scholarly journals Frequency and Clinical Impact of WT1 Mutations in the Context of CEBPA-Mutated Acute Myeloid Leukemia

2021 ◽  
Author(s):  
Ting Wang ◽  
Haiying Hua ◽  
Zhen Wang ◽  
Biao Wang ◽  
Liujun Cao ◽  
...  
Keyword(s):  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Wilms Tumor ◽  
Clinical Impact ◽  
Newly Diagnosed ◽  
Wild Type ◽  
Free Survival ◽  
Cebpa Mutations ◽  
Few Data ◽  
Acute Myeloid

Abstract Introduction: Several studies have confirmed that mutations in the Wilms tumor 1 (WT1) gene occur in adult acute myeloid leukemia (AML). However, few data are available regarding the incidence of WT1 mutations in CEBPAmut AML and their impact. Methods: We retrospectively analyzed the frequency and clinical impact of WT1 mutations in 220 newly diagnosed AML patients with CEBPA mutations. Chromosome karyotype analysis was performed by R or G banding method and further confirmed either by fluorescence in situ hybridization (FISH) and/or by multiple reverse transcription polymerase chain reaction (multiple RT-PCR). Mutations were detected with a panel of 112 mutational genes using next-generation sequencing (NGS). FLT3-ITD, NPM1 and CEBPA mutation were detected by PCR Sanger sequencing.Results: Overall, 30 WT1 mutations were detected in 29 of the 220 patients (13.18%) screened. These mutations clustered overwhelmingly in exon 7 (16 mutations in 15 patients), but they were also detected in exon 8 (n=6) and exon 9 (n=8). WT1-mutated (WT1mut) patients presented with lower platelet counts (P=0.0481), higher WT1 expression (P=0.0371), and a negative trend with the M5 subtype (P=0.07) compared to WT wild-type (WTwt) patients. WT1 mutations were found to be significantly more frequent in AML patients with double-mutated CEBPA (CEBPAdm) than in AML patients with single-mutated CEBPA (P=0.043). Of note, the concomitant mutations in epigenetic regulators were inversely correlated with WT1 mutations (P=0.003). Patients with newly diagnosed WT1mut AML had inferior relapse-free survival, event-free survival and overall survival compared with patients with WT1wt AML (P=0.002, 0.004, and 0.010, respectively). Conclusion: Our data showed that WT1 mutations are frequently identified in CEBPAmut AML, especially in CEBPAdm AML. Patients with WT1 mutations show distinct clinical features, a spectrum of comutations, and poor prognosis compared to WT1 wild-type patients.

Intensively timed induction therapy followed by autologous or allogeneic bone marrow transplantation for children with acute myeloid leukemia or myelodysplastic syndrome: a Childrens Cancer Group pilot study.

1993 ◽  
Vol 11 (8) ◽  
pp. 1448-1457 ◽  
Author(s):  
W G Woods ◽  
N Kobrinsky ◽  
J Buckley ◽  
S Neudorf ◽  
J Sanders ◽  
...  
Keyword(s):  
Bone Marrow ◽  
Acute Myeloid Leukemia ◽  
Induction Therapy ◽  
Myeloid Leukemia ◽  
Allogeneic Bone Marrow Transplantation ◽  
Allogeneic Bone ◽  
Newly Diagnosed ◽  
Free Survival ◽  
Cancer Group ◽  
Acute Myeloid

PURPOSE Childrens Cancer Group (CCG) protocol 2861 was designed to test the feasibility of aggressively timed induction therapy followed by autologous or allogeneic bone marrow transplantation (BMT) as the sole postremission therapy for newly diagnosed children with acute myeloid leukemia (AML) or myelodysplastic syndrome (MDS). PATIENTS AND METHODS Between April 1988 and October 1989, 142 patients were eligible for study. All patients entered received a timing-intensive five-drug induction of dexamethasone, cytarabine (Ara-C), thioguanine, etoposide, and daunorubicin (DCTER) over 4 days with a second cycle administered after 6 days of rest, irrespective of hematologic status at that time. Most patients subsequently received a second two-cycle induction course. Those who achieved remission were eligible for bone marrow ablative therapy with busulfan and cyclophosphamide, followed by 4-hydroperoxy-cyclophosphamide (4-HC)-purged autologous or allogeneic BMT rescue. RESULTS One hundred eight (76%) patients achieved remission: 19 (13%) died of complications of the leukemia and/or chemotherapy, and 15 (11%) failed to achieve remission. Seventy-four patients subsequently underwent BMT with either autologous (n = 58) or allogeneic (n = 16) rescue. For patients who received autologous rescue with 4-HC-purged grafts, the actuarial disease-free survival (DFS) rate at 3 years from the day of transplant is 51%, compared with 55% for patients who received allogeneic grafts (P = .92). At 3 years, the overall actuarial survival rate for all 142 patients entered on this study is 45%, with an event-free survival (EFS) rate of 37%. Adverse prognostic factors for outcome included an elevated WBC count or the presence of CNS leukemia at the time of AML diagnosis. CONCLUSION Results suggest that aggressively timed induction therapy followed by marrow ablation and BMT rescue with either autologous or allogeneic grafts for children with newly diagnosed AML or MDS is both feasible and effective.

