scholarly journals Genetic Regulatory Networks of Apolipoproteins and Associated Medical Risks

2022 ◽  
Vol 8 ◽  
Author(s):  
Preethi Basavaraju ◽  
Rubadevi Balasubramani ◽  
Divya Sri Kathiresan ◽  
Ilakkiyapavai Devaraj ◽  
Kavipriya Babu ◽  
...  
Keyword(s):  
Genetic Polymorphisms ◽  
Regulatory Networks ◽  
Vascular Complications ◽  
Genetic Regulatory Networks ◽  
The Body ◽  
Nucleotide Polymorphisms ◽  
Base Pairs ◽  
Disease Heterogeneity ◽  
Single Nucleotide ◽  
Genetic Risks

Apolipoproteins (APO proteins) are the lipoprotein family proteins that play key roles in transporting lipoproteins all over the body. There are nearly more than twenty members reported in the APO protein family, among which the A, B, C, E, and L play major roles in contributing genetic risks to several disorders. Among these genetic risks, the single nucleotide polymorphisms (SNPs), involving the variation of single nucleotide base pairs, and their contributing polymorphisms play crucial roles in the apolipoprotein family and its concordant disease heterogeneity that have predominantly recurred through the years. In this review, we have contributed a handful of information on such genetic polymorphisms that include APOE, ApoA1/B ratio, and A1/C3/A4/A5 gene cluster-based population genetic studies carried throughout the world, to elaborately discuss the effects of various genetic polymorphisms in imparting various medical conditions, such as obesity, cardiovascular, stroke, Alzheimer's disease, diabetes, vascular complications, and other associated risks.

scholarly journals Structural Characterization of Carbonic Anhydrase VIII and Effects of Missense Single Nucleotide Variations to Protein Structure and Function

2020 ◽  
Vol 21 (8) ◽  
pp. 2764
Author(s):  
Taremekedzwa Allan Sanyanga ◽  
Özlem Tastan Bishop
Keyword(s):  
Carbonic Anhydrase ◽  
Binding Site ◽  
Cross Correlation ◽  
Structure And Function ◽  
The Body ◽  
Conformational Sampling ◽  
Nucleotide Polymorphisms ◽  
Ip3 Receptor ◽  
Single Nucleotide ◽  
And Function

Human carbonic anhydrase 8 (CA-VIII) is an acatalytic isoform of the α -CA family. Though the protein cannot hydrate CO2, CA-VIII is essential for calcium (Ca2+) homeostasis within the body, and achieves this by allosterically inhibiting the binding of inositol 1,4,5-triphosphate (IP3) to the IP3 receptor type 1 (ITPR1) protein. However, the mechanism of interaction of CA-VIII to ITPR1 is not well understood. In addition, functional defects to CA-VIII due to non-synonymous single nucleotide polymorphisms (nsSNVs) result in Ca2+ dysregulation and the development of the phenotypes such as cerebellar ataxia, mental retardation and disequilibrium syndrome 3 (CAMRQ3). The pathogenesis of CAMRQ3 is also not well understood. The structure and function of CA-VIII was characterised, and pathogenesis of CAMRQ3 investigated. Structural and functional characterisation of CA-VIII was conducted through SiteMap and CPORT to identify potential binding site residues. The effects of four pathogenic nsSNVs, S100A, S100P, G162R and R237Q, and two benign S100L and E109D variants on CA-VIII structure and function was then investigated using molecular dynamics (MD) simulations, dynamic cross correlation (DCC) and dynamic residue network (DRN) analysis. SiteMap and CPORT analyses identified 38 unique CA-VIII residues that could potentially bind to ITPR1. MD analysis revealed less conformational sampling within the variant proteins and highlighted potential increases to variant protein rigidity. Dynamic cross correlation (DCC) showed that wild-type (WT) protein residue motion is predominately anti-correlated, with variant proteins showing no correlation to greater residue correlation. DRN revealed variant-associated increases to the accessibility of the N-terminal binding site residues, which could have implications for associations with ITPR1, and further highlighted differences to the mechanism of benign and pathogenic variants. SNV presence is associated with a reduction to the usage of Trp37 in all variants, which has implications for CA-VIII stability. The differences to variant mechanisms can be further investigated to understand pathogenesis of CAMRQ3, enhancing precision medicine-related studies into CA-VIII.

scholarly journals Structural and Functional Features of the P2X4 Receptor: An Immunological Perspective

2021 ◽  
Vol 12 ◽  
Author(s):  
Jean M. Kanellopoulos ◽  
Cássio Luiz Coutinho Almeida-da-Silva ◽  
Sirje Rüütel Boudinot ◽  
David M. Ojcius
Keyword(s):  
Plasma Membrane ◽  
P2y Receptors ◽  
Potential Interaction ◽  
The Body ◽  
Extracellular Nucleotides ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Functional Features ◽  
G Protein Coupled

