Molecularly Imprinted Nanoparticles Based Sensor for Cocaine Detection

The development of a sensor based on molecularly imprinted polymer nanoparticles (nanoMIPs) and electrochemical impedance spectroscopy (EIS) for the detection of trace levels of cocaine is described in this paper. NanoMIPs for cocaine detection, synthesized using a solid phase, were applied as the sensing element. The nanoMIPs were first characterized by Transmission Electron Microscopy (TEM) and Dynamic Light Scattering and found to be ~148.35 ± 24.69 nm in size, using TEM. The nanoMIPs were then covalently attached to gold screen-printed electrodes and a cocaine direct binding assay was developed and optimized, using EIS as the sensing principle. EIS was recorded at a potential of 0.12 V over the frequency range from 0.1 Hz to 50 kHz, with a modulation voltage of 10 mV. The nanoMIPs sensor was able to detect cocaine in a linear range between 100 pg mL−1 and 50 ng mL−1 (R2 = 0.984; p-value = 0.00001) and with a limit of detection of 0.24 ng mL−1 (0.70 nM). The sensor showed no cross-reactivity toward morphine and a negligible response toward levamisole after optimizing the sensor surface blocking and assay conditions. The developed sensor has the potential to offer a highly sensitive, portable and cost-effective method for cocaine detection.

Download Full-text

Preparation and characterization of molecularly imprinted solid-phase extraction column coupled with high-performance liquid chromatography for selective determination of melamine

Royal Society Open Science ◽

10.1098/rsos.180750 ◽

2018 ◽

Vol 5 (9) ◽

pp. 180750 ◽

Cited By ~ 3

Author(s):

Q. Zhou ◽

X. C. Tan ◽

X. J. Guo ◽

Y. J. Huang ◽

H. Y. Zhai

Keyword(s):

Solid Phase Extraction ◽

High Performance ◽

Limit Of Detection ◽

Solid Phase ◽

Cost Effective ◽

Extraction Column ◽

Phase Extraction ◽

Molecularly Imprinted ◽

Selective Determination ◽

Solid Phase Extraction Column

We synthesized a selective molecularly imprinted solid-phase extraction (MIP-SPE) column and established an extraction and enrichment method using this MIP-SPE column. By coupling with HPLC, we developed a new method to detect trace amounts of melamine in eggs. The MIP-SPE column was synthesized by in situ thermal-initiated polymerization using melamine as the template, methacrylic acid as the functional monomer, ethylene glycol dimethacrylate as the cross-linker and azodiisobutyronitrile as the initiator. HPLC was used to evaluate the identification and enrichment capability of the MIP-SPE column and for the measurement of melamine in the sample. The melamine concentration exhibited an excellent linear relationship in the range of 0.1–25.0 µg ml −1 ( r = 0.9983). The identification capability of the MIP-SPE column was apparently superior to that of the non-imprinted polymer solid-phase extraction column; an average enrichment factor of 46.8-fold (RSD = 3.5%) was obtained for 0.4 µg ml −1 melamine by the MIP-SPE column. When the MIP-SPE HPLC method was applied to the detection of melamine in eggs, an average recovery rate of 93.5–102.0% (RSD = 3.6–4.9%) and a limit of detection of 0.05 µg kg −1 were obtained. This method is simple, fast and cost-effective; thus, it can greatly simplify the pre-treatment of complex samples and can be used in the detection of residual melamine in eggs and other products.

Download Full-text

Competitive pseudo-ELISA based on molecularly imprinted nanoparticles for microcystin-LR detection in water

Pure and Applied Chemistry ◽

10.1515/pac-2018-1207 ◽

2019 ◽

Vol 91 (10) ◽

pp. 1593-1604

Author(s):

Yadiris Garcia ◽

Francesco Canfarotta ◽

Katarzyna Smolinska-Kempisty ◽

Sergey A. Piletsky ◽

Eduardo Pereira

Keyword(s):

Water Samples ◽

Limit Of Detection ◽

Cost Effective ◽

Cross Reactivity ◽

Molecularly Imprinted ◽

The Public ◽

Analytical Recovery ◽

Cost Effective Alternative ◽

Molecularly Imprinted Nanoparticles ◽

The Stability

Abstract Microcystins (MCs) are dangerous cyanotoxins for the public health, and microcystin-LR (MC-LR) is one of most toxic, dangerous, and frequently found in water bodies. Typically, the detection of MCs is carried out by means of competitive ELISAs which, however, need special precautions for handling and storage, due to the stability of the antibodies used in this test. Molecularly imprinted nanoparticles (nanoMIPs) represents more robust and cost-effective alternative to antibodies. In this work, we developed a competitive pseudo-ELISA based on nanoMIPs (which are used in place of natural antibodies), for the detection of microcystin-LR (MC-LR). This pseudo-ELISA showed a linear response towards MC-LR, showing high affinity and low cross-reactivity against another analogue toxin (microcystin-YR). The analytical recovery of MC-LR in the analysis of water samples by the proposed pseudo-ELISA was 96 %–130 % and the limit of detection was 2.64 × 10−4 nM. The obtained results suggest that this competitive pseudo-ELISA could have high potential in the detection of toxins, due to its rapid, sensitive and accurate detection of toxin in water samples.

