scholarly journals Pendidikan Kesehatan tentang Diabetes Melitus pada Keluarga di Kelurahan Pahandut Palangka Raya

2018 ◽  
Vol 4 (1) ◽  
pp. 1-7
Author(s):  
Putria Carolina ◽  
Haryadi Haryadi ◽  
Wawan Kurniawan Setiawan ◽  
Meyria Sintani ◽  
Yuliani Yuliani ◽  
...  
Keyword(s):  
Health Education ◽  
Signs And Symptoms ◽  
Predisposing Factor ◽  
Professional Students ◽  
Healthy Behaviors ◽  
Glucose Levels ◽  
Information Giving ◽  
Blood Glucose Levels ◽  
Education Community ◽  
The Family

Diabetes Mellitus (DM) is a disease characterized by blood glucose levels exceeding normal which is characterized by fasting and postprandial hyperglycemia, atherosclerosis and microangiopathic vascular disease. DM can be caused due to diet or genetic factors. Research conducted in Pahandut Palangka Raya Village showed a lack of family knowledge (67%) regarding DM can be a predisposing factor for the occurrence of DM in family members. Education is an effort to make people behave or adopt healthy behaviors by means of persuasion, persuasion, appeal, invitation, giving information, giving awareness and so on, through activities called education or health promotion. The method of implementing the activity is to use a health education strategy for families in Pahandut Palangka Raya. The activities carried out are by carrying out health education to families in Pahandut Palangka Raya. The activity is carried out with the lecture and question and answer method. The health education media used are LCD projectors and leaflets distributed to families. The material provided is about DM disease which includes understanding, causes, signs and symptoms, treatment, complications. During health education, the environment is conducive, the family enthusiastically listens to health education and actively asks when given opportunities for discussion. The results of the evaluation of health education show the family is able to mention and explain again about DM disease as described during health education. Community service activities carried out by lecturers, nurses and Ners professional students to families in Pahandut Palangka Raya can be declared successful. Through the evaluation results during health education, there is a positive response from the family and is also able to mention again about DM as described.

Adrenal Insufficiency in the Term and Preterm Neonate

1999 ◽  
Vol 18 (5) ◽  
pp. 21-28 ◽  
Author(s):  
Catherine Witt
Keyword(s):  
Adrenal Gland ◽  
Adrenal Insufficiency ◽  
Preterm Neonate ◽  
Endocrine System ◽  
Signs And Symptoms ◽  
The Body ◽  
Electrolyte Balance ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Appropriate Treatment

The adrenal gland is part of the endocrine system and produces hormones that are essential for survival. The adrenal cortex, the largest part of the adrenal gland, produces three major hormones. Glucocorticoids regulate metabolism of glucose, protein, and fat and allow the body to respond to stress by increasing blood glucose levels and cardiac output. Mineralocorticoids regulate fluid and electrolyte balance and help maintain blood pressure. Androgens are responsible for sexual differentiation in the fetus.Insufficient production of these hormones can occur for many reasons and can have a profound effect on the newborn. It is important for neonatal nurses to be familiar with signs and symptoms and appropriate treatment of adrenal insufficiency. This article explores causes, signs and symptoms, and treatment of adrenal insufficiency in the newborn.

Applications for self-monitoring of gestational diabetes mellitus in pregnancy; part of the improvement of connected health in Europe (Preprint)

2019 ◽  
Author(s):  
Kristina Drusany Starič ◽  
Vladimir Trajkovik ◽  
Hrvoje Belani ◽  
Petra Bukovec
Keyword(s):  
Gestational Diabetes ◽  
Mobile Applications ◽  
Positive Impact ◽  
Mobile Apps ◽  
Rapid Development ◽  
Self Monitoring ◽  
Healthy Behaviors ◽  
Connected Health ◽  
Glucose Levels ◽  
Blood Glucose Levels

