Spatial Distribution and Landscape Characteristics of Flores Hawk-Eagle (Nisaetus Floris) Habitat in Flores Island

Flores Hawk-Eagle (FHE, Nisaetus floris) is one of the endemic and keystone species that was rarely studied among other eagles. The study on the FHE is currently experiencing limited information for estimating their distribution area. Therefore, the FHE habitat distribution is required as the essential information for developing the strategies and conservation action. The objectives of this study were to identify the spatial habitat distribution and analyze the characteristics of the habitat. Minimum convex polygon (MCP) and kernel-density estimation (KDE) 95% was combined with the land cover map for delineating the patch habitat of FHE. Slope, elevation, and land cover were used as environmental variables. Principal Component Analysis (PCA) combine with GIS were used for characterizing the landscape habitat. The results showed that there were eight habitat patches with a total area of 1.132 km2. Six principal components were retained from PCA analysis which explained 71.96% of data variance. Habitat characteristics of FHE describe its requirement for nesting and hunting activities for principal components 1 to 4, while for flight activity related to principal components 5 and 6. Forests and savannahs become the main habitat preference for both nesting and hunting activities. Results of this study will be supported as baseline information for developing conservation strategies and action for FHE.

Modeling the Habitat Distribution of Acanthopagrus schlegelii in the Coastal Waters of the Eastern Taiwan Strait Using MAXENT with Fishery and Remote Sensing Data

Black sea bream, Acanthopagrus schlegelii, is among the most commercially valuable species in the coastal fishery industry and marine ecosystems. Catch data comprising capture locations for the gillnet fisheries, remotely sensed environmental data (i.e., sea surface temperature, chlorophyll-a concentration, and current velocity), and topography (bathymetry) from 2015 to 2018 were used to construct a spatial habitat distribution of black sea bream. This species is concentrated in coastal waters (<3 nm) from December to April (spawning season). The maximum entropy (MaxEnt) method and corresponding habitat suitability index among seasons were used to clarify the species’ spatial distribution and identify the seasonal variations in habitat selection. The patterns corresponded closely to the changes in oceanographic conditions, and the species exhibited synchronous trends with the marine environment’s seasonal dynamics. Chlorophyll-a concentration and bathymetry substantially influenced (80.1–92.9%) black sea bream’s habitat selection. By applying the MaxEnt model, the optimal habitats were identified with four variables including depth and satellite-derived temperature, current velocity and chlorophyll-a concentration, which provides a foundation for the scientific assessment and management of black sea bream in coastal waters of the Eastern Taiwan Strait.

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

Spatial Distribution and Landscape Characteristics of Flores Hawk-Eagle (Nisaetus Floris) Habitat in Flores Island

Flores Hawk-Eagle (FHE, Nisaetus floris) is one of the endemic and keystone species that was rarely studied among other eagles. The study on the FHE is currently experiencing limited information for estimating their distribution area. Therefore, the FHE habitat distribution is required as the essential information for developing the strategies and conservation action. The objectives of this study were to identify the spatial habitat distribution and analyze the characteristics of the habitat. Minimum convex polygon (MCP) and kernel-density estimation (KDE) 95% was combined with the land cover map for delineating the patch habitat of FHE. Slope, elevation, and land cover were used as environmental variables. Principal Component Analysis (PCA) combine with GIS were used for characterizing the landscape habitat. The results showed that there were eight habitat patches with a total area of 1.132 km2. Six principal components were retained from PCA analysis which explained 71.96% of data variance. Habitat characteristics of FHE describe its requirement for nesting and hunting activities for principal components 1 to 4, while for flight activity related to principal components 5 and 6. Forests and savannahs become the main habitat preference for both nesting and hunting activities. Results of this study will be supported as baseline information for developing conservation strategies and action for FHE.

Modeling the Wintering Habitat Distribution of Oriental Honey Buzzards in West Java Indonesia with Satellite Tracking Data Using Logistic Regression

Oriental honey buzzards (OHBs, Pernis ptilorhynchus) are one of migratory raptor from Japan to Indonesia which is widely recognized as indicator species reflecting the conditions of their habitat. Since 2003, OHBs have been satellite-tracked in their wintering grounds in Indonesia. Less information available on wintering areas in the west Java, which hampers the OHB conservation efforts. This paper proposes a new approach for predicting the probability models of the wintering habitat distribution of OHBs with the presence data derived from satellite tracking using logistic regression analysis coupled with RAMAS GIS. This spatial model was locally constructed from the data concerning Talaga Bodas and its surrounding areas and extrapolated for the entire West Java region. The best predicted probability model successfully characterized the distribution of the OHB wintering habitat using slope (25–40%), elevation (0–300 m and >1,000 m), and land cover (forest, paddy field, and water body). The extrapolation model generated potential areas of the wintering habitat distribution covering an area of 3013.13 km2 (8.11% of West Java). These areas were predominantly located outside the protected areas (94.04%). The modeling approach proposed herein may be used to study other migratory species that are tracked using satellite or other navigation technologies.

Zingiber calcicola (Zingiberaceae), a new species from a limestone area in south Yunnan, China

Zingiber calcicola Y.H.Tan & H.B.Ding, sp. nov. (Zingiberaceae) from a limestone area in south Yunnan, China is described and illustrated here. It belongs to Zingiber sect. Dymczewiczia due to the terminal inflorescence on the leafy shoot. The description, photographs, habitat, distribution, phenology and a comparison with the allied species are also provided.

Response of Abundance and Distribution of Humboldt Squid (Dosidicus gigas) to Short-Lived Eddies in the Eastern Equatorial Pacific Ocean From April to June 2017

In this study, the eddy characteristics on the fishing ground of the Humboldt squid (Dosidicus gigas) in the eastern equatorial Pacific Ocean were detected based on geometrical characteristics with the flow field during April–June 2017. The influence of the eddies on the biophysical environment, D. gigas abundance, and habitat distribution were explored. The habitat was identified by fishery data, sea surface temperature (SST), vertical water temperature, and chlorophyll-a (Chl-a). Results indicated that the eddy lifetime was relatively short, with only three eddies persisting for more than 2 weeks. The number of eddies in each month showed a similar variability trend with the monthly average catch per unit effort (CPUE) of D. gigas. Two eddies were taken with a lifetime of above 2 weeks, which revealed that the environmental conditions around the eddies significantly changed. When the eddy persisted for 8–10 days, SST and vertical temperature gradually decreased, but Chl-a significantly increased. The habitat quality of D. gigas gradually increased, and the gravity center of the fishing ground was consistent with eddy movement. The eddy-induced Ekman pumping led to the transportation of deep waters with rich nutrients into the euphotic layer, promoted the reproduction of bait organisms, and yielded favorable water temperature conditions for D. gigas. These environmental changes aided the formation of high-quality habitats, which increase D. gigas abundance and catch and drive the shift of the gravity centers of fishing grounds with the eddy. Our findings suggested that eddy activities have significant impacts on D. gigas abundance and habitat distribution.