scholarly journals Citrate Mediated Europium-Based Detection of Oxytetracycline in Citrus Tissues

Antibiotics ◽  
2021 ◽  
Vol 10 (5) ◽  
pp. 566
Author(s):  
Faraj Hijaz ◽  
Yasser Nehela ◽  
Ozgur Batuman ◽  
Nabil Killiny
Keyword(s):  
Solid Phase ◽  
Plant Diseases ◽  
Cetyltrimethylammonium Chloride ◽  
Candidatus Liberibacter Asiaticus ◽  
Citrus Greening Disease ◽  
Sample Extract ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Reliable Methods ◽  
The Eu

Oxytetracycline (OTC) and streptomycin have been used for the control of several plant diseases and were recently permitted for the control of citrus greening disease, Huanglongbing. Consequently, sensitive and reliable methods are highly needed for the detection of OTC in citrus tissues. Herein, we studied the replacement of cetyltrimethylammonium chloride (CTAC) by citrate (Cit) as a sensitizing agent for the analysis of OTC in citrus tissues using the recently established europium (Eu) method. In addition, we determined the optimal conditions for the formation of the Eu-OTC-Cit ternary complex in tris buffer. Our results showed that the plant matrix significantly decreased the fluorescence intensity of the Eu-OTC-Cit complex even after the replacement of CTAC. Our investigations showed that phenols such as gallic acid degrade slowly at high pH and their degradation was enhanced in the presence of the (Eu+3) cation. To reduce the plant matrix interference, the sample extract was cleaned using solid-phase extraction (SPE). The OTC recoveries from spiked healthy and Candidatus Liberibacter asiaticus (CLas)-infected trees were 91.4 ± 7.8% and 82.4 ± 3.9%, respectively. We also used the citrate method to determine the level of OTC in trunk-injected trees. The level of OTC as measured using the Eu-OTC-Cit complex (117.5 ± 20.3 µg g−1 fresh weight “FWT”) was similar to that measured using Eu-OTC-CTAC complex (97.5 ± 14 µg g−1 FWT). In addition, we were able to visualize the OTC in citrus leaf extract, under ultraviolet light (400 nm), after it was cleaned with the SPE. Our study showed that the citrate can be successfully used to replace the harmful CTAC surfactant, which could also react with phenols.

scholarly journals Viability of ‘Candidatus Liberibacter asiaticus’ Prolonged by Addition of Citrus Juice to Culture Medium

2014 ◽  
Vol 104 (1) ◽  
pp. 15-26 ◽  
Author(s):  
Jennifer K. Parker ◽  
Sarah R. Wisotsky ◽  
Evan G. Johnson ◽  
Faraj M. Hijaz ◽  
Nabil Killiny ◽  
...  
Keyword(s):  
Grapefruit Juice ◽  
Culture Medium ◽  
Quantitative Polymerase Chain Reaction ◽  
Chemical Characterization ◽  
Candidatus Liberibacter Asiaticus ◽  
Citrus Greening Disease ◽  
Candidatus Liberibacter ◽  
The Media ◽  
Liberibacter Asiaticus

Huanglongbing, or citrus greening disease, is associated with infection by the phloem-limited bacterium ‘Candidatus Liberibacter asiaticus’. Infection with ‘Ca. L. asiaticus’ is incurable; therefore, knowledge regarding ‘Ca. L. asiaticus’ biology and pathogenesis is essential to develop a treatment. However, ‘Ca. L. asiaticus’ cannot currently be successfully cultured, limiting its study. To gain insight into the conditions conducive for growth of ‘Ca. L. asiaticus’ in vitro, ‘Ca. L. asiaticus’ inoculum obtained from seed of fruit from infected pomelo trees (Citrus maxima ‘Mato Buntan’) was added to different media, and cell viability was monitored for up to 2 months using quantitative polymerase chain reaction in conjunction with ethidium monoazide. Media tested included one-third King's B (K), K with 50% juice from the infected fruit, K with 50% commercially available grapefruit juice, and 100% commercially available grapefruit juice. Results show that juice-containing media dramatically prolong viability compared with K in experiments reproduced during 2 years using different juice sources. Furthermore, biofilm formed at the air–liquid interface of juice cultures contained ‘Ca. L. asiaticus’ cells, though next-generation sequencing indicated that other bacterial genera were predominant. Chemical characterization of the media was conducted to discuss possible factors sustaining ‘Ca. L. asiaticus’ viability in vitro, which will contribute to future development of a culture medium for ‘Ca. L. asiaticus’.