BACKGROUND The rapid development of mobile application technology and personalized medicine also in Europe, stimulate the self-monitoring. Self-monitoring allows the patient to actively participate in the treatment process, with a positive impact on the result of the treatment. Mobile applications thus offer a new way to promote healthy behaviors, such as healthy diet, physical activity and measurement of blood glucose levels in the care for women with gestational diabetes. However, there are many factors, which make significant barriers preventing wide use of mobile applications in general medical praxis. OBJECTIVE The main aim of this study is to evaluate the most commonly used mobile apps used to manage gestational diabetes and compare them to each other. METHODS This paper presents a study, which investigates the mobile applications that can potentially support controlling of the blood sugar in pregnant women. After a broad overview of mobile applications on the Google Play Store and iTunes, we found 90 mobile applications that fit our keywords search terms and our inclusion criteria. Among these 90 applications, only 4 were designed for the management of gestational diabetes and not diabetes in general. All 4 were downloaded and analysed. Among the rest 86 applications that were designed to manage diabetes in general we downloaded, evaluated and compared to each other 5 applications with the highest download rate. RESULTS The characteristics of the most commonly used applications were described. Differentiations between useful mobile applications were investigated. CONCLUSIONS Applications can provide support for women to act on a certain issue by themselves without visiting an obstetrician. Although most of the applications were very useful, we suggested improvements. The greatest policy concerns of connected health are quality, privacy and safety of the gathered data.

scholarly journals Acquired Acrodermatitis Enteropathica in a 28-Year-Old Male with Type 1 Diabetes

2021 ◽  
Vol 2021 ◽  
pp. 1-6
Author(s):  
Owen Ngalamika ◽  
Wencilaus M. P. Selvaraj ◽  
Fatima K. Yikona ◽  
Chibamba Mumba
Keyword(s):  
Type 1 Diabetes ◽  
Zinc Deficiency ◽  
Gastrointestinal Symptoms ◽  
Signs And Symptoms ◽  
Acrodermatitis Enteropathica ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Systemic Infections

Acrodermatitis enteropathica (AE) is a rare disorder arising from inherited or acquired zinc deficiency. It is mainly characterized by acral dermatitis, periorificial dermatitis, alopecia, and gastrointestinal symptoms in the form of diarrhea. There are many complications of AE including local and systemic infections that may develop as a result of untreated AE. In addition, due to the role of zinc in glucose metabolism, chronic zinc deficiency may pose a challenge in the control of blood glucose levels in diabetics. We report the case of a 28-year-old male with type 1 diabetes who presented with signs and symptoms of AE.

scholarly journals Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples

2020 ◽  
Vol 3 (2) ◽  
pp. 48-53
Author(s):  
Hindah Sabrina Amin ◽  
Miftahul Mushlih
Keyword(s):  
Diabetes Mellitus ◽  
Nadh Dehydrogenase ◽  
Insulin Production ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
The Family ◽  
Impaired Insulin ◽  
Mitochondrial Genotype ◽  
Mitochondrial Nd1

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.

scholarly journals ROLE OF FAMILY IN IMPLEMENTATION OF DIABETES EXERCISE IN TYPE 2 DIABETES MELITUS PATIENTS

2018 ◽  
Vol 7 (2) ◽  
pp. 152-157
Author(s):  
Lono Wijayanti
Keyword(s):  
Diabetes Mellitus ◽  
Type 2 Diabetes ◽  
Blood Glucose ◽  
Health Center ◽  
Family Members ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
The Family

Introduction: Diabetes mellitus is a group of metabolic diseases characterized by an increase in blood glucose levels (hyperglycemia), which occurs due to abnormal insulin secretion, insulin activity and both (Brunner & Suddarth, 2014). The role of the family is needed for diabetics related to well-being and health where the family environment is a place for individuals to learn for life (Friedman, 2010). The role of the family is the most powerful indicator in giving a positive impact on the implementation of diabetes exercise which acts as a glicemic control which is controlling and regulating blood sugar levels.Objective: The aim of the study was to describe the role of families in implementing diabetes exercise in type 2 Diabetes Mellitus (DM) patients at Gayungan Health Center, Dukuh Menanggal, Surabaya.Method: The design of this study used descriptive research. The population is all families who have family members with diabetes mellitus cases with a large sample of 4O people. Sampling using the Total sampling technique The variables studied were the role of family in implementing diabetes exercise. Data collection is done by distributing questionnaires.Results: The results of the study showed that of the 40 respondents in the Gayungan Community Health Center working area in Dukuh Menanggal dated 40% the role of good family, 32.5% was sufficient, 27.5 was lacking in supporting the implementation of diabetes exerciseConclusion: The family role of almost half is in the good category. The family should play an active role in the management of diabetes exercises in family members who suffer from diabetes mellitus so that blood glucose levels can be controlled properly. Keywords: The role of the family, diabetes exercise, diabetes mellitus.

