A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

2021 ◽  
Author(s):  
Handong Wang ◽  
Ye Chen ◽  
Wei Shi ◽  
Yongyao Guo ◽  
Jinghong He ◽  
...  
Keyword(s):  
Tandem Repeats ◽  
Complete Mitochondrial Genome ◽  
Sister Group ◽  
Recent Common Ancestor ◽  
Phylogenetic Study ◽  
Mitochondrial Genomes ◽  
Evolutionary Analysis ◽  
Habitat Distribution ◽  
Remarkable Feature ◽  
Most Recent Common Ancestor

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

scholarly journals Three Complete Mitochondrial Genomes of Orestes guangxiensis, Peruphasma schultei, and Phryganistria guangxiensis (Insecta: Phasmatodea) and Their Phylogeny

Insects ◽  
2021 ◽  
Vol 12 (9) ◽  
pp. 779 ◽  
Author(s):  
Ke-Ke Xu ◽  
Qing-Ping Chen ◽  
Sam Pedro Galilee Ayivi ◽  
Jia-Yin Guan ◽  
Kenneth B. Storey ◽  
...  
Keyword(s):  
Sister Group ◽  
Recent Common Ancestor ◽  
Mitochondrial Genomes ◽  
Sister Group Relationship ◽  
Protein Coding ◽  
Most Recent Common Ancestor ◽  
Stick Insects ◽  
Long Time ◽  
Relationship Of ◽  
Complete Mitochondrial Genomes

Insects of the order Phasmatodea are mainly distributed in the tropics and subtropics and are best known for their remarkable camouflage as plants. In this study, we sequenced three complete mitochondrial genomes from three different families: Orestes guangxiensis, Peruphasma schultei, and Phryganistria guangxiensis. The lengths of the three mitochondrial genomes were 15,896 bp, 16,869 bp, and 17,005 bp, respectively, and the gene composition and structure of the three stick insects were identical to those of the most recent common ancestor of insects. The phylogenetic relationships among stick insects have been chaotic for a long time. In order to discuss the intra- and inter-ordinal relationship of Phasmatodea, we used the 13 protein-coding genes (PCGs) of 85 species for maximum likelihood (ML) and Bayesian inference (BI) analyses. Results showed that the internal topological structure of Phasmatodea had a few differences in both ML and BI trees and long-branch attraction (LBA) appeared between Embioptera and Zoraptera, which led to a non-monophyletic Phasmatodea. Consequently, after removal of the Embioptera and Zoraptera species, we re-performed ML and BI analyses with the remaining 81 species, which showed identical topology except for the position of Tectarchus ovobessus (Phasmatodea). We recovered the monophyly of Phasmatodea and the sister-group relationship between Phasmatodea and Mantophasmatodea. Our analyses also recovered the monophyly of Heteropterygidae and the paraphyly of Diapheromeridae, Phasmatidae, Lonchodidae, Lonchodinae, and Clitumninae. In this study, Peruphasma schultei (Pseudophasmatidae), Phraortes sp. YW-2014 (Lonchodidae), and species of Diapheromeridae clustered into the clade of Phasmatidae. Within Heteropterygidae, O. guangxiensis was the sister clade to O. mouhotii belonging to Dataminae, and the relationship of (Heteropteryginae + (Dataminae + Obriminae)) was recovered.

scholarly journals An ancient adenosine receptor gains olfactory function in bony vertebrates

2021 ◽  
Author(s):  
Daniel Kowatschew ◽  
Sigrun I Korsching
Keyword(s):  
Adenosine Receptor ◽  
Olfactory Receptor ◽  
Receptor Gene ◽  
Sister Group ◽  
Olfactory Function ◽  
Recent Common Ancestor ◽  
Phylogenetic Study ◽  
Double Labeling ◽  
Most Recent Common Ancestor ◽  
Aquatic Vertebrates