Download Full-text

Coupling multiplex pre-amplification and droplet digital PCR for longitudinal monitoring ofESR1andPIK3CAmutations from plasma cell-free DNA

10.1101/598847 ◽

2019 ◽

Author(s):

Huilan Yao ◽

Grant Wu ◽

Subhasree Das ◽

Crystal MacKenzie ◽

Hua Gao ◽

...

Keyword(s):

Limit Of Detection ◽

Hot Spot ◽

Metastatic Breast ◽

High Sensitivity ◽

Cost Effective ◽

Digital Pcr ◽

Cost Effective Method ◽

High Prevalence ◽

High Concordance ◽

Hotspot Mutations

AbstractHere we report on the development of a sensitive and cost-effective method to longitudinally trackESR1andPIK3CAmutations from cfDNA in patients with metastatic breast cancer (MBC) using a streamlined and de-centralized workflow. Hotspot mutations inESR1have been shown to cause resistance to aromatase inhibitor–based and anti-estrogenic therapies, whilePIK3CAmutations have high prevalence in MBC. As a result, their utility as circulating biomarkers to predict or monitor response in the clinical development of investigational compounds has been the focus of many studies. Six regions inESR1andPIK3CAgenes containing 20 hotspot mutations were pre-amplified, followed by optimized singleplex ddPCR assays to detect allele frequencies of individual mutations. Without pre-amplification, the limit of detection (LOD) and limit of linearity (LOL) of individual ddPCR assays were at 0.05-0.1% and 0.25% level, respectively. With pre-amplification, the LOD and LOL were slightly elevated at 0.1-0.25% and 0.25-0.5% levels, respectively. High concordance was achieved to the BEAMing assay (Sysmex Inostics) for mutation positive assays (r=0.98, P<0.0001). In conclusion, coupling pre-amplification and ddPCR assays allowed us for the detection of up to 20 hot spot mutations inESR1andPIK3CAwith high sensitivity and reproducibility.

Download Full-text

MassARRAY-based single nucleotide polymorphism analysis in breast cancer of north Indian population

BMC Cancer ◽

10.1186/s12885-020-07361-8 ◽

2020 ◽

Vol 20 (1) ◽

Author(s):

Divya Bakshi ◽

Ashna Nagpal ◽

Varun Sharma ◽

Indu Sharma ◽

Ruchi Shah ◽

...

Keyword(s):

Breast Cancer ◽

Gene Mutations ◽

Cost Effective ◽

P Value ◽

Polymorphism Analysis ◽

Nucleotide Polymorphisms ◽

Single Nucleotide ◽

Cost Effective Method ◽

Common Genetic Variants ◽

Underlying Causes

Abstract Background Breast Cancer (BC) is associated with inherited gene mutations. High throughput genotyping of BC samples has led to the identification and characterization of biomarkers for the diagnosis of BC. The most common genetic variants studied are SNPs (Single Nucleotide Polymorphisms) that determine susceptibility to an array of diseases thus serving as a potential tool for identifying the underlying causes of breast carcinogenesis. Methods SNP genotyping employing the Agena MassARRAY offers a robust, sensitive, cost-effective method to assess multiple SNPs and samples simultaneously. In this present study, we analyzed 15 SNPs of 14 genes in 550 samples (150 cases and 400 controls). We identified four SNPs of genes TCF21, SLC19A1, DCC, and ERCC1 showing significant association with BC in the population under study. Results The SNPs were rs12190287 (TCF21) having OR 1.713 (1.08–2.716 at 95% CI) p-value 0.022 (dominant), rs1051266 (SLC19A1) having OR 3.461 (2.136–5.609 at 95% CI) p-value 0.000000466 (dominant), rs2229080 (DCC) having OR 0.6867 (0.5123–0.9205 at 95% CI) p-value 0.0116 (allelic) and rs2298881 (ERCC1) having OR 0.669 (0.46–0.973 at 95% CI), p-value 0.035 (additive) respectively. The in-silico analysis was further used to fortify the above findings. Conclusion It is further anticipated that the variants should be evaluated in other population groups that may aid in understanding the genetic complexity and bridge the missing heritability.

