scholarly journals Characterization and Identification of a Novel Torovirus Associated With Recombinant Bovine Torovirus From Tibetan Antelope in Qinghai-Tibet Plateau of China

2021 ◽  
Vol 12 ◽  
Author(s):  
Xiaoyi Dai ◽  
Shan Lu ◽  
Guobao Shang ◽  
Wentao Zhu ◽  
Jing Yang ◽  
...  
Keyword(s):  
Distinct Species ◽  
Reservoir Host ◽  
Open Reading Frames ◽  
Tibet Plateau ◽  
Recent Common Ancestor ◽  
Evolutionary Analysis ◽  
Viral Loads ◽  
Most Recent Common Ancestor ◽  
Porcine Torovirus ◽  
Tibetan Antelope

Toroviruses (ToVs) are enteric pathogens and comprise three species, equine torovirus (EToV), bovine torovirus (BToV), and porcine torovirus (PToV). In this study, a novel torovirus (antelope torovirus, AToV) was discovered from fecal samples of Tibetan antelopes (Pantholops hodgsonii) with viral loads of 2.10×109 to 1.76×1010 copies/g. The genome of AToV is 28,438 nucleotides (nt) in length encoding six open reading frames (ORFs) with 11 conserved domains in pp1ab and a putative slippery sequence (14171UUUAAAC14177) in the overlapping region of ORF1a and ORF1b. Phylogenetic analysis illustrated strains of AToV form a unique clade within ToVs and comparative analysis showed AToV share relatively low sequence identity with other ToVs in six ORFs (68.2–91.6% nucleotide identity). These data suggested that AToV represents a novel and distinct species of ToVs. Based on the M genes, evolutionary analysis with BEAST of AToV and other ToVs led to a most recent common ancestor estimate of 366years ago. Remarkably, recombination analysis revealed AToV was the unknown parental ToV that once involving in the recombinant events of HE genes of two Dutch strains of BToV (B150 and B155), which indicated that AToV occurred cross-species transmission and existed both in the Netherlands and China. This study revealed a novel torovirus, a natural reservoir host (Tibetan antelope) of toroviruses for the first time, and appealed to further related studies to better understand the diversity of toroviruses.

scholarly journals Monkeypox Virus in Nigeria: Infection Biology, Epidemiology, and Evolution

Viruses ◽  
2020 ◽  
Vol 12 (11) ◽  
pp. 1257
Author(s):  
Emmanuel Alakunle ◽  
Ugo Moens ◽  
Godwin Nchinda ◽  
Malachy Ifeanyi Okeke
Keyword(s):  
Reservoir Host ◽  
Recent Common Ancestor ◽  
Future Research ◽  
Gene Gain ◽  
X Rays ◽  
Host Animal ◽  
Monkeypox Virus ◽  
Most Recent Common Ancestor ◽  
Infection Biology

Monkeypox is a zoonotic disease caused by monkeypox virus (MPXV), which is a member of orthopoxvirus genus. The reemergence of MPXV in 2017 (at Bayelsa state) after 39 years of no reported case in Nigeria, and the export of travelers’ monkeypox (MPX) from Nigeria to other parts of the world, in 2018 and 2019, respectively, have raised concern that MPXV may have emerged to occupy the ecological and immunological niche vacated by smallpox virus. This review X-rays the current state of knowledge pertaining the infection biology, epidemiology, and evolution of MPXV in Nigeria and worldwide, especially with regard to the human, cellular, and viral factors that modulate the virus transmission dynamics, infection, and its maintenance in nature. This paper also elucidates the role of recombination, gene loss and gene gain in MPXV evolution, chronicles the role of signaling in MPXV infection, and reviews the current therapeutic options available for the treatment and prevention of MPX. Additionally, genome-wide phylogenetic analysis was undertaken, and we show that MPXV isolates from recent 2017 outbreak in Nigeria were monophyletic with the isolate exported to Israel from Nigeria but do not share the most recent common ancestor with isolates obtained from earlier outbreaks, in 1971 and 1978, respectively. Finally, the review highlighted gaps in knowledge particularly the non-identification of a definitive reservoir host animal for MPXV and proposed future research endeavors to address the unresolved questions.

