scholarly journals Multiple Camera Fluorescence Detection for Real-Time PCR

2021 ◽  
Vol 6 (1) ◽  
pp. 71
Author(s):  
Seul-Bit-Na Koo ◽  
Hyeon-Gyu Chi ◽  
Ji-Sung Park ◽  
Jong-Dae Kim ◽  
Chan-Young Park ◽  
...  
Keyword(s):  
Real Time ◽  
Fluorescence Detection ◽  
Real Time Pcr ◽  
Detection System ◽  
Low Cost ◽  
Dna Amplification ◽  
Multiple Camera ◽  
Open Platform ◽  
Polymerase Chain ◽  
Fluorescence Detection System

The general polymerase chain reaction (PCR) amplifies DNA and analyzes the amplification results of the quantified DNA. Recently, real-time PCR has been developed to detect DNA amplification in various ways. The conventional camera-based system is too expensive and difficult to reduce device size. In this paper, we propose a low-cost, compact fluorescence detection system for real-time PCR systems using an open platform camera. To simplify the optics, four low-cost small cameras were fixedly placed, and the entire tube was divided into four quadrants to minimize the field of view. In addition, an effective image processing method was used to compensate. The proposed system measured the fluorescence detection performance on the basis of the amount of DNA using various fluorescent substances.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

scholarly journals Multiple Compact Camera Fluorescence Detector for Real-Time PCR Devices

Sensors ◽  
2021 ◽  
Vol 21 (21) ◽  
pp. 7013
Author(s):  
Seul-Bit-Na Koo ◽  
Hyeon-Gyu Chi ◽  
Jong-Dae Kim ◽  
Yu-Seop Kim ◽  
Ji-Sung Park ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
High Performance ◽  
Signal To Noise Ratio ◽  
Low Cost ◽  
Optical Element ◽  
Dna Amplification ◽  
Biological Research ◽  
Fluorescence Detector ◽  
Fluorescence Excitation

The polymerase chain reaction is an important technique in biological research because it tests for diseases with a small amount of DNA. However, this process is time consuming and can lead to sample contamination. Recently, real-time PCR techniques have emerged which make it possible to monitor the amplification process for each cycle in real time. Existing camera-based systems that measure fluorescence after DNA amplification simultaneously process fluorescence excitation and emission for dozens of tubes. Therefore, there is a limit to the size, cost, and assembly of the optical element. In recent years, imaging devices for high-performance, open platforms have benefitted from significant innovations. In this paper, we propose a fluorescence detector for real-time PCR devices using an open platform camera. This system can reduce the cost, and can be miniaturized. To simplify the optical system, four low-cost, compact cameras were used. In addition, the field of view of the entire tube was minimized by dividing it into quadrants. An effective image processing method was used to compensate for the reduction in the signal-to-noise ratio. Using a reference fluorescence material, it was confirmed that the proposed system enables stable fluorescence detection according to the amount of DNA.

A low-cost 2D fluorescence detection system for μm sized beads on-chip

Lab on a Chip ◽  
2012 ◽  
Vol 12 (10) ◽  
pp. 1780 ◽  
Author(s):  
Loes I. Segerink ◽  
Maarten J. Koster ◽  
Ad J. Sprenkels ◽  
Albert van den Berg
Keyword(s):  
Fluorescence Detection ◽  
Detection System ◽  
Low Cost ◽  
On Chip ◽  
Fluorescence Detection System

scholarly journals Compact Fluorescence Detection System for Polymerase Chain Reaction Chips

2019 ◽  
Vol 31 (5) ◽  
pp. 1635
Author(s):  
Deuk-Ju Lee ◽  
Ji-Soo Hwang ◽  
Ji-Seong Park ◽  
Chan-Young Park ◽  
Hye-Jeong Song ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Fluorescence Detection ◽  
Detection System ◽  
Chain Reaction ◽  
Polymerase Chain ◽  
Fluorescence Detection System

scholarly journals An Alternative Approach to Detecting Cancer Cells by Multi-Directional Fluorescence Detection System Using Cost-Effective LED and Photodiode

Sensors ◽  
2019 ◽  
Vol 19 (10) ◽  
pp. 2301
Author(s):  
Kyoungrae Cho ◽  
Jeong-hyeok Seo ◽  
Gyeongyong Heo ◽  
Se-woon Choe
Keyword(s):  
Cancer Cells ◽  
Light Source ◽  
Fluorescence Detection ◽  
Detection System ◽  
Low Cost ◽  
Cost Effective ◽  
Flow Cytometer ◽  
Cell Counting ◽  
Fluorescence Characteristics ◽  
Fluorescence Detection System