Extracellular nucleotides are important mediators of activation, triggering various responses through plasma membrane P2 and P1 receptors. P2 receptors are further subdivided into ionotropic P2X receptors and G protein-coupled P2Y receptors. P2X4 is an ATP-gated cation channel broadly expressed in most tissues of the body. Within the P2X family, P2X4 has a unique subcellular distribution, being preferentially localized in lysosomes. In these organelles, high ATP concentrations do not trigger P2X4 because of the low pH. However, when the pH increases to 7.4, P2X4 can be stimulated by intra-lysosomal ATP, which is in its active, tetra-anionic form. Elucidation of P2X4, P2X3 and P2X7 structures has shed some light on the functional differences between these purinergic receptors. The potential interaction between P2X4 and P2X7 has been extensively studied. Despite intensive effort, it has not been possible yet to determine whether P2X4 and P2X7 interact as heterotrimers or homotrimers at the plasma membrane. However, several publications have shown that functional interactions between P2X4 and P2X7 do occur. Importantly, these studies indicate that P2X4 potentiates P2X7-dependent activation of inflammasomes, leading to increased release of IL-1β and IL-18. The role of P2X4 in various diseases could be beneficial or deleterious even though the pathophysiological mechanisms involved are still poorly defined. However, in diseases whose physiopathology involves activation of the NLRP3 inflammasome, P2X4 was found to exacerbate severity of disease. The recent production of monoclonal antibodies specific for the human and mouse P2X4, some of which are endowed with agonist or antagonist properties, raises the possibility that they could be used therapeutically. Analysis of single nucleotide polymorphisms of the human P2RX4 gene has uncovered the association of P2RX4 gene variants with susceptibility to several human diseases.

scholarly journals Transposable elements contribute to the genomic response to insecticides in Drosophila melanogaster

2020 ◽  
Vol 375 (1795) ◽  
pp. 20190341 ◽  
Author(s):  
Judit Salces-Ortiz ◽  
Carlos Vargas-Chavez ◽  
Lain Guio ◽  
Gabriel E. Rech ◽  
Josefa González
Keyword(s):  
Gene Expression ◽  
Drosophila Melanogaster ◽  
Regulatory Networks ◽  
Regulation Of Gene Expression ◽  
Nucleotide Polymorphisms ◽  
Rna Seq ◽  
Organophosphate Insecticide ◽  
Single Nucleotide ◽  
Insecticide Exposure ◽  
Genomic Response

Most of the genotype–phenotype analyses to date have largely centred attention on single nucleotide polymorphisms. However, transposable element (TE) insertions have arisen as a plausible addition to the study of the genotypic–phenotypic link because of to their role in genome function and evolution. In this work, we investigate the contribution of TE insertions to the regulation of gene expression in response to insecticides. We exposed four Drosophila melanogaster strains to malathion, a commonly used organophosphate insecticide. By combining information from different approaches, including RNA-seq and ATAC-seq, we found that TEs can contribute to the regulation of gene expression under insecticide exposure by rewiring cis -regulatory networks. This article is part of a discussion meeting issue ‘Crossroads between transposons and gene regulation’.

247 ASSOCIATIONS BETWEEN HEAT SHOCK PROTEIN 70 GENETIC POLYMORPHISMS AND CALVING RATES OF BRAHMAN-INFLUENCED COWS

2010 ◽  
Vol 22 (1) ◽  
pp. 281
Author(s):  
C. Rosenkrans Jr ◽  
A. Banks ◽  
S. Reiter ◽  
L. Starkey ◽  
M. Looper
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Genetic Polymorphisms ◽  
Heat Shock Protein 70 ◽  
Promoter Region ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Hsp70 Promoter ◽  
Single Nucleotide