Early divergence of an Azorean endemic species in the moss genus Rhynchostegiella (Brachytheciaceae)

Phytotaxa ◽  
2015 ◽  
Vol 210 (1) ◽  
pp. 60 ◽  
Author(s):  
Alain Vanderpoorten ◽  
Jairo PatiÑo ◽  
Gerard Dirkse ◽  
TOM BLOCKEEL ◽  
Lars Hedenäs
Keyword(s):  
Endemic Species ◽  
Taxonomic Revision ◽  
Distinct Species ◽  
Recent Common Ancestor ◽  
Width Ratio ◽  
Most Recent Common Ancestor ◽  
Molecular Phylogenetic ◽  
Variable Species ◽  
The One ◽  
A New Species

Using the moss genus Rhynchostegiella (Brachytheciaceae) as a model, we address the question of whether taxonomic shortcomings account for the extremely low rates of endemism reported in the Azorean bryophyte flora. Eight accessions initially assigned to three of the four previously reported species in the Azores were identified as a distinct species using the Generalized Mixed Yule Coalescent method in the context of a molecular phylogenetic analysis of the genus. Rhynchostegiella azorica sp. nov. is therefore described as a new species that is endemic to the Azores. Its morphological features intergrade with those observed in other species, with a seta that ranges from almost smooth to rough; a length to width ratio of the laminal cells that matches the one of the R. curviseta group; but a leaf apex that is typical of the R. tenella group. This suggests that previous reports of four Rhynchostegiella species from Azores are erroneous and that a single, morphologically variable species, R. azorica, occurs in the archipelago. Rhynchostegiella azorica is sister to the remainder of the species of the genus, whose most recent common ancestor was dated at 4–20 Ma. This points to a more ancient origin in comparison with other Macaronesian endemic species of the genus. The unexpected discovery of an Azorean endemic species in Rhynchostegiella suggests that patterns of endemicity in the Azorean bryophyte flora are not well estimated from traditional taxonomic knowledge and point to the necessity of an extensive integrative taxonomic revision.

scholarly journals Predominance of hepatitis C virus genotype 4 infection and rapid transmission between 1935 and 1965 in the Central African Republic

2009 ◽  
Vol 90 (10) ◽  
pp. 2452-2456 ◽  
Author(s):  
Richard Njouom ◽  
Eric Frost ◽  
Sylvie Deslandes ◽  
Fleurie Mamadou-Yaya ◽  
Annie-Claude Labbé ◽  
...  
Keyword(s):  
Hepatitis C Virus ◽  
Hepatitis C ◽  
Central African Republic ◽  
Phylogenetic Analyses ◽  
Recent Common Ancestor ◽  
Evolutionary Analysis ◽  
Virus Genotype ◽  
Genotype 4 ◽  
Most Recent Common Ancestor ◽  
Genotype 2

The molecular epidemiology of hepatitis C virus (HCV) in the Central African Republic (CAR) is poorly documented. Thus, we conducted phylogenetic analyses of NS5B gene sequences from 58 HCV-infected inhabitants of a remote area of south-west CAR, which indicated that 48 (82.8 %) were infected with genotype 4 (HCV-4), five (8.6 %) with genotype 2 and five (8.6 %) with genotype 1. HCV-4 strains were highly heterogeneous, containing previously described subtypes 4k (48 %), 4c (27 %), 4r (4 %), 4f (4 %) and unclassified subtypes (17 %). To estimate the epidemic history of these HCV-4 strains, an evolutionary analysis using the coalescent approach was used. The estimated date of the most recent common ancestor of the CAR HCV-4 strains was 1539 (95 % confidence intervals, 1317–1697). They exhibited a rapid, exponential spread from 1935 to 1965, simultaneously with what was recently reported in neighbouring Cameroon and Gabon. The hypothesis of a massive iatrogenic transmission during interventions for the control of endemic tropical diseases is discussed.