Abstract Nucleotides are an important class of odorants for aquatic vertebrates such as frogs and fishes, but also have manifold signalling roles in other cellular processes. Recently, an adenosine receptor believed to belong to the adora2 clade has been identified as an olfactory receptor in zebrafish. Here we set out to elucidate the evolutionary history of both this gene and its olfactory function. We have performed a thorough phylogenetic study in vertebrates, chordates and their sister group, ambulacraria, and show that the origin of the zebrafish olfactory receptor gene can be traced back to the most recent common ancestor of all three groups as a segregate sister clade (adorb) to the adora gene family. Eel, carp, and clawed frog all express adorb in a sparse and distributed pattern within their olfactory epithelium very similar to the pattern observed for zebrafish, i.e. consistent with a function as olfactory receptor. In sharp contrast, lamprey adorb-expressing cells are absent from the sensory region of the lamprey nose, but form a contiguous domain directly adjacent to the sensory region. Double-labeling experiments confirmed the expression of lamprey adorb in nonneuronal cells and are consistent with an expression in neuronal progenitor cells. Thus, adorb may have undergone a switch of function in the jawed lineage of vertebrates towards a role as olfactory receptor.

scholarly journals Mitogenomics and the genetic differentiation of contemporary Balaena mysticetus (Cetacea) from Svalbard

2020 ◽  
Author(s):  
Lutz Bachmann ◽  
Andrea A Cabrera ◽  
Mads Peter Heide-Jørgensen ◽  
Olga V Shpak ◽  
Christian Lydersen ◽  
...  
Keyword(s):  
Genetic Differentiation ◽  
High Throughput Sequencing ◽  
Demographic History ◽  
Bowhead Whale ◽  
Recent Common Ancestor ◽  
Mitochondrial Genomes ◽  
Balaena Mysticetus ◽  
Bowhead Whales ◽  
Most Recent Common Ancestor ◽  
Loop Region

Abstract Full mitochondrial genomes were assembled for 12 recently sampled animals from the Svalbard bowhead whale (Balaena mysticetus) stock via high-throughput sequencing data, facilitating analysis of the demographic history of the population for the first time. The Svalbard population has retained noticeable amounts of mitochondrial genome diversity despite extreme historical harvest levels. Haplotype and nucleotide diversities were similar to those estimated earlier for other bowhead whale populations. The reconstructed demographic history was in accordance with a boom–bust scenario, combining a slight Pleistocene population growth 25 000–35 000 years ago and a Holocene decline. Employing a mutation rate of 3.418 × 10–8 substitutions per site per year, the time to the most recent common ancestor for the mitochondrial genomes of the contemporary Svalbard bowhead whales was estimated to be 68 782 (54 353–83 216) years before the present. Based on 370 bp fragments of the D-loop region, significant genetic differentiation was detected between all extant bowhead whale populations across the circumpolar Arctic. Thus, the Svalbard bowhead whales can be regarded as a population with its own genetic legacy.

Early-diverging bumblebees from across the roof of the world: the high-mountain subgenus Mendacibombus revised from species’ gene coalescents and morphology (Hymenoptera, Apidae)

Zootaxa ◽  
2016 ◽  
Vol 4204 (1) ◽  
pp. 1 ◽  
Author(s):  
PAUL H. WILLIAMS ◽  
JIAXING HUANG ◽  
PIERRE RASMONT ◽  
JIANDONG AN
Keyword(s):  
Incomplete Lineage Sorting ◽  
Sister Group ◽  
Process Models ◽  
Coi Gene ◽  
Colour Pattern ◽  
Recent Common Ancestor ◽  
High Mountain ◽  
Crown Group ◽  
Most Recent Common Ancestor ◽  
Colour Patterns