Etoposide and mitoxantrone in newly diagnosed acute myeloid leukemia patients with persistent leukemia after a course of induction therapy with cytarabine and idarubicin

2009 ◽  
Vol 27 (15_suppl) ◽  
pp. 7073-7073
Author(s):  
W. M. McHayleh ◽  
R. Redner ◽  
R. Sehgal ◽  
A. Raptis ◽  
M. Agha ◽  
...  
Keyword(s):  
Acute Myeloid Leukemia ◽  
Median Duration ◽  
Induction Therapy ◽  
Myeloid Leukemia ◽  
Complete Response ◽  
Newly Diagnosed ◽  
Relapse Free Survival ◽  
Free Survival ◽  
Grade 3 ◽  
Acute Myeloid

7073 Background: The goal of induction chemotherapy in acute myeloid leukemia (AML) is complete remission with restoration of normal bone marrow. If residual leukemia is present after the first course of induction therapy, patients receive a second course identical to the first or receive a non-cross resistant antileukemic regimen. Methods: In a retrospective study of adult patients with newly-diagnosed AML treated at the University of Pittsburgh Cancer Institute between December 2002 and May 2008, we evaluated the efficacy and toxicity of mitoxantrone (10 mg/m2/d) and etoposide (100 mg/m2/d), both administered intravenously within 5 days as second course therapy of patients not responding to first-course induction therapy with cytarabine and idarubicin. Univariate and multivariate associations between patient characteristics and complete response (CR) were assessed by logistic regression, with overall- and relapse-free survival estimated by Kaplan-Meier analysis. Results: 74 AML patients (mean age 56 years, range: 18–73 years) completed treatment with etoposide and mitoxantrone; 29 (39%) achieved CR. Lower CR rate was associated with unfavorable cytogenetic risk status at diagnosis and higher percent blasts prior to treatment with mitoxantrone and etoposide. Ten (14%) patients died due to infectious complications. No grade 3 or 4 hepatic toxicities were observed. One patient developed grade 3 cardiac toxicity. Median duration of neutrophil recovery following therapy in patients achieving CR was 29 days. Median overall survival was 9.0 months (95% CI 5.8–14.9 months). The 29 patients who achieved CR received postremission therapy: 16 of these eventually relapsed, while 4 others died without evidence of relapse. Median duration of relapse-free survival in these 29 patients was 11.0 months (95% CI: 9.0–19.3 months). Conclusions: Our study suggests that the combination of etoposide and mitoxantorne is an active and well-tolerated regimen as second-course therapy in newly diagnosed AML patients who have persistent leukemia after a first course of induction therapy with cytarabine and idarubicin. No significant financial relationships to disclose.

scholarly journals Clinical impact of GATA2 mutations in acute myeloid leukemia patients harboring CEBPA mutations: a study of the AML study group

Leukemia ◽  
2016 ◽  
Vol 30 (11) ◽  
pp. 2248-2250 ◽  
Author(s):  
F Theis ◽  
A Corbacioglu ◽  
V I Gaidzik ◽  
P Paschka ◽  
D Weber ◽  
...  
Keyword(s):  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Clinical Impact ◽  
Study Group ◽  
Cebpa Mutations ◽  
Acute Myeloid

Response Rate, Event-Free Survival, and Overall Survival in Newly Diagnosed Acute Myeloid Leukemia: US Food and Drug Administration Trial-Level and Patient-Level Analyses