Download Full-text

Molecularly Imprinted Polyscopoletin for the Electrochemical Detection of the Chronic Disease Marker Lysozyme

Biosensors ◽

10.3390/bios11010003 ◽

2020 ◽

Vol 11 (1) ◽

pp. 3

Author(s):

Tiziano Di Giulio ◽

Elisabetta Mazzotta ◽

Cosimino Malitesta

Keyword(s):

Electrochemical Impedance ◽

Limit Of Detection ◽

Mammalian Species ◽

Covalent Immobilization ◽

Amino Groups ◽

Molecularly Imprinted ◽

Disease Marker ◽

Sensing Material ◽

Enzymatic Marker ◽

L 62

Herein we report the electropolymerization of a scopoletin based molecularly imprinted polymer (MIP) for the detection of lysozyme (Lyz), an enzymatic marker of several diseases in mammalian species. Two different approaches have been used for the imprinting of lysozyme based, respectively, on the use of a monomer-template mixture and on the covalent immobilization of the enzyme prior to polymer synthesis. In the latter case, a multi-step protocol has been exploited with preliminary functionalization of gold electrode with amino groups, via 4-aminothiophenol, followed by reaction with glutaraldehyde, to provide a suitable linker for lysozyme. Each step of surface electrode modification has been followed by cyclic voltammetry and electrochemical impedance spectroscopy, which has been also employed to test the electrochemical responses of the developed MIP. The sensors show good selectivity to Lyz and detect the enzyme at concentrations up to 292 mg/L (20 μM), but with different performances, depending on the used imprinting approach. An imprinting factor equal to 7.1 and 2.5 and a limit of detection of 0.9 mg/L (62 nM) and 2.1 mg/L (141 nM) have been estimated for MIPs prepared with and without enzyme immobilization, respectively. Competitive rebinding experiment results show that this sensing material is selective for Lyz determination. Tests were performed using synthetic saliva to evaluate the potential application of the sensors in real matrices for clinical purposes.

Download Full-text

Surface plasmon resonance sensors using molecularly imprinted polymers for sorbent assay of theophylline, caffeine, and xanthine

Canadian Journal of Chemistry ◽

10.1139/v98-007 ◽

1998 ◽

Vol 76 (3) ◽

pp. 265-273 ◽

Cited By ~ 2

Author(s):

Edward PC Lai ◽

Ania Fafara ◽

Victoria A VanderNoot ◽

Mari Kono ◽

Brandee Polsky

Keyword(s):

Surface Plasmon Resonance ◽

Surface Plasmon ◽

Plasmon Resonance ◽

Dynamic Range ◽

Soxhlet Extraction ◽

Cross Reactivity ◽

Sensing Element ◽

Standard Drug ◽

Molecularly Imprinted ◽

Optical Phenomenon

A sensor system based on the optical phenomenon of surface plasmon resonance (SPR), which employs either photothermal deflection spectroscopy (PDS) or a photodiode array (PDA) for detection, was developed to use molecularly imprinted (MI) polymethacrylic acid - ethylene glycol dimethacrylates (PMAA-EDMA) as the sensing element. The MI polymers were first processed by Soxhlet extraction to remove the print molecules (theophylline, caffeine, and xanthine), yielding the specific anti-polymers. Each anti-polymer was layered over a silver film to serve as the analysis surface for the molecularly imprinted sorbent assay (MIA) of one target drug. This surface was exposed for 60 min to an aqueous standard drug solution, dried in air, and the uptake of the print molecule into the anti-polymer was monitored by shifts in the SPR angle θ r (and hence the SPR-PDS signal measured at constant θ ). The linear dynamic range of the MIA was found to extend up to 6 mg/mL, with a concentration detection limit estimated at 0.4 mg/mL for theophylline in aqueous solution. A cross-reactivity study of the anti-theophylline and anti-caffeine polymers, using eight other drugs structurally similar to theophylline and caffeine, showed none or very slight shifts in θ r. This implies that the anti-polymers were selective only for their original print molecules and had no affinity for the other drug molecules. Similar molecular recognition characteristics were observed for the anti-xanthine polymer.Key words: surface plasmon resonance, molecular imprinting, theophylline, caffeine, xanthine, sensor.

Download Full-text

Genetic Analysis of colorectal carcinoma using high throughput SNP genotyping technique within the population of Jammu and Kashmir

10.21203/rs.3.rs-199948/v1 ◽

2021 ◽

Author(s):

Bhanu Sharma ◽

Shabab Angurana ◽

Amrita Bhat ◽

Sonali Verma ◽

Divya Bakshi ◽

...