The bumblebees of the subgenus Mendacibombus of the genus Bombus are the sister group to all other extant bumblebees and are unusual among bees for specialising in some of the highest elevation habitats with entomophilous plants on Earth. Most named taxa in this group (24 available names, from a total of 49 published names) were described originally from small differences in the colour pattern of the hair, many as parts (e.g. subspecies) of just one species. Subsequent taxonomic treatments recognised multiple species, but have described very few morphological characters, most of which are in the male genitalia. We examined 4413 specimens representing all of the named taxa from throughout the group’s global range to describe variation in DNA, in skeletal morphology, and in the colour patterns of the hair. Using Bayesian inference of the phylogeny from an evolutionary model for the fast-evolving COI gene, and fitting either general mixed Yule/coalescent models or Poisson tree process models, we identify COI gene coalescents, which are expected to characterise species as evolutionarily independent lineages. None of the conditions most likely to compromise this interpretation (biased sampling, paralogy, introgression, heteroplasmy, incomplete lineage sorting) appears to be a substantial problem in this case. In an integrative analysis, we show that colour patterns are often variable within these groups and do not diagnose the same groups as we recognise from genes; in contrast, the groups recognised from gene coalescents can also be diagnosed from differences we identify in morphology. We infer that the 12 groups with coalescents in the COI gene that are corroborated by morphology constitute species, whereas many of these species are polymorphic in colour pattern. Lectotypes are designated for 15 taxa in order to reduce uncertainty in the identity and application of the names. We provide new morphological keys and distribution maps for the species. Then we use four genes (fast-evolving mitochondrial COI and 16S; and slower nuclear PEPCK and opsin) to obtain an absolute chronogram of phylogenetic relationships among the species. From published estimates that the most recent common ancestor of the subgenus Mendacibombus diverged from the other bumblebees at the beginning of the Oligocene, our results support the crown group of Mendacibombus as having diversified in the late Miocene, events that both appear to have been associated with periods of climate cooling. Relative conservatism in the alpine/subalpine climate niche of Mendacibombus, as compared with the much more diversified climate niches in the sister group of all other bumblebees, may have contributed to constraining the number of Mendacibombus species to just one twentieth of the total number of extant bumblebee species. 

scholarly journals Ancient DNA from the extinct Haitian cave-rail ( Nesotrochis steganinos ) suggests a biogeographic connection between the Caribbean and Old World

2021 ◽  
Vol 17 (3) ◽  
Author(s):  
Jessica A. Oswald ◽  
Ryan S. Terrill ◽  
Brian J. Stucky ◽  
Michelle J. LeFebvre ◽  
David W. Steadman ◽  
...  
Keyword(s):  
Common Ancestor ◽  
Complete Mitochondrial Genome ◽  
Recent Common Ancestor ◽  
Evolutionary Relationships ◽  
Human Settlement ◽  
Comprehensive Understanding ◽  
The Holocene ◽  
Most Recent Common Ancestor ◽  
Extant Species ◽  
The Caribbean

Worldwide decline in biodiversity during the Holocene has impeded a comprehensive understanding of pre-human biodiversity and biogeography. This is especially true on islands, because many recently extinct island taxa were morphologically unique, complicating assessment of their evolutionary relationships using morphology alone. The Caribbean remains an avian hotspot but was more diverse before human arrival in the Holocene. Among the recently extinct lineages is the enigmatic genus Nesotrochis, comprising three flightless species. Based on morphology, Nesotrochis has been considered an aberrant rail (Rallidae) or related to flufftails (Sarothruridae). We recovered a nearly complete mitochondrial genome of Nesotrochis steganinos from fossils, discovering that it is not a rallid but instead is sister to Sarothruridae, volant birds now restricted to Africa and New Guinea, and the recently extinct, flightless Aptornithidae of New Zealand. This result suggests a widespread or highly dispersive most recent common ancestor of the group. Prior to human settlement, the Caribbean avifauna had a far more cosmopolitan origin than is evident from extant species.

scholarly journals Diversity and Paleodemography of the Addax (Addax nasomaculatus), a Saharan Antelope on the Verge of Extinction

Genes ◽  
2021 ◽  
Vol 12 (8) ◽  
pp. 1236
Author(s):  
Elisabeth Hempel ◽  
Michael V. Westbury ◽  
José H. Grau ◽  
Alexandra Trinks ◽  
Johanna L. A. Paijmans ◽  
...  
Keyword(s):  
Population Size ◽  
Population History ◽  
Phylogeographic Structure ◽  
Recent Common Ancestor ◽  
Mitochondrial Genomes ◽  
Effective Population ◽  
Mammal Species ◽  
Human Disturbances ◽  
Most Recent Common Ancestor ◽  
History Of