Stress proteins and their genetic polymorphisms have been associated with decreased male and female fertility. Our objectives were to 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 (Hsp70) gene and 2) evaluate associations between Hsp70 SNP and calving rates of multiparous Brahman-influenced cows (n = 99). Genomic DNA was extracted from the buffy coats of EDTA- treated whole blood. Primers HSP-Pro749F (GCCAGGAAACCAGAGACAGA) and HSP-Pro1268R (CCTACGCAGGAGTAGGTGGT) were used for PCR amplification of a 539-base segment of the bovine Hsp70 promoter (GenBank accession number M98823). Eleven single nucleotide polymorphisms were detected: 8 transitions (G1013A, n = 2; G1045A, n = 8; C1069T, n = 4; A1096G, n = 14; G1117A, n = 12; T1134C, n = 7; C1154G, n = 11; andT1204C, n = 56), 2 transversions (A1125C, n = 53; and G1128T, n = 51), and 1 deletion at base position 895 (n = 37). Within an SNP, calving percentages were compared by chi-square analysis. Concentrations of Hsp70 and Julian date were analyzed by ANOVA, with each SNP represented as the main effect in the model. Cows that were homozygous for the minor allele at both transversion (A1125C and G1128T) sites had lower (P < 0.05) calving rates when compared with cows that were homozygous for the primary allele (48 v. 75%). Homozygous and heterozygous deletion of cytosine at base 895 resulted in lower (P < 0.05) calving percentages than homozygous cytosine cows (8, 50, 82%; respectively). In addition, DD cows had the latest (P < 0.05) Julian calving date. Eighteen Hsp70 promoter haplotypes were deduced, and 7 of those haplotypes (n = 37) included the deletion at base 895. Thirty-two cows had the haplotype consistent with the sequence deposited at GenBank, and the remaining 30 cows had an SNP other than the deletion. Cows with the deletion haplotypes had greater (P < 0.05) serum Hsp70 concentrations and lower (P < 0.05) calving rates (5.1, 4.7, and 3.5 MSE 0.5 ng mL-1; and 35, 78, and 87%; respectively, for Deletion, No, and Yes). Furthermore, cows with the deletion haplotypes had the latest (P < 0.05) Julian calving date (85, 77, and 73 d, respectively, for Deletion, No, and Yes). Our results suggest that the promoter region of the bovine Hsp70 gene is polymorphic and might be useful in selecting cows with greater fertility.

Genetics of Atrial Fibrilation: In Search of Novel Therapeutic Targets

2019 ◽  
Vol 19 (3) ◽  
pp. 183-194 ◽  
Author(s):  
Estefanía Lozano-Velasco ◽  
Carlos Garcia-Padilla ◽  
Amelia E. Aránega ◽  
Diego Franco
Keyword(s):  
Atrial Fibrillation ◽  
Regulatory Networks ◽  
Association Studies ◽  
Redox Homeostasis ◽  
Experimental Studies ◽  
Point Mutations ◽  
Therapeutic Targets ◽  
Genetic Regulatory Networks ◽  
Nucleotide Polymorphisms ◽  
Novel Therapeutic

: Atrial fibrillation (AF) is the most frequent arrhythmogenic disease in humans, ranging from 2% in the general population and rising up to 10-12% in 80+ years. Genetic analyses of AF familiar cases have identified a series of point mutations in distinct ion channels, supporting a causative link. However, these genetic defects only explain a minority of AF patients. Genomewide association studies identified single nucleotide polymorphisms (SNPs), close to PITX2 on 4q25 chromosome, that are highly associated to AF. Subsequent GWAS studies have identified several new loci, involving additional transcription and growth factors. Furthermore, these risk 4q25 SNPs serve as surrogate biomarkers to identify AF recurrence in distinct surgical and pharmacological interventions. Experimental studies have demonstrated an intricate signalling pathway supporting a key role of the homeobox transcription factor PITX2 as a transcriptional regulator. Furthermore, cardiovascular risk factors such as hyperthyroidism, hypertension and redox homeostasis have been identified to modulate PITX2 driven gene regulatory networks. We provide herein a state-of-the-art review of the genetic bases of atrial fibrillation, our current understanding of the genetic regulatory networks involved in AF and its plausible usage for searching novel therapeutic targets.

ARTS1 polymorphisms are associated with ankylosing spondylitis in Koreans

2009 ◽  
Vol 69 (3) ◽  
pp. 582-584 ◽  
Author(s):  
Chan-Bum Choi ◽  
Tae-Hwan Kim ◽  
Jae-Bum Jun ◽  
Hye-Soon Lee ◽  
Seung Cheol Shim ◽  
...  
Keyword(s):  
New York ◽  
Ankylosing Spondylitis ◽  
Single Nucleotide Polymorphisms ◽  
Genetic Polymorphisms ◽  
Caucasian Population ◽  
Healthy Controls ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Pathogenetic Mechanisms ◽  
Caucasian Patients