scholarly journals The global phylogeny of Plum pox virus is emerging

2019 ◽  
Vol 100 (10) ◽  
pp. 1457-1468 ◽  
Author(s):  
Mohammad Hajizadeh ◽  
Adrian J. Gibbs ◽  
Fahimeh Amirnia ◽  
Miroslav Glasa
Keyword(s):  
Strain Differences ◽  
Open Reading Frames ◽  
Recent Common Ancestor ◽  
Plum Pox Virus ◽  
Migrant Populations ◽  
Most Recent Common Ancestor ◽  
Strong Negative Selection ◽  
Show Evidence ◽  
Reading Frames ◽  
Complete Genomic

The 206 complete genomic sequences of Plum pox virus in GenBank (January 2019) were downloaded. Their main open reading frames (ORF)s were compared by phylogenetic and population genetic methods. All fell into the nine previously recognized strain clusters; the PPV-Rec and PPV-T strain ORFs were all recombinants, whereas most of those in the PPV-C, PPV-CR, PPV-CV, PPV-D, PPV-EA, PPV-M and PPV-W strain clusters were not. The strain clusters ranged in size from 2 (PPV-CV and PPV-EA) to 74 (PPV-D). The isolates of eight of the nine strains came solely from Europe and the Levant (with an exception resulting from a quarantine breach), but many PPV-D strain isolates also came from east and south Asia and the Americas. The estimated time to the most recent common ancestor (TMRCA) of all 134 non-recombinant ORFs was 820 (865–775) BCE. Most strain populations were only a few decades old, and had small intra-strain, but large inter-strain, differences; strain PPV-W was the oldest. Eurasia is clearly the ‘centre of emergence’ of PPV and the several PPV-D strain populations found elsewhere only show evidence of gene flow with Europe, so have come from separate introductions from Europe. All ORFs and their individual genes show evidence of strong negative selection, except the positively selected pipo gene of the recently migrant populations. The possible ancient origins of PPV are discussed.

scholarly journals Target enrichment of long open reading frames and ultraconserved elements to link microevolution and macroevolution in non-model organisms

2021 ◽  
Author(s):  
Claudia Ortiz-Sepulveda ◽  
Mathieu Genete ◽  
Christelle Blassiau ◽  
Cécile Godé ◽  
Christian Albrecht ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Sequence Data ◽  
Early Stage ◽  
Phylogenetic Analyses ◽  
Open Reading Frames ◽  
Model Organisms ◽  
Recent Common Ancestor ◽  
Ultraconserved Elements ◽  
Most Recent Common Ancestor ◽  
Reading Frames

Despite the increasing accessibility of high-throughput sequencing, obtaining high-quality genomic data on non-model organisms without proximate well-assembled and annotated genomes remains challenging. Here we describe a workflow that takes advantage of distant genomic resources and ingroup transcriptomes to select and jointly enrich long open reading frames (ORFs) and ultraconserved elements (UCEs) from genomic samples for integrative studies of microevolutionary and macroevolutionary dynamics. This workflow is applied to samples of the African unionid bivalve tribe Coelaturini (Parreysiinae) at basin and continent-wide scales. Our results indicate that ORFs are efficiently captured without prior identification of intron-exon boundaries. The enrichment of UCEs was less successful, but nevertheless produced a substantial dataset. Exploratory continent-wide phylogenetic analyses with ORF supercontigs (>515,000 parsimony informative sites) resulted in a fully resolved phylogeny, the backbone of which was also retrieved with UCEs (>11,000 informative sites), although some branches lack support in the latter case. Variant calling on the exome of Coelaturini from the Malawi Basin produced ~2,000 SNPs per population pair. Nucleotide diversity and population differentiation was low compared to previous estimates in mollusks, but comparable to those in recently diversifying Malawi cichlids and other taxa at an early stage of speciation. Skimming non-specific sequence data obtained for Coelaturini of the Malawi Basin, we reconstructed the maternally-inherited mitogenome, which displays an identical gene order to that of the most recent common ancestor of Unionidae. Overall, our workflow and results provide exciting perspectives for the development of integrative genomic studies on micro- and macroevolutionary dynamics in non-model organisms.