Since the 19th century, the addax (Addax nasomaculatus) has lost approximately 99% of its former range. Along with its close relatives, the blue antelope (Hippotragus leucophaeus) and the scimitar-horned oryx (Oryx dammah), the addax may be the third large African mammal species to go extinct in the wild in recent times. Despite this, the evolutionary history of this critically endangered species remains virtually unknown. To gain insight into the population history of the addax, we used hybridization capture to generate ten complete mitochondrial genomes from historical samples and assembled a nuclear genome. We found that both mitochondrial and nuclear diversity are low compared to other African bovids. Analysis of mitochondrial genomes revealed a most recent common ancestor ~32 kya (95% CI 11–58 kya) and weak phylogeographic structure, indicating that the addax likely existed as a highly mobile, panmictic population across its Sahelo–Saharan range in the past. PSMC analysis revealed a continuous decline in effective population size since ~2 Ma, with short intermediate increases at ~500 and ~44 kya. Our results suggest that the addax went through a major bottleneck in the Late Pleistocene, remaining at low population size prior to the human disturbances of the last few centuries.

scholarly journals Characterization of the mitochondrial genome of Analcellicampa xanthosoma gen. et sp. nov. (Hymenoptera: Tenthredinidae)

PeerJ ◽  
2019 ◽  
Vol 7 ◽  
pp. e6866 ◽  
Author(s):  
Gengyun Niu ◽  
Yaoyao Zhang ◽  
Zhenyi Li ◽  
Meicai Wei
Keyword(s):  
Mitochondrial Genome ◽  
New Genus ◽  
Complete Mitochondrial Genome ◽  
Sister Group ◽  
Mitochondrial Genomes ◽  
Protein Coding ◽  
Protein Coding Genes ◽  
A New Species ◽  
High Support

A new genus with a new species of the tribe Hoplocampini of Hoplocampinae was described from China: Analcellicampa xanthosoma Wei & Niu, gen. et sp. nov. Hoplocampa danfengensis G. Xiao 1994 was designated as the type species of the new genus. The characters of Analcellicampa danfengensis (G. Xiao) comb. nov. were briefly discussed. A key to the tribes and known genera of Hoplocampinae was provided. The nearly complete mitochondrial genome of A. xanthosoma was characterized as having a length of 15,512 bp and containing 37 genes (22 tRNAs, 13 protein-coding genes (PCGs), and 2 rRNAs). The gene order of this new specimen was the same as that in the inferred insect ancestral mitochondrial genome. All PCGs were initiated by ATN codons and ended with TAA or T stop codons. All tRNAs had a typical cloverleaf secondary structure, except for trnS1. Remarkably, the helices H991 of rrnS and H47 of rrnL were redundant, while helix H563 of rrnL was highly conserved. A phylogeny based on previously reported symphytan mitochondrial genomes showed that A. xanthosoma is a sister group to Monocellicampa pruni, with high support values. We suggest that A. xanthosoma and M. pruni belong to the tribe Hoplocampini of Hoplocampinae.

scholarly journals The evolutionary history of Stomatopoda (Crustacea: Malacostraca) inferred from molecular data

PeerJ ◽  
2017 ◽  
Vol 5 ◽  
pp. e3844 ◽  
Author(s):  
Cara Van Der Wal ◽  
Shane T. Ahyong ◽  
Simon Y.W. Ho ◽  
Nathan Lo
Keyword(s):  
Phylogenetic Analyses ◽  
Sister Group ◽  
Molecular Data ◽  
Recent Common Ancestor ◽  
Ancestral State ◽  
Crown Group ◽  
Most Recent Common Ancestor ◽  
History Of ◽  
The Tropics ◽  
Age Constraints

The crustacean order Stomatopoda comprises seven superfamilies of mantis shrimps, found in coastal waters of the tropics and subtropics. These marine carnivores bear notable raptorial appendages for smashing or spearing prey. We investigated the evolutionary relationships among stomatopods using phylogenetic analyses of three mitochondrial and two nuclear markers. Our analyses recovered the superfamily Gonodactyloidea as polyphyletic, withHemisquillaas the sister group to all other extant stomatopods. A relaxed molecular clock, calibrated by seven fossil-based age constraints, was used to date the origin and major diversification events of stomatopods. Our estimates suggest that crown-group stomatopods (Unipeltata) diverged from their closest crustacean relatives about 340 Ma (95% CRI [401–313 Ma]). We found that the specialized smashing appendage arose after the spearing appendage ∼126 Ma (95% CRI [174–87 Ma]). Ancestral state reconstructions revealed that the most recent common ancestor of extant stomatopods had eyes with six midband rows of hexagonal ommatidia. Hexagonal ommatidia are interpreted as plesiomorphic in stomatopods, and this is consistent with the malacostracan ground-plan. Our study provides insight into the evolutionary timescale and systematics of Stomatopoda, although further work is required to resolve with confidence the phylogenetic relationships among its superfamilies.

