseed Supplementation on Female Offspring of Diabetic Rats in Serum Concentration of Glucose, Insulin, and Thyroid Hormones

2019 ◽  
Vol 89 (1-2) ◽  
pp. 45-54
Author(s):  
Akemi Suzuki ◽  
André Manoel Correia-Santos ◽  
Gabriela Câmara Vicente ◽  
Luiz Guillermo Coca Velarde ◽  
Gilson Teles Boaventura
Keyword(s):  
Thyroid Hormones ◽  
High Fat Diet ◽  
Female Offspring ◽  
Flaxseed Oil ◽  
Diabetic Rats ◽  
High Fat ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Flaxseed Flour ◽  
Maternal Consumption

Abstract. Objective: This study aimed to evaluate the effect of maternal consumption of flaxseed flour and oil on serum concentrations of glucose, insulin, and thyroid hormones of the adult female offspring of diabetic rats. Methods: Wistar rats were induced to diabetes by a high-fat diet (60%) and streptozotocin (35 mg/kg). Rats were mated and once pregnancy was confirmed, were divided into the following groups: Control Group (CG): casein-based diet; High-fat Group (HG): high-fat diet (49%); High-fat Flaxseed Group (HFG): high-fat diet supplemented with 25% flaxseed flour; High-fat Flaxseed Oil group (HOG): high-fat diet, where soya oil was replaced with flaxseed oil. After weaning, female pups (n = 6) from each group were separated, received a commercial rat diet and were sacrificed after 180 days. Serum insulin concentrations were determined by ELISA, the levels of triiodothyronine (T3), thyroxine (T4) and thyroid-stimulating hormone (TSH) were determined by chemiluminescence. Results: There was a significant reduction in body weight at weaning in HG (−31%), HFG (−33%) and HOG (44%) compared to CG (p = 0.002), which became similar by the end of 180 days. Blood glucose levels were reduced in HFG (−10%, p = 0.044) when compared to CG, and there was no significant difference between groups in relation to insulin, T3, T4, and TSH after 180 days. Conclusions: Maternal severe hyperglycemia during pregnancy and lactation resulted in a microsomal offspring. Maternal consumption of flaxseed reduces blood glucose levels in adult offspring without significant effects on insulin levels and thyroid hormones.

Sign in / Sign up

Export Citation Format

Share Document