Pseudocochlodinium profundisulcus Resting Cysts Detected in the Ballast Tank Sediment of Ships Arriving in the Ports of China and North America and the Implications in the Species’ Geographic Distribution and Possible Invasion

Over the past several decades, much attention has been focused on the dispersal of aquatic nonindigenous species via ballast tanks of shipping vessels worldwide. The recently reclassified dinoflagellate Pseudocochlodinium profundisulcus (previously identified as Cochlodinium sp., Cochlodinium geminatum, or Polykrikos geminatus) was not reported in China until 2006. However, algal blooming events caused by this organism have been reported almost every year since then in the Pearl River Estuary and its adjacent areas in China. Whether P. profundisulcus is an indigenous or an invasive species has thus become an ecological question of great scientific and practical significance. In this study, we collected the sediments from ballast tanks of ships arriving in the ports of China and North America and characterized dinoflagellate resting cysts via a combined approach. We germinated two dark brownish cysts from the tank of an international ship (Vessel A) arriving at the Jiangyin Port (China) into vegetative cells and identified them as P. profundisulcus by light and scanning electron microscopy and phylogenetic analyses for partial LSU rDNA sequences. We also identified P. profundisulcus cyst from the ballast tank sediment of a ship (Vessel B) arriving in the port of North America via single-cyst PCR and cloning sequencing, which indicated that this species could be transported as resting cyst via ship. Since phylogenetic analyses based on partial LSU rDNA sequences could not differentiate all sequences among our cysts from those deposited in the NCBI database into sub-groups, all populations from China, Australia, Japan, and the original sources from which the cysts in the two vessels arrived in China and North America were carried over appeared to share a very recent common ancestor, and the species may have experienced a worldwide expansion recently. These results indicate that P. profundisulcus cysts may have been extensively transferred to many regions of the world via ships’ ballast tank sediments. While our work provides an exemplary case for both the feasibility and complexity (in tracking the source) of the bio-invasion risk via the transport of live resting cysts by ship’s ballast tanks, it also points out an orientation for future investigation.

Amyloid Precursor Protein A713T Mutation in Calabrian Patients with Alzheimer’s Disease: A Population Genomics Approach to Estimate Inheritance from a Common Ancestor

Mutation A713T in the amyloid precursor protein (APP) has been linked to cases of Alzheimer’s disease (AD), cerebral amyloid angiopathy (CAA) and cerebrovascular disease. Despite its rarity, it has been observed in several families from the same geographical area, in the Calabria region in Southern Italy. Genotyping of 720,000 genome-wide SNPs with the HumanOmniExpress BeadChip was performed for six patients that were representative of apparently unrelated Calabrian families, as well as a Belgian subject of Italian descent (all with the same A713T mutation and disease). Their genomic structure and genetic relationships were analyzed. Demographic reconstruction and coalescent theory were applied to estimate the time of the most recent common ancestor (tMRCA) among patients. Results show that all A713T carriers fell into the genetic variability of Southern Italy and were not more closely related to each other than to any other healthy Calabrian individual. However, five out of seven patients shared a 1.7 Mbp-long DNA segment centered on the A713T mutation, making it possible to estimate a tMRCA for its common origin in the Calabrian region dating back over 1000 years. The analysis of affected individuals with methodologies based on human population genomics thus provides informative insights in support of clinical observations and biomedical research.

Treponema pallidum genome sequencing from six continents reveals variability in vaccine candidate genes and dominance of Nichols clade strains in Madagascar

In spite of its immutable susceptibility to penicillin, Treponema pallidum (T. pallidum) subsp. pallidum continues to cause millions of cases of syphilis each year worldwide, resulting in significant morbidity and mortality and underscoring the urgency of developing an effective vaccine to curtail the spread of the infection. Several technical challenges, including absence of an in vitro culture system until very recently, have hampered efforts to catalog the diversity of strains collected worldwide. Here, we provide near-complete genomes from 196 T. pallidum strains–including 191 T. pallidum subsp. pallidum–sequenced directly from patient samples collected from 8 countries and 6 continents. Maximum likelihood phylogeny revealed that samples from most sites were predominantly SS14 clade. However, 99% (84/85) of the samples from Madagascar formed two of the five distinct Nichols subclades. Although recombination was uncommon in the evolution of modern circulating strains, we found multiple putative recombination events between T. pallidum subsp. pallidum and subsp. endemicum, shaping the genomes of several subclades. Temporal analysis dated the most recent common ancestor of Nichols and SS14 clades to 1717 (95% HPD: 1543–1869), in agreement with other recent studies. Rates of SNP accumulation varied significantly among subclades, particularly among different Nichols subclades, and was associated in the Nichols A subclade with a C394F substitution in TP0380, a ERCC3-like DNA repair helicase. Our data highlight the role played by variation in genes encoding putative surface-exposed outer membrane proteins in defining separate lineages, and provide a critical resource for the design of broadly protective syphilis vaccines targeting surface antigens.