scholarly journals Predominance of hepatitis C virus genotype 4 infection and rapid transmission between 1935 and 1965 in the Central African Republic

2009 ◽  
Vol 90 (10) ◽  
pp. 2452-2456 ◽  
Author(s):  
Richard Njouom ◽  
Eric Frost ◽  
Sylvie Deslandes ◽  
Fleurie Mamadou-Yaya ◽  
Annie-Claude Labbé ◽  
...  
Keyword(s):  
Hepatitis C Virus ◽  
Hepatitis C ◽  
Central African Republic ◽  
Phylogenetic Analyses ◽  
Recent Common Ancestor ◽  
Evolutionary Analysis ◽  
Virus Genotype ◽  
Genotype 4 ◽  
Most Recent Common Ancestor ◽  
Genotype 2

The molecular epidemiology of hepatitis C virus (HCV) in the Central African Republic (CAR) is poorly documented. Thus, we conducted phylogenetic analyses of NS5B gene sequences from 58 HCV-infected inhabitants of a remote area of south-west CAR, which indicated that 48 (82.8 %) were infected with genotype 4 (HCV-4), five (8.6 %) with genotype 2 and five (8.6 %) with genotype 1. HCV-4 strains were highly heterogeneous, containing previously described subtypes 4k (48 %), 4c (27 %), 4r (4 %), 4f (4 %) and unclassified subtypes (17 %). To estimate the epidemic history of these HCV-4 strains, an evolutionary analysis using the coalescent approach was used. The estimated date of the most recent common ancestor of the CAR HCV-4 strains was 1539 (95 % confidence intervals, 1317–1697). They exhibited a rapid, exponential spread from 1935 to 1965, simultaneously with what was recently reported in neighbouring Cameroon and Gabon. The hypothesis of a massive iatrogenic transmission during interventions for the control of endemic tropical diseases is discussed.

scholarly journals First phylogenetic analysis of dengue virus serotype 4 circulating in Espírito Santo state, Brazil, in 2013 and 2014

2017 ◽  
Vol 146 (1) ◽  
pp. 100-106 ◽  
Author(s):  
C. R. VICENTE ◽  
C. S. PANNUTI ◽  
P. R. URBANO ◽  
A. C. FELIX ◽  
C. CERUTTI JUNIOR ◽  
...  
Keyword(s):  
Dengue Virus ◽  
Recent Common Ancestor ◽  
Phylogenetic Study ◽  
Envelope Gene ◽  
Mato Grosso ◽  
Espírito Santo ◽  
Most Recent Common Ancestor ◽  
Virus Serotype ◽  
Espirito Santo ◽  
Genotype Ii

SUMMARYThe purpose of the present study was to reconstruct the phylogeny of dengue virus serotype 4 (DENV-4) that was circulating in Espírito Santo state, Brazil, in 2013 and 2014, and to discuss the epidemiological implications associated with this evolutionary hypothesis. Partial envelope gene of eight DENV-4 samples from Espírito Santo state were sequenced and aligned with 72 worldwide DENV-4 reference sequences from GenBank. A phylogenetic tree was reconstructed through Bayesian Inference and the Time of the Most Recent Common Ancestor was estimated. The study detected the circulation of DENV-4 genotype II in Espírito Santo state, which was closely related to strains from the states of Mato Grosso collected in 2012 and of São Paulo sampled in 2015. This cluster emerged around 2011, approximately 4 years after the entry of the genotype II in Brazil through its northern states, possibly imported from Venezuela and Colombia. This is so far the first phylogenetic study of the DENV-4 circulating in Espírito Santo state and shows the importance of an internal route of dengue viral circulation in Brazil to the introduction of the virus into this state.

Sign in / Sign up

Export Citation Format

Share Document