The enumeration of cellular proliferation by covering from hemocytometer to flow cytometer is an important procedure in the study of cancer development. For example, hemocytometer has been popularly employed to perform manual cell counting. It is easily achieved at a low-cost, however, manual cell counting is labor-intensive and prone to error for a large number of cells. On the other hand, flow cytometer is a highly sophisticated instrument in biomedical and clinical research fields. It provides detailed physical parameters of fluorescently labeled single cells or micro-sized particles depending on the fluorescence characteristics of the target sample. Generally, optical setup to detect fluorescence uses a laser, dichroic filter, and photomultiplier tube as a light source, optical filter, and photodetector, respectively. These components are assembled to set up an instrument to measure the amount of scattering light from the target particle; however, these components are costly, bulky, and have limitations in selecting diverse fluorescence dyes. Moreover, they require multiple refined and expensive modules such as cooling or pumping systems. Thus, alternative cost-effective components have been intensively developed. In this study, a low-cost and miniaturized fluorescence detection system is proposed, i.e., costing less than 100 US dollars, which is customizable by a 3D printer and light source/filter/sensor operating at a specific wavelength using a light-emitting diode with a photodiode, which can be freely replaceable. The fluorescence detection system can quantify multi-directional scattering lights simultaneously from the fluorescently labeled cervical cancer cells. Linear regression was applied to the acquired fluorescence intensities, and excellent linear correlations (R2 > 0.9) were observed. In addition, the enumeration of the cells using hemocytometer to determine its performance accuracy was analyzed by Student’s t-test, and no statistically significant difference was found. Therefore, different cell concentrations are reversely calculated, and the system can provide a rapid and cost-effective alternative to commercial hemocytometer for live cell or microparticle counting.

Visual and real-time imaging focusing for highly sensitive laser-induced fluorescence detection at yoctomole levels in nanocapillaries

2020 ◽  
Vol 56 (16) ◽  
pp. 2423-2426 ◽  
Author(s):  
Wenmei Zhang ◽  
Lei Liu ◽  
Qi Zhang ◽  
Dongtang Zhang ◽  
Qin Hu ◽  
...  
Keyword(s):  
Real Time ◽  
Fluorescence Detection ◽  
Detection System ◽  
Laser Induced Fluorescence ◽  
Real Time Imaging ◽  
Laser Induced Fluorescence Detection ◽  
Highly Sensitive ◽  
Fluorescence Detection System

We developed a highly sensitive laser-induced fluorescence detection system, involving visual and real-time imaging focusing instead of the use of fluorescent reagents, for the detection of analytes in nanocapillaries.

scholarly journals Perbandingan deteksi Plasmodium falciparum dengan metode pemeriksaan mikroskopik dan teknik real-time polymerase chain reaction

2016 ◽  
Vol 4 (1) ◽  
Author(s):  
Elril T. Langi ◽  
Janno B. B. Bernadus ◽  
Greta J. P. Wahongan
Keyword(s):  
Polymerase Chain Reaction ◽  
Plasmodium Falciparum ◽  
Real Time ◽  
Real Time Pcr ◽  
Gold Standard ◽  
Dna Amplification ◽  
World Health ◽  
Chain Reaction ◽  
Blood Samples ◽  
Polymerase Chain