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

2021 ◽  
Author(s):  
Handong Wang ◽  
Ye Chen ◽  
Wei Shi ◽  
Yongyao Guo ◽  
Jinghong He ◽  
...  
Keyword(s):  
Tandem Repeats ◽  
Complete Mitochondrial Genome ◽  
Sister Group ◽  
Recent Common Ancestor ◽  
Phylogenetic Study ◽  
Mitochondrial Genomes ◽  
Evolutionary Analysis ◽  
Habitat Distribution ◽  
Remarkable Feature ◽  
Most Recent Common Ancestor

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

Evolutionary analysis of rabies virus using the partial Nucleoprotein and Glycoprotein gene in Mumbai region of India

2021 ◽  
Author(s):  
Rajesh Raghunanth Pharande ◽  
Sharmila Badal Majee ◽  
Satish S. Gaikwad ◽  
S. D. Moregoankar ◽  
AnilKumar Bannalikar ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Rabies Virus ◽  
Evolutionary Dynamics ◽  
Recent Common Ancestor ◽  
N Gene ◽  
Evolutionary Analysis ◽  
Coalescent Analysis ◽  
Most Recent Common Ancestor ◽  
Indian Isolates ◽  
Highest Posterior Density

Nearly 1.7 million cases of dog bites are reported every year in India and many cases of animal rabies are left unattended and undiagnosed. Therefore, a mere diagnosis of rabies is not sufficient to understand the epidemiology and the spread of the rabies virus (RV) in animals. There is a paucity of information about the evolutionary dynamics of RV in dogs and its biodiversity patterns in India. In total, 50 dog-brain samples suspected of rabies were screened by the nucleoprotein- (N) and glycoprotein- (G) gene PCR. The N and G genes were subsequently sequenced to understand the molecular evolution in these genes. The phylogenetic analysis of the N gene revealed that six isolates in the Mumbai region belonged to a single Arctic lineage. Time-scaled phylogeny by Bayesian coalescent analysis of the partial N gene revealed that the time to the most recent common ancestor (TMRCA) for the sequences belonged to the cluster from 2006.68 with a highest posterior density of 95 % betweeen 2005–2008, which is assigned to Indian lineage I. Migration pattern revealed a strong Bayes factor between Mumbai to Delhi, Panji to Hyderabad, Delhi to Chennai, and Chennai to Chandigarh. Phylogenetic analysis of the G gene revealed that the RVs circulating in the Mumbai region are divided into three lineages. Time-scaled phylogeny by the Bayesian coalescent analysis method estimated that the TMRCA for sequences under study was from 1993 and Indian clusters was from 1962. In conclusion, the phylogenetic analysis of the N gene revealed that six isolates belonged to single Arctic lineages along with other Indian isolates and they were clustered into a single lineage but divided into three clades based on the G-gene sequences. The present study highlights and enhances the current molecular epidemiology and evolution of RV and revealed strong location bias and geographical clustering within Indian isolates on the basis of N and G genes.

scholarly journals Two Persistent LINE-1 Lineages in Peromyscus Have Unequal Rates of Evolution

Genetics ◽  
1996 ◽  
Vol 142 (4) ◽  
pp. 1289-1298
Author(s):  
N Carol Casavant ◽  
Amy N Sherman ◽  
Holly A Wichman
Keyword(s):  
Reverse Transcriptase ◽  
Deer Mouse ◽  
Comparative Sequence Analysis ◽  
Open Reading Frames ◽  
Recent Common Ancestor ◽  
Most Recent Common Ancestor ◽  
Rates Of Evolution ◽  
Muroid Rodents ◽  
Lineage 2 ◽  
Species Specific

Abstract LINE-1, the major family of long, interspersed repeats in the mammalian genome, moves via an RNA intermediate and encodes its own reverse transcriptase. Comparative sequence analysis was used to reconstruct the phylogenetic history of LINE-1 dynamics in the deer mouse, Peromyscus. As is the case in Mus and Rattus, a very small number of active templates produce the majority of LINE-1 copies in Peromyscus. However, in contrast to the single LINE-1 lineage seen in the muroid rodents, Peromyscus has at least two LINE-1 lineages whose most recent common ancestor probably existed before the peromyscine radiation. Species-specific variants of Lineage 1, and intact open reading frames in the youngest elements of both Lineages 1 and 2, suggest that both lineages have remained active within the same genome. The higher number of shared-sequence variants in Lineage 1 relative to Lineage 2 suggests that Lineage 1 has replaced its master template much more frequently than Lineage 2 or that the reverse transcriptase Lineage 1 is more error prone. The implications of the method used to acquire LINE-1 sequences for analysis are discussed.