2021 ◽  
Author(s):  
Kelly J. Norsworthy ◽  
Xin Gao ◽  
Chia-Wen Ko ◽  
E. Dianne Pulte ◽  
Jiaxi Zhou ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Strong Association ◽  
Intensive Chemotherapy ◽  
Newly Diagnosed ◽  
Event Free Survival ◽  
Free Survival ◽  
Patient Level ◽  
Acute Myeloid

PURPOSE To explore trial-level and patient-level associations between response (complete remission [CR] and CR + CR with incomplete hematologic [CRi] or platelet [CRp] recovery), event-free survival (EFS), and overall survival (OS) in newly diagnosed acute myeloid leukemia (AML) trials of intensive chemotherapy. METHODS We identified data from eight randomized, active-controlled trials of intensive chemotherapy submitted to the US Food and Drug Administration for treatment of newly diagnosed AML (N = 4,482). Associations between trial-level odds ratios (ORs) for CR and CR + CRi or CRp, and hazard ratios (HRs) for EFS and OS were analyzed using weighted linear regression models. We performed patient-level responder analyses to compare OS by response using pooled data from all studies. RESULTS In trial-level analyses, association between HR for OS and OR for CR was moderate (R2 = 0.49; 95% CI, 0.05 to 0.86), as was the association with OR for CR + CRi or CRp (R2 = 0.48; 95% CI, 0.05 to 0.99). For OS versus EFS, a strong association was observed (R2 = 0.87; 95% CI, 0.47 to 0.98) when EFS definitions were harmonized across trials using raw data. In the patient-level responder analyses, patients who achieved CR had better OS compared with CRi or CRp responders (0.73; 95% CI, 0.64 to 0.84) and nonresponders (HR, 0.33; 95% CI, 0.31 to 0.37). CONCLUSION On a trial level, there is a moderate association between OS and CR rate. A strong association between EFS and OS was observed. However, CIs were wide, and results became moderate using alternative definitions for EFS. Patient-level analyses showed CR responders have better OS compared with CRi or CRp responders and nonresponders. A therapy in newly diagnosed AML with benefit in EFS or substantial benefit in CR rate would be likely to have an OS effect.

Double, but Not Single, CEBPA mutations Define a Subgroup of Acute Myeloid Leukemia with Favorable Outcome and a Distinct Gene Expression Profile

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 141-141 ◽  
Author(s):  
Bas J. Wouters ◽  
Claudia A.J. Erpelinck-Verschueren ◽  
Bob Lowenberg ◽  
Peter J.M. Valk ◽  
Ruud Delwel
Keyword(s):  
Gene Expression ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Multivariable Analysis ◽  
Favorable Outcome ◽  
Heterozygous Mutation ◽  
Wild Type ◽  
Mutation Status ◽  
Cebpa Mutations ◽  
Acute Myeloid