Abstract: Plasmodium falciparum is one of the species of parasites causing tropical malaria disease. Plasmodium falciparum was reported as often being the major source of pain and even death in most cases. The data released by WHO shows that, globally, 198 millions of malaria cases occurred in 2013 with 548 thousands as cause of death. Microscopic examination is a gold standard for detecting Plasmodium falciparum. Although this method has certain limitations in diagnosing complication infection, phases of parasitemia, and also the capability of laboratory's medical staff factor. Nowadays, there has been innovation in biomolecular department, that is examination using PCR which can accurately detect the plasmodium, due to the DNA amplification. This method however, has not often used by doctors in diagnose malaria disease. The aim of this research is to determine the comparison of malaria detection using microscopic verification of plasmodium falciparum with real-time PCR verification. The method used in this research is diagnostic with 35 blood samples of patient suffering malaria disease. The blood samples from patient's vena were then divided into thick and thin microscopic sample, and some were putted into EDTA tube for DNA extraction in the laboratory using real-time PCR verification. The result of this research shown that sensitivity and specificity rate of PCR is 100% accurate. Conclusion: detection result of plasmodium falciparum using real-time PCR verification produced equal result as microscopic verification.Keywords: Plasmodium falciparum, Microscopic method, Real-time Polymerase Chain Reaction (PCR)Abstrak: Plasmodium falciparum adalah salah satu spesies parasit penyebab penyakit malaria, yaitu malaria tropika. Plasmodium falciparum dilaporkan sebagai spesies yang paling banyak menyebabkan angka kesakitan dan kematian pada manusia akibat penyakit malaria. World Health Organization (WHO) melaporkan secara global, diperkirakan 198 juta kasus malaria terjadi secara keseluruhan pada tahun 2013 dan menyebabkan 584 ribu kematian. Pemeriksaan mikroskopik adalah pemeriksaan gold standard untuk mendeteksi Plasmodium falciparum. Namun pemeriksaan ini memiliki keterbatasan dalam hal mendiagnosis infeksi campuran, infeksi dengan keadaan parasitemia, dan tidak terlatihnya tenaga kesehatan laboratorium. Saat ini dalam bidang biomolekuler telah dikembangkan pemeriksaan real-time polymerase chain reaction (PCR) yang akurat untuk mendeteksi plasmodium, karena didasarkan pada amplifikasi DNA plasmodium, namun pemeriksaan ini belum rutin digunakan untuk mendiagnosis malaria. Penelitian ini bertujuan untuk mengetahui perbandingan deteksi Plasmodium falciparum dengan pemeriksaan mikroskopik dan pemeriksaan real-time PCR. Metode penelitian ini ialah uji diagnostik. Sampel pada penelitian ini yaitu 35 sampel darah pasien suspek malaria. Sampel darah vena yang diambil langsung dibuat sedian darah tipis dan sediaan darah tebal untuk diperiksa di mikroskop, sedangkan darah yang tersisa dimasukkan dalam tabung EDTA, dan dibawa ke Laboratorium untuk dibuat ekstraksi DNA dan dilanjutkan dengan pemeriksaan real-time PCR. Hasil penelitian menunjukkan tingkatsensitivitas dan spesifisitas real-time PCR sebesar 100%. Simpulan: Hasil deteksi Plasmodium falciparum dengan pemeriksaan real-time PCR memiliki efektivitas yang setara dengan metode pemeriksaan mikroskopik sebagai gold standart.Kata kunci: Plasmodium falciparum, Pemeriksaan Mikroskopik, Real-time Polymerase Chain Reaction (PCR)

scholarly journals Portable and Battery-Powered PCR Device for DNA Amplification and Fluorescence Detection

Sensors ◽  
2020 ◽  
Vol 20 (9) ◽  
pp. 2627
Author(s):  
Junyao Jie ◽  
Shiming Hu ◽  
Wenwen Liu ◽  
Qingquan Wei ◽  
Yizheng Huang ◽  
...  
Keyword(s):  
Control System ◽  
Fluorescence Detection ◽  
Detection System ◽  
Pcr Amplification ◽  
Dna Amplification ◽  
Thermal Control ◽  
Nucleic Acid Amplification ◽  
Oxide Semiconductor ◽  
Thermal Control System ◽  
Fluorescence Detection System

Polymerase chain reaction (PCR) is a technique for nucleic acid amplification, which has been widely used in molecular biology. Owing to the limitations such as large size, high power consumption, and complicated operation, PCR is only used in hospitals or research institutions. To meet the requirements of portable applications, we developed a fast, battery-powered, portable device for PCR amplification and end-point detection. The device consisted of a PCR thermal control system, PCR reaction chip, and fluorescence detection system. The PCR thermal control system was formed by a thermal control chip and external drive circuits. Thin-film heaters and resistance temperature detectors (RTDs) were fabricated on the thermal control chip and were regulated with external drive circuits. The average heating rate was 32 °C/s and the average cooling rate was 7.5 °C/s. The disposable reaction chips were fabricated using a silicon substrate, silicone rubber, and quartz plate. The fluorescence detection system consisted a complementary metal-oxide-semiconductor (CMOS) camera, an LED, and mirror units. The device was driven by a 24 V Li-ion battery. We amplified HPV16E6 genomic DNA using our device and achieved satisfactory results.

Sign in / Sign up

Export Citation Format

Share Document