scholarly journals The homologies and evolutionary reduction of the pelvis and hindlimbs in snakes, with the first report of ossified pelvic vestiges in an anomalepidid (Liotyphlops beui)

2019 ◽  
Author(s):  
Alessandro Palci ◽  
Mark N Hutchinson ◽  
Michael W Caldwell ◽  
Krister T Smith ◽  
Michael S Y Lee
Keyword(s):  
Common Ancestor ◽  
Recent Common Ancestor ◽  
Evolutionary Analysis ◽  
First Report ◽  
Most Recent Common Ancestor ◽  
Usual Representation ◽  
Primary Groups

Abstract We report the first example of ossified pelvic vestiges in an anomalepidid snake, Liotyplophs beui, and provide a review of the diversity of limb and pelvic elements within Serpentes. We trace the evolution, homology and reduction of the pelvic elements and hindlimbs from the oldest known snakes through to living forms. Evolutionary analysis of the pelvic and limb data shows that the most recent common ancestor of all living snakes (Serpentes) most probably retained all three pelvic elements and rudimentary hindlimbs (femoral spurs). Subsequently, there have been multiple losses of ossified pelvic and hindlimb elements and regaining of ossified pelvic elements. Reduction of the pelvis has followed different routes in the two primary groups of living snakes (scolecophidians and alethinophidians). The single remaining rod-like element in some scolecophidians is the ischium, whereas the single remaining rod-like element in many basal alethinophidians is the pubis. Notably, many basal alethinophidians share a distinctive configuration of cloacal spur (claw), femur and a sizeable pubis, which is likely to be related functionally to the widespread use of the hindlimbs in mating and courtship, rather than the usual representation of the bones as non-functional vestiges.

scholarly journals Evolution and Phylogeography of the Nonpathogenic Calicivirus RCV-A1 in Wild Rabbits in Australia

2010 ◽  
Vol 84 (23) ◽  
pp. 12397-12404 ◽  
Author(s):  
Marlene Jahnke ◽  
Edward C. Holmes ◽  
Peter J. Kerr ◽  
John D. Wright ◽  
Tanja Strive
Keyword(s):  
Myxoma Virus ◽  
European Rabbit ◽  
Rabbit Hemorrhagic Disease Virus ◽  
Recent Common Ancestor ◽  
Hemorrhagic Disease ◽  
Evolutionary Analysis ◽  
Wild Rabbit ◽  
Most Recent Common Ancestor ◽  
Capsid Sequence ◽  
Australian Continent

ABSTRACT Despite its potential importance for the biological control of European rabbits, relatively little is known about the evolution and molecular epidemiology of rabbit calicivirus Australia 1 (RCV-A1). To address this issue we undertook an extensive evolutionary analysis of 36 RCV-A1 samples collected from wild rabbit populations in southeast Australia between 2007 and 2009. Based on phylogenetic analysis of the entire capsid sequence, six clades of RCV-A1 were defined, each exhibiting strong population subdivision. Strikingly, our estimates of the time to the most recent common ancestor of RCV-A1 coincide with the introduction of rabbits to Australia in the mid-19th century. Subsequent divergence events visible in the RCV-A1 phylogenies likely reflect key moments in the history of the European rabbit in Australia, most notably the bottlenecks in rabbit populations induced by the two viral biocontrol agents used on the Australian continent, myxoma virus and rabbit hemorrhagic disease virus (RHDV). RCV-A1 strains therefore exhibit strong phylogeographic separation and may constitute a useful tool to study recent host population dynamics and migration patterns, which in turn could be used to monitor rabbit control in Australia.

Sign in / Sign up

Export Citation Format

Share Document