scholarly journals Analysis of Health Education and Nursing Effect of Diabetic Patients Based on Clinical Path

2020 ◽  
Vol 9 (1) ◽  
pp. 6
Author(s):  
Yun Yang
Keyword(s):  
Blood Glucose ◽  
Health Education ◽  
Clinical Pathways ◽  
Study Groups ◽  
Control Group ◽  
Diabetic Patients ◽  
Study Group ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Patients With Diabetes

<p>Objective: To explore the nursing effect of health education based on clinical pathways on patients with diabetes. Methods: 80 patients with diabetes participated in the study, and the consultation period was from February 2019 to February 2020. In this study, patients were first divided into control and study groups, and then different health education methods were implemented. The control group was routine health education and nursing, and the patients in the study group were based on clinical pathways for health education and nursing. Observation indicators for statistics of two groups of patients include: Blood glucose levels before and after nursing, and satisfaction with nursing to achieve the purpose of analyzing the effects of health education nursing measures. Results: The differences in blood glucose levels between the groups before nursing were small (P＞0.05), and all improved after the nursing, and the improvement degree of the research group was better than that of the control group (P＜0.05); the satisfaction of the control group and the study group on nursing were 75% (30/40) and 97.5% (39/40), respectively, and the study group was significantly higher (P &lt; 0.05). Conclusion: For the health education and nursing of diabetic patients, the implementation based on the clinical path has ideal value, so it can be applied.</p>

scholarly journals Visiting Bitter Gourd (Momordica charantia) from a Breeding Perspective: A Review

2020 ◽  
Author(s):  
Hari Kesh ◽  
Prashant Kaushik
Keyword(s):  
Abiotic Stresses ◽  
Essential Role ◽  
Bitter Gourd ◽  
Biotic And Abiotic Stresses ◽  
Early Maturity ◽  
Breeding Programs ◽  
Know How ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
The Family

Bitter gourd is an important vegetable of the family Cucurbitaceae, cultivated mainly in humid and subtropical Asia. Bitter gourd is vegetable with immense health benefits due to the presence of medicinal compounds such as charatin, vicine, and polypeptide-p, which play an essential role in lessening the blood glucose levels. Moreover, bitter gourd fruits are particularly rich in vitamin C, minerals, and carotenes. Here, an effort has been made to critically evaluate the extent of achievements during the enhancement and enactment of bitter gourd breeding programs with the use of latest technologies. Broadening of the genetic base of cultivated bitter groud varieties as a result of enrichment of the existing resources by using the wild species in the breeding programs. Practical seed production technological know-how along with the use of the MS system (male sterility)/chemical-induced sterility procedure is nonetheless vital to cope up with the market demands. Superior yielding bitter gourd hybrids combining early maturity and resistance to biotic and abiotic stresses are regularly needed to cope up with the challenge of bitter gourd production.

scholarly journals PERAN INFORMAL KELUARGA DALAM PENGENDALIAN KADAR GLUKOSA DARAH PADA PENDERITA DIABETES MELLITUS

2018 ◽  
Vol 1 (2) ◽  
pp. 5
Author(s):  
Rosalina Rosalina
Keyword(s):  
Diabetes Mellitus ◽  
Blood Glucose ◽  
Blood Sugar ◽  
Blood Glucose Control ◽  
Bivariate Analysis ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
The Family ◽  
Sugar Levels

Diabetes mellitus is a disease or disorder of chronic metabolism with multiethiology characterized by high blood sugar (hyperglycemia). Diabetes Mellitus can not be cured but can be controlled by regulating blood sugar levels. One important factor in controlling blood sugar levels is the role of the family To know the correlation between family's informal role and the control of blood glucose levels in people with diabetes mellitus at RSUD Ungaran Semarang Regency.The design of this study was descriptive correlational with cross sectional approach with the number of population of 176 people and samples of 64 respondents by using accidental sampling method. Data collection tools used questionnaires. Data analysis used SPSS version 23.0. Bivariate analysis was processed by using chi square test. The informal role of the family in people with diabetes mellitus is mostly in good category (75.0%). Control of blood glucose level in people with diabetes mellitus is mostly in good category (62,5%). There is significant correlation between family informal role and blood glucose control in patients with diabetes mellitus at RSUD Ungaran Semarang Regency, with p value 0,043 <0,05 (α). There is correlation between family's informal role and the control of blood glucose levels in people with diabetes mellitus at RSUD Ungaran Semarang Regency.We recommend that patients with DM further improve the control of blood glucose levels by increasing the role of the family so as to prevent the occurrence of complications

scholarly journals Study on the Nursing Effect of Diabetes Health Education Nursing Methods Applied to Diabetes Patients in the Endocrinology Department