Abstract Acute myeloid leukemia (AML) is a heterogeneous disease characterized by various cytogenetic and molecular abnormalities, some of which can be used as prognostic markers. Mutations in the transcription factor CCAAT/enhancer binding protein alpha (CEBPA) occur in 5–10% of AML and have consistently been associated with a favorable outcome. Three types of mutations have been described: N-terminal out-of-frame mutations, inframe mutations in the basic leucine zipper (bZIP) region, and a small variable group of remaining aberrations. Most CEBPA mutant AML cases carry two mutations, usually on different alleles (double mutant). However, there are also cases that only express a single heterozygous mutation, and thus retain a wild type allele (single mutant). It is not known whether single and double CEBPA mutations should be considered of equal biological and/or clinical importance. We applied dHPLC WAVE technology in combination with nucleotide sequencing of the entire CEBPA gene in a cohort of 598 cases of adult de novo AML. After exclusion of previously described polymorphisms, we identified 41 cases (6.9%) with at least one mutation. Of these cases, 28 carried double mutations, i.e. two different heterozygous mutations or one homozygous mutation, whereas the remaining cases carried a single heterozygous mutation. To investigate whether CEBPA mutations were associated with specific transcriptional signatures, we examined genome-wide gene expression (GEP) data of 525/598 AMLs, including 38/41 CEBPA mutant cases. Class prediction of total CEBPA mutation status based on GEP data resulted in a relatively large number of false negatives in cross-validation using the PAM algorithm (sensitivity 68%, specificity 99%). Strikingly however, all these missed cases appeared to be of the single mutant group, while the double mutants were recognized with high accuracy. In agreement, unsupervised cluster analysis of the 525 AMLs led to distinct grouping of cases with double mutations, while cases with a single heterozygous mutation did not. These observations suggested that double and single CEBPA mutant AMLs represent distinct biological entities. We next assessed the clinical relevance of this finding. In concordance with previous studies, total CEBPA mutation status associated with favorable overall survival (OS) and event-free survival (EFS) (P=0.023 and P=0.042, log rank test), which was maintained in multivariable Cox’s proportional hazards models with cytogenetic risk group, FLT3-ITD and NPM1 mutation status, age and white blood cell count (hazard ratio [HR] 0.47, 95% confidence interval [CI] 0.29–0.77; P=0.002 and HR 0.52, 95% CI 0.33–0.82; P=0.004). Surprisingly, when the double and single CEBPA mutant cases were separately analyzed, only the double mutants showed a highly favorable outcome, while the single mutants could not be distinguished from CEBPA wild type AMLs (P=0.003 versus P=0.51 (OS) and P=0.004 versus P=0.18 (EFS)). In multivariable analysis, CEBPA double mutation status remained associated with favorable outcome (OS HR 0.31, 95% CI 0.16–0.59; P<0.001, and EFS HR 0.34; 95% CI 0.19–0.61; P<0.001), contrasting with the single mutants (HR 1.18, 95% CI 0.58–2.41; P=0.64 and HR 1.65, 95% CI 0.84–3.23; P=0.15). Similarly, in multivariable analysis in the selected normal karyotype subset (n=193), CEBPA double mutations, but not single mutations, were significantly associated with OS (P=0.026 versus P=0.24) and EFS (P=0.013 versus P=0.42). In conclusion, these data demonstrate the existence of distinct transcriptional and clinical characteristics of AML cases with double CEBPA mutations and imply that it is crucial to discriminate them from single mutants to identify those patients with a favorable prognosis.

scholarly journals Lenalidomide-mediated enhanced translation of C/EBPα-p30 protein up-regulates expression of the antileukemic microRNA-181a in acute myeloid leukemia

Blood ◽  
2013 ◽  
Vol 121 (1) ◽  
pp. 159-169 ◽  
Author(s):  
Christopher J. Hickey ◽  
Sebastian Schwind ◽  
Hanna S. Radomska ◽  
Adrienne M. Dorrance ◽  
Ramasamy Santhanam ◽  
...  
Keyword(s):  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Wild Type ◽  
Regulatory Pathway ◽  
Protein Levels ◽  
Transactivation Activity ◽  
Improved Outcomes ◽  
Increased Sensitivity ◽  
Cebpa Mutations ◽  
Acute Myeloid

Abstract Recently, we showed that increased miR-181a expression was associated with improved outcomes in cytogenetically normal acute myeloid leukemia (CN-AML). Interestingly, miR-181a expression was increased in CN-AML patients harboring CEBPA mutations, which are usually biallelic and associate with better prognosis. CEBPA encodes the C/EBPα transcription factor. We demonstrate here that the presence of N-terminal CEBPA mutations and miR-181a expression are linked. Indeed, the truncated C/EBPα-p30 isoform, which is produced from the N-terminal mutant CEBPA gene or from the differential translation of wild-type CEBPA mRNA and is commonly believed to have no transactivation activity, binds to the miR-181a-1 promoter and up-regulates the microRNA expression. Furthermore, we show that lenalidomide, a drug approved for myelodysplastic syndromes and multiple myeloma, enhances translation of the C/EBPα-p30 isoform, resulting in higher miR-181a levels. In xenograft mouse models, ectopic miR-181a expression inhibits tumor growth. Similarly, lenalidomide exhibits antitumorigenic activity paralleled by increased miR-181a expression. This regulatory pathway may explain an increased sensitivity to apoptosis-inducing chemotherapy in subsets of AML patients. Altogether, our data provide a potential explanation for the improved clinical outcomes observed in CEBPA-mutated CN-AML patients, and suggest that lenalidomide treatment enhancing the C/EBPα-p30 protein levels and in turn miR-181a may sensitize AML blasts to chemotherapy.

scholarly journals PTPN11 mutations and Outcomes in Adult Patients with Acute Myeloid Leukemia

