HTLV-1's Foxy Strategy for Survival and Transmission

Human T-cell leukemia virus type 1 (HTLV-1) is the causative agent of adult T-cell leukemia-lymphoma (ATL) and inflammatory diseases including HTLV-1-associated myelopathy (HAM). A remarkable feature of HTLV-1 is that this virus transmits primarily through cell-to-cell contact. HTLV-1 increases the number of infected cells in vivo to ensure its survival and transmission. Therefore, survival of HTLV-1-infected cells in vivo is very critical for transmission under the host immune surveillance. HTLV-1 possesses multiple strategies to evade host immune responses. Among viral genes, Tax and HTLV-1 bZIP factor (HBZ) play crucial roles in the proliferation of infected cells and the subsequent development of ATL. Although Tax strongly activates the NF-kB pathway, the immunogenicity of Tax is very high; it is a major target of cytotoxic T lymphocytes. Therefore, the virus minimizes Tax production, expressing it only intermittently in vivo. On the other hand, the immunogenicity of HBZ is low, and its expression is maintained in all ATL cases. HBZ transforms the immunophenotype of infected cells into regulatory T cell-like (CD4+ CD25+ CCR4+ TIGIT+ Foxp3+), and promotes the production of immunosuppressive cytokines. Furthermore, HBZ mRNA not only encodes the protein but also functions itself like long non-coding RNA. As a result, Tax and HBZ enable long-term escape from host immunity, persistent infection, and proliferation of infected cells. Here, we review the viral strategies to counteract to host immune surveillance system.

Avenues for the Primary Prevention of Breast Cancer in the Second Millennium

Breast cancer (BC) has recently surpassed lung canceras the most frequently diagnosed cancer worldwide,with an estimated 19.3 million new cases and almost 10 1 million deaths occurring in 2020. A steady ascension in BC incidence has been a remarkable feature in cancer epidemiology for almost a century, and has been reported in richer as well as poorer communities all over the world. This trend is no doubt associated with the ageing of the global population: “Each one-year increase of population ageing (is) associated with a nearly ½ year increase of age at BC diagnosis.

An Intriguing New Species of Sanchezia (Acanthaceae) from Southeastern Peru

Abstract— Sanchezia dubia is described and illustrated as a new species from the department of Madre de Dios in southeastern Peru. Its morphology slightly resembles Sanchezia sprucei, but its most remarkable feature is its close similarity to Suessenguthia, even more so than to those of its own genus. This new species is distinguished from others by its glabrous stem and leaves, its inflorescence containing two to five serial cymose heads, which are sessile to short-pedunculate, with mostly two to four flowers each (occasionally one), its inner bracts ranging in length between 6 and 23 mm, and its androecium composed of two stamens and two mucronate staminodes. We suggest it is an endangered species based on its restricted geographic distribution, its few known populations, and the increasing threats to its habitats. Along with Suessenguthia koessleri, this new species seems to be a key taxon to understanding the phylogenetic relationship between these two genera, which is still uncertain. Additionally, we provide a key to identify the Sanchezia and Suessenguthia species of the Madre de Dios River basin from southern Peru to northern Bolivia.

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

PiRNA Biogenesis and Their Role in Human Cancers and Other Diseases: A Narrative Review

PIWI-interacting RNAs (piRNAs) with the length of approximately 26-30 nucleotides are a distinct class of small non-coding RNAs that mainly expressed in the animal gonads. Other small RNAs originate from double stranded precursors but piRNAs derive from long single-stranded primary transcripts, which expressed from distinct genomic regions. piRNAs are involved in silencing of mobile elements named transposons and their main role is germline maintenance. Recent studies have opened new insights on biological and clinical significance of piRNAs in various diseases. Abnormal expression of piRNAs is a remarkable feature in many diseases especially human cancers, which emphasize on their important biological role in disease progression. Furthermore, they can be served as biomarkers and therapeutic targets for tumor diagnostics and treatment. In this review, we explained piRNAs characteristics, biogenesis process and functions, discuss new findings about involvement of these elements in various disease and their potential to be used as diagnostic biomarkers.

Case not closed: the mystery of the origin of the carpel

The carpel is a fascinating structure that plays a critical role in flowering plant reproduction and contributed greatly to the evolutionary success and diversification of flowering plants. The remarkable feature of the carpel is that it is a closed structure that envelopes the ovules and after fertilization develops into the fruit which protects, helps disperse, and supports seed development into a new plant. Nearly all plant-based foods are either derived from a flowering plant or are a direct product of the carpel. Given its importance it’s no surprise that plant and evolutionary biologists have been trying to explain the origin of the carpel for a long time. Before carpel evolution seeds were produced on open leaf-like structures that are exposed to the environment. When the carpel evolved in the stem lineage of flowering plants, seeds became protected within its closed structure. The evolutionary transition from that open precursor to the closed carpel remains one of the greatest mysteries of plant evolution. In recent years, we have begun to complete a picture of what the first carpels might have looked like. On the other hand, there are still many gaps in our understanding of what the precursor of the carpel looked like and what changes to its developmental mechanisms allowed for this evolutionary transition. This review aims to present an overview of existing theories of carpel evolution with a particular emphasis on those that account for the structures that preceded the carpel and/or present testable developmental hypotheses. In the second part insights from the development and evolution of diverse plant organs are gathered to build a developmental hypothesis for the evolutionary transition from a hypothesized laminar open structure to the closed structure of the carpel.