Whole-genome analysis-based phylogeographic investigation of Streptococcus pneumoniae serotype 19A sequence type 320 isolates in Japan.

After the introduction of the seven-valent pneumococcal conjugate vaccine, the global spread of multidrug resistant serotype 19A-ST320 strains became a public health concern. In Japan, the main genotype of serotype 19A was ST3111, and the identification rate of ST320 was low. Although the isolates were sporadically detected in both adults and children, their origin remains unknown. Thus, by combining pneumococcal isolates collected in three nationwide pneumococcal surveillance studies conducted in Japan between 2008 and 2020, we analyzed 56 serotype 19A-ST320 isolates along with 931 global isolates, using whole-genome sequencing to uncover the transmission route of the globally distributed clone in Japan. The clone was frequently detected in Okinawa Prefecture, where the U.S. returned to Japan in 1972. Phylogenetic analysis demonstrated that the isolates from Japan were genetically related to those from the U.S.; therefore, the common ancestor may have originated in the U.S. In addition, Bayesian analysis suggested that the time to the most recent common ancestor of the isolates form Japan and the U.S. was approximately the 1990s to 2000, suggesting the possibility that the common ancestor could have already spread in the U.S. before the Taiwan 19F-14 isolate was first identified in a Taiwanese hospital in 1997. The phylogeographical analysis supported the transmission of the clone from the U.S. to Japan, but the analysis could be influenced by sampling bias. These results suggested the possibility that the serotype 19A-ST320 clone had already spread in the U.S. before being imported into Japan.

TopHap: Rapid inference of key phylogenetic structures from common haplotypes in large genome collections with limited diversity

Motivation: Building reliable phylogenies from very large collections of sequences with a limited number of phylogenetically informative sites is challenging because sequencing errors and recurrent/backward mutations interfere with the phylogenetic signal, confounding true evolutionary relationships. Massive global efforts of sequencing genomes and reconstructing the phylogeny of SARS-CoV-2 strains exemplify these difficulties since there are only hundreds of phylogenetically informative sites and millions of genomes. For such datasets, we set out to develop a method for building the phylogenetic tree of genomic haplotypes consisting of positions harboring common variants to improve the signal-to-noise ratio for more accurate phylogenetic inference of resolvable phylogenetic features. Results: We present the TopHap approach that determines spatiotemporally common haplotypes of common variants and builds their phylogeny at a fraction of the computational time of traditional methods. To assess topological robustness, we develop a bootstrap resampling strategy that resamples genomes spatiotemporally. The application of TopHap to build a phylogeny of 68,057 genomes (68KG) produced an evolutionary tree of major SARS-CoV-2 haplotypes. This phylogeny is concordant with the mutation tree inferred using the co-occurrence pattern of mutations and recovers key phylogenetic relationships from more traditional analyses. We also evaluated alternative roots of the SARS-CoV-2 phylogeny and found that the earliest sampled genomes in 2019 likely evolved by four mutations of the most recent common ancestor of all SARS-CoV-2 genomes. An application of TopHap to more than 1 million genomes reconstructed the most comprehensive evolutionary relationships of major variants, which confirmed the 68KG phylogeny and provided evolutionary origins of major variants of concern. Availability: TopHap is available on the web at https://github.com/SayakaMiura/TopHap.

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

Phylogeography and Re-Evaluation of Evolutionary Rate of Powassan Virus Using Complete Genome Data

In this paper, we revealed the genetic structure and migration history of the Powassan virus (POWV) reconstructed based on 25 complete genomes available in NCBI and ViPR databases (accessed in June 2021). The usage of this data set allowed us to perform a more precise assessment of the evolutionary rate of this virus. In addition, we proposed a simple Bayesian technique for the evaluation and visualization of ‘temporal signal dynamics’ along the phylogenetic tree. We showed that the evolutionary rate value of POWV is 3.3 × 10−5 nucleotide substitution per site per year (95% HPD, 2.0 × 10−5–4.7 × 10−5), which is lower than values reported in the previous studies. Divergence of the most recent common ancestor (MRCA) of POWV into two independent genetic lineages most likely occurred in the period between 2600 and 6030 years ago. We assume that the divergence of the virus lineages happened due to the melting of glaciers about 12,000 years ago, which led to the disappearance of the Bering Land Bridge between Eurasia and North America (the modern Alaskan territory) and spatial division of the viral areal into two parts. Genomic data provide evidence of the virus migrations between two continents. The mean migration rate detected from the Far East of Russia to North America was one event per 1750 years. The migration to the opposite direction occurred approximately once per 475 years.