Blood ◽  
2020 ◽  
Vol 136 (Supplement 1) ◽  
pp. 4-5
Author(s):  
Klaus H. Metzeler ◽  
Maja Rothenberg-Thurley ◽  
Dennis Görlich ◽  
Maria Cristina Sauerland ◽  
Annika Maria Dufour ◽  
...  
Keyword(s):  
Acute Myeloid Leukemia ◽  
Genetic Risk ◽  
Myeloid Leukemia ◽  
Research Funding ◽  
Risk Group ◽  
Newly Diagnosed ◽  
Wild Type ◽  
Prognostic Relevance ◽  
Multivariable Models ◽  
Acute Myeloid

Background: Mutations in the protein tyrosine phosphatase gene PTPN11 (also known as SHP2) are found in approximately 10% of adult patients with acute myeloid leukemia (AML). A recent study reported that mutated PTPN11 associates with inferior response rates and shorter survival among intensively treated AML patients, independently of the ELN prognostic groups (Alfayez et al., Leukemia 2020). Earlier analyses of the genomic landscape of AML did not uncover a similar prognostic relevance of PTPN11 mutations. Therefore, our aim was to clarify the prognostic relevance of mutated PTPN11 variants in AML patients receiving intensive front-line therapy. Patients and Methods: We studied 1116 AML patients enrolled on two subsequent multicenter phase III trials of the German AML Cooperative Group (AML-CG 1999, NCT00266136; and AML-CG 2008, NCT01382147) who were genetically characterized by amplicon-based targeted next-generation sequencing (Herold et al., Leukemia 2020). All patients had received induction chemotherapy containing cytarabine and daunorubicin or mitoxantrone. Results: We identified 146 PTPN11 mutations in 114 of 1116 patients (10%). Mutations clustered in two hotspot regions (5': codons 52-79; n=108 and 3': codons 491-512, n=38) as previously reported. Associations of PTPN11 mutations with baseline clinical and genetic patient characteristics are shown in Figure A. PTPN11 mutations were most frequent in the European LeukemiaNet (ELN) "favorable" genetic risk group, and associated with higher leukocyte counts. Patients with mutated PTPN11more commonly had mutated NPM1, IDH1 and DNMT3A, and less frequently had FLT3-ITD, IDH2 and TP53 mutations, compared to patients with wild-type PTPN11. With regard to treatment outcomes, the rate of complete remission was similar among patients with mutated and wild-type PTPN11 (65% vs. 59%, P=.25). In univariate analyses, PTPN11-mutated patients had significantly longer relapse-free survival (RFS; 5-year estimate, 55% vs 33% for PTPN11-wild type patients; P=.001; Figure B) and tended to have longer overall survival (OS; 5-year estimate, 43% vs 32%; P=.06; Figure C). However, in multivariable models adjusting for age, sex, leukocyte count, AML type (de novo/sAML/tAML) and ELN-2017 genetic risk group, mutated PTPN11 no longer associated with RFS (hazard ratio [HR], 0.89, 95% confidence interval [CI], 0.63 - 1.27; P=0.53) or OS (HR, 1.03; 95% CI, 0.80 - 1.33; P=.79). Moreover, PTPN11 mutations did not significantly associate with RFS or OS within any of the ELN genetic risk groups. Finally, we detected no significant differences in baseline characteristics or outcomes between patients with PTPN11 mutations affecting the 5' hotspot region (n=82), the 3' hotspot region (n=21), or mutations at both hotspots (n=11). Conclusion: In our cohort of newly diagnosed and intensively treated AML patients, mutations in PTPN11 occurred in 10% and associated with prognostically favorable genetic characteristics such as mutated NPM1 and absence of FLT3-ITD and TP53mutations. Consequently, PTPN11 mutations were most commonly found within the ELN-2017 favorable risk category. While patients with PTPN11 mutations had relatively favorable survival outcomes, multivariable models suggest this observation is confounded by the frequent co-occurrence of known favorable genetic markers. Our data are in disagreement with a recently published study on 880 newly diagnosed patients that found an unfavourable prognostic impact of mutated PTPN11, particularly among the 410 patients who received intensive treatment. Possible explanations for these discrepant results include differences in treatment regimens between the two cohorts, as well as the play of chance when studying a relatively rare gene mutation in medium-sized cohorts. In summary, our data do not support a role of PTPN11 mutations as an adverse prognostic biomarker in newly diagnosed, intensively treated adult AML patients. Figure Disclosures Metzeler: Daiichi Sankyo: Honoraria; Otsuka Pharma: Consultancy; Pfizer: Consultancy; Celgene: Consultancy, Honoraria, Research Funding; Novartis: Consultancy; Jazz Pharmaceuticals: Consultancy; Astellas: Honoraria. Subklewe:AMGEN: Consultancy, Honoraria, Research Funding; Celgene: Consultancy, Honoraria; Pfizer: Consultancy, Honoraria; Novartis: Consultancy, Research Funding; Janssen: Consultancy; Morphosys: Research Funding; Seattle Genetics: Research Funding; Roche AG: Consultancy, Research Funding; Gilead Sciences: Consultancy, Honoraria, Research Funding.