2022 ◽  
Vol 2022 ◽  
pp. 1-5
Author(s):  
Jianhua Wang ◽  
Yanan Zhao ◽  
Fei Xie
Keyword(s):  
Health Education ◽  
Diabetes Education ◽  
Routine Care ◽  
Control Group ◽  
Diabetic Patients ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Regular Care ◽  
Patients With Diabetes ◽  
Experimental Group

The aim of this study was to explore the nursing effect of diabetes education and nursing methods applied to diabetic patients in the endocrinology department. From October 2019 to October 2020, 90 patients with diabetes who were admitted to the Department of Endocrinology in our hospital were selected as the research objects, and the medical records of all patients were retrospectively analyzed. The patients were randomly divided into two groups, 45 patients who were given regular care as the control group and 45 patients who were given the diabetes health education care model as the experimental group. Routine care was given to patients in the routine group; that is, we paid attention to the patients’ diet, medication, and blood glucose levels. The experimental group patients were given diabetes health education guidance. The nursing effect, blood sugar level, disease awareness level, occurrence of complications, and compliance of the two groups of patients were evaluated. In this study, diabetes health education was given to the experimental group of patients. The conditions of this group of patients were significantly better than those of the basic group using conventional nursing methods. Therefore, the application of diabetes health education is very effective. The recovery from the disease has positive significance.

Effects of Maternal Flaxseed Supplementation on Female Offspring of Diabetic Rats in Serum Concentration of Glucose, Insulin, and Thyroid Hormones

2019 ◽  
Vol 89 (1-2) ◽  
pp. 45-54
Author(s):  
Akemi Suzuki ◽  
André Manoel Correia-Santos ◽  
Gabriela Câmara Vicente ◽  
Luiz Guillermo Coca Velarde ◽  
Gilson Teles Boaventura
Keyword(s):  
Thyroid Hormones ◽  
High Fat Diet ◽  
Female Offspring ◽  
Flaxseed Oil ◽  
Diabetic Rats ◽  
High Fat ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Flaxseed Flour ◽  
Maternal Consumption

Abstract. Objective: This study aimed to evaluate the effect of maternal consumption of flaxseed flour and oil on serum concentrations of glucose, insulin, and thyroid hormones of the adult female offspring of diabetic rats. Methods: Wistar rats were induced to diabetes by a high-fat diet (60%) and streptozotocin (35 mg/kg). Rats were mated and once pregnancy was confirmed, were divided into the following groups: Control Group (CG): casein-based diet; High-fat Group (HG): high-fat diet (49%); High-fat Flaxseed Group (HFG): high-fat diet supplemented with 25% flaxseed flour; High-fat Flaxseed Oil group (HOG): high-fat diet, where soya oil was replaced with flaxseed oil. After weaning, female pups (n = 6) from each group were separated, received a commercial rat diet and were sacrificed after 180 days. Serum insulin concentrations were determined by ELISA, the levels of triiodothyronine (T3), thyroxine (T4) and thyroid-stimulating hormone (TSH) were determined by chemiluminescence. Results: There was a significant reduction in body weight at weaning in HG (−31%), HFG (−33%) and HOG (44%) compared to CG (p = 0.002), which became similar by the end of 180 days. Blood glucose levels were reduced in HFG (−10%, p = 0.044) when compared to CG, and there was no significant difference between groups in relation to insulin, T3, T4, and TSH after 180 days. Conclusions: Maternal severe hyperglycemia during pregnancy and lactation resulted in a microsomal offspring. Maternal consumption of flaxseed reduces blood glucose levels in adult offspring without significant effects on insulin levels and thyroid hormones.

Sign in / Sign up

Export Citation Format

Share Document