Historical biogeography of early diverging termite lineages (Isoptera: Teletisoptera)

Termites are social cockroaches distributed throughout warm temperate and tropical ecosystems. The ancestor of modern termites (crown-Isoptera) occurred during the earliest Cretaceous, approximately 140 million years ago, suggesting that both vicariance through continental drift and overseas dispersal may have shaped the distribution of early diverging termite lineages. We reconstruct the historical biogeography of three early diverging termite families – Stolotermitidae, Hodotermitidae, and Archotermopsidae – using the nuclear rRNA genes and mitochondrial genomes of 27 samples. Our analyses confirmed the monophyly of Stolotermitidae + Hodotermitidae + Archotermopsidae (clade Teletisoptera), with Stolotermitidae diverging from a monophyletic Hodotermitidae + Archotermopsidae approximately 100.3 Ma (94.3–110.4 Ma, 95% HPD), and with Archotermopsidae paraphyletic to a monophyletic Hodotermitidae. The Oriental Archotermopsis and the Nearctic Zootermopsis diverged 50.8 Ma (40.7–61.4 Ma, 95% HPD) before land connections between the Palearctic region and North America ceased to exist. The African Hodotermes + Microhodotermes diverged from Anacanthotermes, a genus found in Africa and Asia, 32.1 Ma (24.8–39.9 Ma, 95% HPD), and the most recent common ancestor of Anacanthotermes lived 10.7 Ma (7.3–14.3 Ma, 95% HPD), suggesting that Anacanthotermes dispersed to Asia using the land bridge connecting Africa and Eurasia ∼18–20 Ma. In contrast, the common ancestors of modern Porotermes and Stolotermes lived 20.2 Ma (15.7–25.1 Ma, 95% HPD) and 26.6 Ma (18.3–35.6 Ma, 95% HPD), respectively, indicating that the presence of these genera in South America, Africa, and Australia involved over-water dispersals. Our results suggest that early diverging termite lineages acquired their current distribution through a combination of over-water dispersals and dispersal via land bridges. We clarify the classification by resolving the paraphyly of Archotermopsidae, restricting the family to Archotermopsis and Zootermopsis, and elevating Hodotermopsinae (Hodotermopsis) as Hodotermopsidae (status novum).

Target enrichment of long open reading frames and ultraconserved elements to link microevolution and macroevolution in non-model organisms

Despite the increasing accessibility of high-throughput sequencing, obtaining high-quality genomic data on non-model organisms without proximate well-assembled and annotated genomes remains challenging. Here we describe a workflow that takes advantage of distant genomic resources and ingroup transcriptomes to select and jointly enrich long open reading frames (ORFs) and ultraconserved elements (UCEs) from genomic samples for integrative studies of microevolutionary and macroevolutionary dynamics. This workflow is applied to samples of the African unionid bivalve tribe Coelaturini (Parreysiinae) at basin and continent-wide scales. Our results indicate that ORFs are efficiently captured without prior identification of intron-exon boundaries. The enrichment of UCEs was less successful, but nevertheless produced a substantial dataset. Exploratory continent-wide phylogenetic analyses with ORF supercontigs (>515,000 parsimony informative sites) resulted in a fully resolved phylogeny, the backbone of which was also retrieved with UCEs (>11,000 informative sites), although some branches lack support in the latter case. Variant calling on the exome of Coelaturini from the Malawi Basin produced ~2,000 SNPs per population pair. Nucleotide diversity and population differentiation was low compared to previous estimates in mollusks, but comparable to those in recently diversifying Malawi cichlids and other taxa at an early stage of speciation. Skimming non-specific sequence data obtained for Coelaturini of the Malawi Basin, we reconstructed the maternally-inherited mitogenome, which displays an identical gene order to that of the most recent common ancestor of Unionidae. Overall, our workflow and results provide exciting perspectives for the development of integrative genomic studies on micro- and macroevolutionary dynamics in non-model organisms.

Integrating transcriptomes to investigate genes associated with adaptation to aquatic environments, and assess phylogenetic conflict and whole-genome duplications in Alismatales

Land plants first evolved from freshwater algae, and flowering plants returned to water as early as the Cretaceous and multiple times beyond. Alismatales is the largest clade of aquatic angiosperms including all marine angiosperms, as well as terrestrial plants. We used Alismatales to explore plant adaptation to aquatic environments by including 95 samples (89 Alismatales species) covering four genomes and 91 transcriptomes (59 generated in this study). To provide a basis for investigating adaptation, we assessed phylogenetic conflict and whole-genome duplication (WGD) events in Alismatales. We recovered a relationship for the three main clades in Alismatales as ((Tofieldiaceae, Araceae), core Alismatids). There is phylogenetic conflict among the backbone of the three main clades that could be due to incomplete lineage sorting and introgression. We identified 18 putative WGD events. One of them had occurred at the most recent common ancestor of core Alismatids, and four occurred at seagrass lineages. Other events are distributed in terrestrial, emergent, and submersed life-forms and seagrasses across Alismatales. We also found that lineage and life-form were each important for different evolutionary patterns for the genes related to freshwater/marine adaptation. For example, some light or ethylene-related genes were lost in the seagrass Zosteraceae, but present in other seagrasses and freshwater species. Stomata-related genes were lost in both submersed freshwater species and seagrasses. Nicotianamine synthase genes, which are important in iron intake, expanded in both submersed freshwater species and seagrasses. Our results advance the understanding of the adaptation to aquatic environments, phylogeny, and whole-genome duplication of Alismatales.