scholarly journals Using Circ-ANAPC7 As a Novel Type of Biomarker in the Monitoring of Acute Myeloid Leukemia

Blood ◽  
2019 ◽  
Vol 134 (Supplement_1) ◽  
pp. 5179-5179
Author(s):  
Ying Shen ◽  
Yachun Jia ◽  
Ru Zhang ◽  
Hongli Chen ◽  
Yuandong Feng ◽  
...  
Keyword(s):  
Bone Marrow ◽  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Expression Level ◽  
Circular Rnas ◽  
Newly Diagnosed ◽  
Free Survival ◽  
Non Coding Rnas ◽  
Acute Myeloid

Introduction: Acute myeloid leukemia (AML) is a heterogeneous disease characterized by the clonal proliferation of immature myeloid progenitor cells in the bone marrow, compressing normal blood cell production and leading to bone marrow failure ultimately. Overwhelming evidence has established that non-coding RNAs (ncRNAs), such as long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) have great role in AML pathogenesis. Circular RNAs (circRNAs) that occupy gene expression at the transcriptional or post-transcriptional level have great potential to be biomarker for types of cancers. We have screened one altered circRNA named circ-ANAPC7 in AML before. In this study, we aimed to validate its expression by enlarging sample size and illuminating the diagnostic and monitoring value of circ-ANAPC7 in AML. Methods: Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was supposed to confirm the expression of circ-ANAPC7 of AML patients. The sequences of circ-ANAPC7 primers were as follows: 5′- GGGAGCAGCACTTAGGAACAT -3′ (sense) and 5′-AAAGCTGGTACTTCTGAGGTGG-3′ (antisense). Receiver operating characteristic (ROC) curve was carried out to evaluate the diagnostic value. Overall survival rate and event-free survival rate were estimated by the Kplan-Meier analysis and compared using the log-rank test. All tests were two-sided, and P < 0.05 was defined as a significant difference. Results: The expression level of circ-ANAPC7 in newly diagnosed AML was significantly higher than CR patients and iron deficiency anemia (IDA) control group (P < 0.001) (Figure 1A). Furthermore, we chose 24 AML patients who undergo the condition of newly diagnosed AML, CR and relapse to dynamical monitor the expression of circ-ANAPC7. We discovered that circ-ANAPC7 expression level changed accompanied with the disease condition transformation. It was high expressed in newly diagnosed and relapsed AML patients. When patients got CR, the expression level of circ-ANAPC7 decreased (P < 0.05). In the continuous CR patients, it remained in a minimal level (Figure 1C). ROC curve analysis revealed that circ-ANAPC7 has significant value of AML diagnosis (AUC = 0.915, P < 0.001) (Figure 1B). Moreover, we conducted survival analysis to explore long-term effect of circ-ANAPC7 expression in AML patients. The result revealed that circ-ANAPC7 expression was not related to overall survival (OS) and disease-free survival (DFS) of AML patients (P > 0.05) (Figure 1D). Conclusions: We validated that circ-ANAPC7 was upregulated in AML patients. The clinical analysis revealed that circ-ANAPC7 may be a predictive index for diagnosing and supervising early recurrence of AML. What's more, additional molecular mechanisms and biological functions of circ-ANAPC7 merit deeper investigation. Figure 1 Disclosures No relevant conflicts of interest to declare.

scholarly journals Wilms Tumor 1 Mutations Are Independent Poor Prognostic Factors in Pediatric Acute Myeloid Leukemia

2021 ◽  
Vol 11 ◽  
Author(s):  
Yin Wang ◽  
Wen-Jun Weng ◽  
Dun-Hua Zhou ◽  
Jian-Pei Fang ◽  
Srishti Mishra ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Prognostic Factors ◽  
Myeloid Leukemia ◽  
Wilms Tumor ◽  
Event Free Survival ◽  
Free Survival ◽  
Wilms Tumor 1 ◽  
Pediatric Aml ◽  
Acute Myeloid