scholarly journals ‘Candidatus Liberibacter asiaticus’ Encodes a Functional Salicylic Acid (SA) Hydroxylase That Degrades SA to Suppress Plant Defenses

2017 ◽  
Vol 30 (8) ◽  
pp. 620-630 ◽  
Author(s):  
Jinyun Li ◽  
Zhiqian Pang ◽  
Pankaj Trivedi ◽  
Xiaofeng Zhou ◽  
Xiaobao Ying ◽  
...  
Keyword(s):  
Salicylic Acid ◽  
Enzymatic Activity ◽  
Plant Defenses ◽  
Plant Diseases ◽  
Transgenic Tobacco Plants ◽  
Candidatus Liberibacter Asiaticus ◽  
Tobacco Plants ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Management Approaches

Pathogens from the fastidious, phloem-restricted ‘Candidatus Liberibacter’ species cause the devastating Huanglongbing (HLB) disease in citrus worldwide and cause diseases on many solanaceous crops and plants in the Apiaceae family. However, little is known about the pathogenic mechanisms due to the difficulty in culturing the corresponding ‘Ca. Liberibacter’ species. Here, we report that the citrus HLB pathogen ‘Ca. L. asiaticus’ uses an active salicylate hydroxylase SahA to degrade salicylic acid (SA) and suppress plant defenses. Purified SahA protein displays strong enzymatic activity to degrade SA and its derivatives. Overexpression of SahA in transgenic tobacco plants abolishes SA accumulation and hypersensitive response (HR) induced by nonhost pathogen infection. By degrading SA, ‘Ca. L. asiaticus’ not only enhances the susceptibility of citrus plants to both nonpathogenic and pathogenic Xanthomonas citri but also attenuates the responses of citrus plants to exogenous SA. In addition, foliar spraying of 2,1,3-benzothiadiazole and 2,6-dichloroisonicotinic acid, SA functional analogs not degradable by SahA, displays comparable (and even better) effectiveness with SA in suppressing ‘Ca. L. asiaticus’ population growth and HLB disease progression in infected citrus trees under field conditions. This study demonstrates one or more pathogens suppress plant defenses by degrading SA and establish clues for developing novel SA derivatives-based management approaches to control the associated plant diseases.

scholarly journals Volatile compounds of Persian and Mexican lime associated with HLB (Huanglongbing) symptoms

2018 ◽  
Vol 44 (1) ◽  
pp. 19 ◽  
Author(s):  
Estrella Mendoza-Peña ◽  
Juan Cibrián-Tovar ◽  
Julio Velázquez-González ◽  
Felipe Tafoya-Rangel ◽  
Ausencio Azuara-Domínguez
Keyword(s):  
Early Detection ◽  
Volatile Compounds ◽  
Solid Phase ◽  
Diagnostic Strategy ◽  
Candidatus Liberibacter Asiaticus ◽  
Mass Selective Detector ◽  
Selective Detector ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
And Control