Enhanced magnetic performance in exchange coupled CoFe2O4 - LaFeO3 nanocomposites

Nanocomposite oxide system of (x)CoFe2O4 - (100-x)LaFeO3 with different weight percent of core-shell structured CoFe2O4 (x = 0,20,40,50,80,100) and LaFeO3 were fabricated, via a two-step sol-gel wet-chemical synthesis technique. The phase formation of the composites was confirmed by X-ray diffraction and the structural parameters of both the phases were attained from the Rietveld refinement results of XRD patterns. The elemental composition and microstructure of the resulting nanocomposites were examined by using energy-dispersive X-ray spectroscopy (EDX) and high-resolution transmission electron microscopy (HRTEM) technique, respectively. The detailed magnetometry studies at 300 K and 5 K reveal that the inter-and intra-phase magnetic interactions affect the saturation magnetization (MS), remanence magnetization (MR) and coercivity (HC) values of this bi-magnetic system. The remarkable feature of “pinched magnetic hysteresis loop” was evidenced in the [(50) CoFe2O4 - (50)LaFeO3] composite, leading to a lesser magnetic loss factor and better magnetic performance of this sample. The report depicts an improved interfacial exchange coupling at 5 K, for the nanocomposites of core-shell morphology and offers an understanding or explanation of improved magnetic performance for the (50)CoFe2O4 - (50)LaFeO3 nanocomposite and opens up an important way to design new multiferroic applications in low magnetic fields.

Empirical Modeling of Stream Nutrients for Countries without Robust Water Quality Monitoring Systems

Water quality models are useful tools to understand and mitigate eutrophication processes. However, gaining access to high-resolution data and fitting models to local conditions can interfere with their implementation. This paper analyzes whether it is possible to create a spatial model of nutrient water level at a local scale that is applicable in different geophysical and land-use conditions. The total nitrogen and phosphorus concentrations were modeled by integrating Geographical Information Systems, Remote Sensing, and Generalized Additive and Land-Use Changes Modeling. The research was based on two case studies, which included 204 drainage basins, with nutrient and limnological data collected during two seasons. The models performed well under local conditions, with small errors calculated from the independent samples. The recorded and predicted concentrations of nutrients indicated a significant risk of water eutrophication in both areas, showing the impact of agricultural intensification and population growth on water quality. The models are a contribution to the sustainable land-use planning process, which can help to prevent or promote land-use transformation and new practices in agricultural production and urban design. The ability to implement models using secondary information, which is easily collected at a low cost, is the most remarkable feature of this approach.

Unraveling the genetic architecture of hepatoblastoma risk: birth defects and increased burden of germline damaging variants in gastrointestinal/renal cancer predisposition and DNA repair genes

The ultrarare hepatoblastoma is the most common pediatric liver cancer. HB risk is related to a few rare syndromes, and the molecular bases remain elusive for most cases. We investigated the burden of rare damaging germline variants in 30 Brazilian patients with HB. A high frequency of prematurity (20%) and birth defects (37%), especially craniofacial (17%, including craniosynostosis) and kidney (7%) anomalies, was observed. Pathogenic or likely pathogenic variants mapped to 10 cancer predisposition genes (APC, CHEK2, DROSHA, ERCC5, FAH, MSH2, MUTYH, RPS19, TGFBR2 and VHL,) were detected in 33% of the patients, only 40% of them with a family history of cancer. These findings showed a predominance of CPGs with a known link to gastrointestinal/colorectal and renal cancer risk. A remarkable feature was an enrichment of rare damaging variants affecting different classes of DNA repair genes, particularly those known as Fanconi anemia genes. Moreover, several damaging rare variants mapped to genes impacting liver functions were observed. To our knowledge, this is the first comprehensive assessment of rare germline variants in HB patients, contributing to elucidating the genetic architecture of HB risk.

The Sogdians and Their Religions in Turfan: Evidence in the Catalogue of the Middle Iranian Fragments in Sogdian Script of the Berlin Turfan Collection

We are able to verify the variety of the religions of the Sogdians by the text fragments found in the Turfan oasis (East Turkistan, today’s Xinjiang Autonomous Region of China). They are housed in several libraries and museums in Europe, Japan, and China. The Berlin Turfan collection contains a large part of them. The catalogue of the Sogdian text fragments in the indigenous Sogdian script of that collection was completed in 2018. The fragments represent parts of the literature of Christian, Manichaean and Buddhist communities in Turfan from the eighth to eleventh century CE. The best represented religion in the homeland of the Sogdians is a type of the Zoroastrian religion, as evidenced by archaeological findings and wall paintings. However, there are only very few texts found in Turfan and other locations in Central Asia which could be interpreted as Zoroastrian. The discussion about the religious affiliation of those texts is going on. The religious background of some other text fragments from Turfan is difficult to identify as well. Two of these examples will be published here. A remarkable feature of the religious communities in Turfan is the multilingual character of their literature, reflecting the development and path of the believers and the multi-ethnical structure of the community.