The prognostic impact of Wilms tumor 1 (WT1) mutations remains controversial for patients with acute myeloid leukemia (AML). Here, we aimed to determine the clinical implication of WT1 mutations in a large cohort of pediatric AML. The clinical data of 870 pediatric patients with AML were downloaded from the therapeutically applicable research to generate effective treatment (TARGET) dataset. We analyzed the prevalence, clinical profile, and prognosis of AML patients with WT1 mutations in this cohort. Our results showed that 6.7% of total patients harbored WT1 mutations. These WT1 mutations were closely associated with normal cytogenetics (P&lt;0.001), FMS-like tyrosine kinase 3/internal tandem duplication (FLT3/ITD) mutations (P&lt;0.001), and low complete remission induction rates (P&lt;0.01). Compared to the patients without WT1 mutations, patients with WT1 mutations had a worse 5-year event-free survival (21.7 ± 5.5% vs 48.9 ± 1.8%, P&lt;0.001) and a worse overall survival (41.4 ± 6.6% vs 64.3 ± 1.7%, P&lt;0.001). Moreover, patients with both WT1 and FLT3/ITD mutations had a dismal prognosis. Compared to chemotherapy alone, hematopoietic stem cell transplantation tended to improve the prognoses of WT1-mutated patients. Multivariate analysis demonstrated that WT1 mutations conferred an independent adverse impact on event-free survival (hazard ratio 1.910, P = 0.001) and overall survival (hazard ratio 1.709, P = 0.020). In conclusion, our findings have demonstrated that WT1 mutations are independent poor prognostic factors in pediatric AML.

scholarly journals Gemtuzumab Ozogamicin in Children and Adolescents With De Novo Acute Myeloid Leukemia Improves Event-Free Survival by Reducing Relapse Risk: Results From the Randomized Phase III Children's Oncology Group Trial AAML0531

2014 ◽  
Vol 32 (27) ◽  
pp. 3021-3032 ◽  
Author(s):  
Alan S. Gamis ◽  
Todd A. Alonzo ◽  
Soheil Meshinchi ◽  
Lillian Sung ◽  
Robert B. Gerbing ◽  
...  
Keyword(s):  
Acute Myeloid Leukemia ◽  
Children And Adolescents ◽  
Myeloid Leukemia ◽  
Gemtuzumab Ozogamicin ◽  
Newly Diagnosed ◽  
Oncology Group ◽  
Event Free Survival ◽  
Free Survival ◽  
Group Trial ◽  
Acute Myeloid

Purpose To improve survival rates in children with acute myeloid leukemia (AML), we evaluated gemtuzumab-ozogamicin (GO), a humanized immunoconjugate targeted against CD33, as an alternative to further chemotherapy dose escalation. Our primary objective was to determine whether adding GO to standard chemotherapy improved event-free survival (EFS) and overall survival (OS) in children with newly diagnosed AML. Our secondary objectives examined outcomes by risk group and method of intensification. Patients and Methods Children, adolescents, and young adults ages 0 to 29 years with newly diagnosed AML were enrolled onto Children's Oncology Group trial AAML0531 and then were randomly assigned to either standard five-course chemotherapy alone or to the same chemotherapy with two doses of GO (3 mg/m2/dose) administered once in induction course 1 and once in intensification course 2 (two of three). Results There were 1,022 evaluable patients enrolled. GO significantly improved EFS (3 years: 53.1% v 46.9%; hazard ratio [HzR], 0.83; 95% CI, 0.70 to 0.99; P = .04) but not OS (3 years: 69.4% v 65.4%; HzR, 0.91; 95% CI, 0.74 to 1.13; P = .39). Although remission was not improved (88% v 85%; P = .15), posthoc analyses found relapse risk (RR) was significantly reduced among GO recipients overall (3 years: 32.8% v 41.3%; HzR, 0.73; 95% CI, 0.58 to 0.91; P = .006). Despite an increased postremission toxic mortality (3 years: 6.6% v 4.1%; HzR, 1.69; 95% CI, 0.93 to 3.08; P = .09), disease-free survival was better among GO recipients (3 years: 60.6% v 54.7%; HzR, 0.82; 95% CI, 0.67 to 1.02; P = .07). Conclusion GO added to chemotherapy improved EFS through a reduction in RR for children and adolescents with AML.

Sign in / Sign up

Export Citation Format

Share Document