ObjectiveTo test the association between ARTS1 polymorphisms and Koreans with ankylosing spondylitis (AS).MethodsAll patients and controls were Korean. 872 patients with AS fulfilling the modified New York criteria and 403 healthy controls were genotyped for five single nucleotide polymorphisms (SNPs), rs27044, rs17482078, rs10050860, rs30107 and rs2287987, known to be associated with AS in Caucasians.ResultsSNPs rs27044 (p=9.37 × 10−7) and rs30187 (p=7.16 × 10−6) of ARTS1 were significantly associated with AS in Koreans. There was no significant association for rs17482078, rs10050860 and rs2287987. Two four-marker haplotypes were found to be associated with AS (GCCT: p=4.71×10−7, CCCC: p=8.56×10−6).ConclusionsThis is first confirmation in a non-Caucasian population that genetic polymorphisms in ARTS1 are associated with AS, implicating common pathogenetic mechanisms in Korean and Caucasian patients with AS.

scholarly journals Lesion size is associated with genetic polymorphisms in TLR1, TLR6, and TIRAP genes in patients with major abscesses and diabetic foot infections

2019 ◽  
Vol 39 (2) ◽  
pp. 353-360 ◽  
Author(s):  
Valentino D’Onofrio ◽  
Annelie A. Monnier ◽  
Cécile Kremer ◽  
Mark H. T. Stappers ◽  
Mihai G. Netea ◽  
...  
Keyword(s):  
Genetic Polymorphisms ◽  
Diabetic Foot ◽  
Lesion Size ◽  
Allelic Variant ◽  
Nucleotide Polymorphisms ◽  
Toll Like Receptor ◽  
Linear Regression Models ◽  
Single Nucleotide ◽  
Diabetic Foot Infections ◽  
Complicated Skin

AbstractGenetic variation in Toll-like receptors (TLRs) has previously been associated with susceptibility to complicated skin and skin structure infections (cSSSIs). The aim of this study was to investigate associations between the severity of cSSSIs, i.e., major abscesses and diabetic foot infections (DFIs), and a set of genetic polymorphisms in the Toll-like receptor pathway. A total of 121 patients with major abscesses and 132 with DFIs participating in a randomized clinical trial were genotyped for 13 nonsynonymous single-nucleotide polymorphisms (SNPs) in genes coding for TLRs and the signaling adaptor molecule TIRAP. Infection severity was defined by lesion size at clinical presentation for both types of infections. The PEDIS infection score was also used to define severity of DFIs. Linear regression models were used to study factors independently associated with severity. In patients with large abscesses, hetero- or homozygosity for the allelic variant TLR6 (P249S) was associated with significantly smaller lesions while homozygosity for the allelic variant TLR1 (R80T) was associated with significantly larger lesions. PRRs genes were not significantly associated with PEDIS. However, patients with DFI hetero- or homozygous for the allelic variant TLR1 (S248N) had significantly larger lesions. Polymorphisms in TLR1 and TLR6 influence the severity of cSSSIs as assessed by the lesion size of major abscesses and DFIs. ClinicalTrial.gov Identifier: NCT 00402727

scholarly journals Interaction between genes and lifestyle factors on obesity

2008 ◽  
Vol 67 (1) ◽  
pp. 1-8 ◽  
Author(s):  
Amelia Marti ◽  
Miguel Angel Martinez-González ◽  
J. Alfredo Martinez
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Candidate Genes ◽  
Weight Control ◽  
Lifestyle Factors ◽  
The Body ◽  
Energy Regulation ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Leptin Receptors ◽  
Body Weight Control

Obesity originates from a failure of the body-weight control systems, which may be affected by changing environmental influences. Basically, the obesity risk depends on two important mutually-interacting factors: (1) genetic variants (single-nucleotide polymorphisms, haplotypes); (2) exposure to environmental risks (diet, physical activity etc.). Common single-nucleotide polymorphisms at candidate genes for obesity may act as effect modifiers for environmental factors. More than 127 candidate genes for obesity have been reported and there is evidence to support the role of twenty-two genes in at least five different populations. Gene–environment interactions imply that the synergy between genotype and environment deviates from either the additive or multiplicative effect (the underlying model needs to be specified to appraise the nature of the interaction). Unravelling the details of these interactions is a complex task. Emphasis should be placed on the accuracy of the assessment methods for both genotype and lifestyle factors. Appropriate study design (sample size) is crucial in avoiding false positives and ensuring that studies have enough power to detect significant interactions, the ideal design being a nested case–control study within a cohort. A growing number of studies are examining the influence of gene–environmental interactions on obesity in either epidemiological observational or intervention studies. Positive evidence has been obtained for genes involved in adiposity, lipid metabolism or energy regulation such as PPARγ2 (Pro12Ala), β-adrenoceptor 2 (Gln27Glu) or uncoupling proteins 1, 2 and 3. Variants on other genes relating to appetite regulation such as melanocortin and leptin receptors have also been investigated. Examples of some recently-identified interactions are discussed.

Sign in / Sign up

Export Citation Format

Share Document