The bacterium Candidatus Liberibacter asiaticus is the pathogen that causes the disease known as Huanglongbing (HLB) in citrus. During the course of the disease, the bacterium affects citrus plant phloem tissues, but their leaves remain asymptomatic for HLB for months to years after initial infection. This limits the early detection and control of the bacterium in infected trees. Therefore, in order to design a diagnostic strategy for HLB, the aim of this study was to quantify the abundance and concentration of the volatile compounds released from young shoots of the Persian lemon (Citrus latifolia Tanaka) and the Mexican lemon [Citrus aurantifolia (Christm.) Swingle] with and without HLB symptoms. The volatiles emitted by young shoots were captured by Solid Phase Microextraction (SPME) and analyzed in a gas chromatograph coupled to a mass selective detector (CG / MS). The results clearly indicate that young shoots with and without HLB symptoms released different abundances and concentrations of volatile compounds. The compounds: D-limonene, β-ocimene, and caryophyllene were collected at higher concentrations in the young shoots of both lemon species with HLB symptoms. This result shows the feasibility of designing a strategy for early detection of the disease in different species of lemon through recognition of patterns and concentrations of volatile compounds released from infected trees.

scholarly journals Genetic Diversity of the Indian Populations of ‘Candidatus Liberibacter asiaticus’ Based on the Tandem Repeat Variability in a Genomic Locus

2015 ◽  
Vol 105 (8) ◽  
pp. 1043-1049 ◽  
Author(s):  
Dilip Kumar Ghosh ◽  
Sumit Bhose ◽  
Manali Motghare ◽  
Ashish Warghane ◽  
Krishanu Mukherjee ◽  
...  
Keyword(s):  
Tandem Repeat ◽  
Tandem Repeats ◽  
Economic Loss ◽  
Class Iii ◽  
Candidatus Liberibacter Asiaticus ◽  
Genomic Locus ◽  
Citrus Greening Disease ◽  
Geographical Regions ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus

Citrus huanglongbing (HLB, citrus greening disease) is an extremely destructive disease affecting citrus and causes severe economic loss to the crop yield worldwide. The disease is caused by a phloem-limited, noncultured, gram-negative bacteria Candidatus Liberibacter spp., the widely present and most destructive species being ‘Candidatus Liberibacter asiaticus’. Although the disease has been reported from almost all citrus growing regions of India, knowledge on the molecular variability of the pathogen ‘Ca. L. asiaticus’ populations from different geographical regions and cultivars is limited. In the present study, variability of the Indian ‘Ca. L. asiaticus’ based on the tandem repeats at the genomic locus CLIBASIA_01645 was characterized and categorized into four classes based on the tandem repeat number (TRN); Class I (TRN ≤ 5), Class II (TRN > 5 ≤ 10), Class III (TRN > 10 ≤ 15), and Class IV (TRN > 15). The study revealed that the Indian population of ‘Ca. L. asiaticus’ is more diverse than reported for Florida and Guangdong populations, which showed less diversity. While Florida and Guangdong populations were dominated by a TRN5 and TRN7 genotype, respectively, the Indian ‘Ca. L. asiaticus’ populations with TRN copy numbers 9, 10, 11, 12, and 13 were widely distributed throughout the country. Additionally, TRN2 and TRN17 genotypes were also observed among the Indian ‘Ca. L. asiaticus’ populations. The predominant ‘Ca. L. asiaticus’ genotypes from the northeastern region of India were TRN6 and TRN7 (53.12%) and surprisingly similar to neighboring South China populations. Preliminary results showed absence of preference of citrus cultivars to any specific ‘Ca. L. asiaticus’ genotype.

scholarly journals First Report of Citrus Greening Disease and Associated Bacterium “Candidatus Liberibacter asiaticus” from Bhutan

Plant Disease ◽  
2003 ◽  
Vol 87 (4) ◽  
pp. 448-448 ◽  
Author(s):  
Y. S. Ahlawat ◽  
V. K. Baranwal ◽  
Thinlay ◽  
Doe Doe ◽  
S. Majumder
Keyword(s):  
Citrus Greening ◽  
Ribosomal Protein Genes ◽  
Candidatus Liberibacter Asiaticus ◽  
African Countries ◽  
First Report ◽  
Citrus Greening Disease ◽  
Pcr Product ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Greening Disease

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

scholarly journals Production of monoclonal antibody against Ompa protein of Candidatus Liberibacter asiaticus causing citrus greening disease

2020 ◽  
Vol 18 (3) ◽  
pp. 529-541
Author(s):  
Ho Thi Thuong ◽  
Nguyen Thi Thom ◽  
Nguyen Thi Tra ◽  
Trinh Thai Vy ◽  
Pham Bich Ngoc ◽  
...  
Keyword(s):  
Strong Interaction ◽  
Research Direction ◽  
Citrus Greening ◽  
Candidatus Liberibacter Asiaticus ◽  
Citrus Greening Disease ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Ompa Protein ◽  
Greening Disease ◽  
Vhh Antibodies

Citrus Greening, also known as HuangLongbing (HLB), is considered one of the most dangerous citrus diseases, and limiting the production of citrus trees all over the world. Production of antibodies against Ompa protein of Candidatus Liberibacter asiaticus (CLas) for detection of citrus greening disease is considered as promising research direction. In this study, for the purpose of producting antibodies against Ompa of CLas, we firstly used the camel VHH antibody library for screening VHH antibodies against Ompa using phage-display technique. Next, phages which had strong interaction with Ompa as shown in ELISA were selected for phagemid isolation and the DNA fragments encoding VHH antibodies were sequenced. The DNA fragment encoding the best VHH antibody was then selected and inserted into the expression vector pET-21a (+), then cloned in Ecoli DH5α strain and expressed in BL21 (DE3) strain. The expression of VHH antibodies against Ompa was optimized at different temperatures with an inductive concentration of 0.1 M IPTG. Anti-Ompa VHH antibodies were purified under denatured conditions then re-folded. The biological activity of the VHH antibody with Ompa antigen was assessed by indirect-ELISA reaction. Results indicated that the VHH antibody had a very strong interaction with the Ompa antigen. This opens up the prospect of applying VHH antibody in the detection of citrus greening disease.

scholarly journals Understanding Citrus Greening Disease and Its Possible Management Strategies in Nepal

2021 ◽  
Vol 9 (4) ◽  
pp. 227-234
Author(s):  
Sameer Pokhrel ◽  
Swikriti Pandey ◽  
Ashish Ghimire ◽  
Savyata Kandel
Keyword(s):  
Management Strategies ◽  
Citrus Greening ◽  
Insect Vector ◽  
Candidatus Liberibacter Asiaticus ◽  
Citrus Greening Disease ◽  
The World ◽  
Citrus Production ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Citrus Orchards

Huanglongbing (HLB), also known as citrus greening, is a devastating disease of citrus that has decimated several citrus orchards throughout the world. The disease is associated with three species of unculturable and phloem-limited bacteriae, Candidatus Liberibacter asiaticus, Candidatus Liberibacter africanus and Candidatus Liberibacter americanus. The most common species of bacteria found in Nepal is Candidatus Liberibacter asiaticus which is transmitted by an insect vector, Asian citrus psyllid (Diaphorina citri). This disease has been detected in several economically important citrus production areas of Nepal, which resulted in heavy yield loss. No cure for the disease has been discovered yet and it is essential to practice proper management strategies to maintain citrus health and sustain citrus production under HLB pressure. Several disease management approaches such as pathogen-free nursery establishment, use of disease tolerant rootstock cultivars, proper irrigation and nutrient supply, removal of HLB affected trees, and control of psyllid with frequent insecticide application are widely practiced throughout the world. This review article highlights the characteristics of the citrus greening disease and its insect vector and gives insights into their management techniques. Several technologically advanced options available to minimize the HLB infection might not be feasible currently in Nepal due to economic and topographic constraints. This article also aims to bring into focus the cost-effective methods that growers in Nepal can practice to mitigate the impact of HLB disease in their citrus orchards. Int. J. Appl. Sci. Biotechnol. Vol 9(4): 227-238.

Sign in / Sign up

Export Citation Format

Share Document