Keyword(s):

Colorectal Cancer ◽

High Throughput ◽

Cost Effective ◽

Snp Genotyping ◽

Colorectal Carcinogenesis ◽

P Value ◽

Jammu And Kashmir ◽

Cost Effective Method ◽

Underlying Causes ◽

Multiple Samples

Abstract Background SNP genotyping has become increasingly more common place to understand the genetic basis of complex diseases like cancer. SNP-genotyping through massARRAY is a cost-effective method to quantitatively analyse the variation of gene expression in multiple samples, making it a potential tool to identify the underlying causes of colorectal carcinogenesis. Methods In the present study, SNP genotyping was carried out using Agena mass ARRAY, which is a cost-effective, robust, and sensitive method to analyse multiple SNPs simultaneously. We analysed 7 genes in 492 samples (100 cases and 392 controls) associated with CRC within the population of Jammu and Kashmir. These SNPs were selected based on their association with multiple cancers in literature. Results This is the first study to explore these SNPs with colorectal cancer within the J&K population.7 SNPs with a call rate of 90% were selected for the study. Out of these, one SNP i.e. rs2229080 of DCC was found to be significantly associated with the current study and 6 were non-significantly associated with CRC within the studied population. The allelic OR observed for the variant rs2229080 of DCC was 1.5 (1.1–2.3 at 95% CI), p value = 0.02. Conclusion This is the first study to find the relation of Genetic variants with the colorectal cancer within the studied population using high throughput mass ARRAY technology. It is further anticipated that the variants should be evaluated in other population groups that may aid in understanding the genetic complexity and bridge the missing heritability.

Download Full-text

Electrochemical Sensor Based on Molecularly Imprinted Polymer for the Detection of Cefalexin

Biosensors ◽

10.3390/bios9010031 ◽

2019 ◽

Vol 9 (1) ◽

pp. 31 ◽

Cited By ~ 11

Author(s):

Bogdan Feier ◽

Adrian Blidar ◽

Alexandra Pusta ◽

Paula Carciuc ◽

Cecilia Cristea

Keyword(s):

Electrochemical Sensor ◽

Molecularly Imprinted Polymer ◽

Electrochemical Impedance ◽

Limit Of Detection ◽

Imprinted Polymer ◽

Boron Doped Diamond ◽

Molecularly Imprinted ◽

Diamond Electrode ◽

The Difference ◽

Mip Sensor

In this study, a new electrochemical sensor was developed for the detection of cefalexin (CFX), based on the use of a molecularly imprinted polymer (MIP) obtained by electro‒polymerization in an aqueous medium of indole-3-acetic acid (I3AA) on a glassy carbon electrode (GCE) and on boron-doped diamond electrode (BDDE). The two different electrodes were used in order to assess how their structural differences and the difference in the potential applied during electrogeneration of the MIP translate to the performances of the MIP sensor. The quantification of CFX was performed by using the electrochemical signal of a redox probe before and after the rebinding of the template. The modified electrode was characterized using atomic force microscopy (AFM), scanning electron microscopy (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The influence of different parameters on the fabrication of the sensor was tested, and the optimized method presented high selectivity and sensitivity. The MIP-based electrode presented a linear response for CFX concentration range of 10 to 1000 nM, and a limit of detection of 3.2 nM and 4.9 nM was obtained for the BDDE and the GCE, respectively. The activity of the sensor was successfully tested in the presence of some other cephalosporins and of other pharmaceutical compounds. The developed method was successfully applied to the detection of cefalexin from real environmental and pharmaceutical samples.

Download Full-text

An Optimized Real-Time qPCR Method for the Effective Detection of Human Malaria Infections

Diagnostics ◽

10.3390/diagnostics11050736 ◽

2021 ◽

Vol 11 (5) ◽

pp. 736

Author(s):

Saiful Arefeen Sazed ◽

Mohammad Golam Kibria ◽

Mohammad Shafiul Alam

Keyword(s):

Real Time ◽

Real Time Pcr ◽

Limit Of Detection ◽

Plasmodium Species ◽

Cost Effective ◽

Plasmodium Malariae ◽

Cross Reactivity ◽

Diagnostic Pcr ◽

Pcr Method ◽

Human Plasmodium

Polymerase chain reaction, although an expensive method for the detection of human Plasmodium spp., is still considered the finest for the diagnosis of malaria. The conventional diagnostic PCR is an inexpensive process but consumes a lot of time, reagents and lacks sensitivity. On the other hand, real-time PCR assays currently being used are mostly probe-based expensive methods and sometimes not feasible to detect all the species in a single amplification reaction condition. Here we have established a real-time PCR method that is time and cost effective with a single protocol to detect and distinguish five human Plasmodium species using the existing primers efficiently. The primers used here are being used in the conventional method and the sensitivity as well as specificity of this method has also been immensely improved (100%). The lower limit of detection for Plasmodium falciparum, Plasmodium vivax and Plasmodium malariae are 0.064 parasites/µL, 1.6 parasites/µL, and 0.32 parasites/µL respectively and no cross reactivity was observed. Besides, we have analyzed melt curves that can be used for further species confirmation and validation purposes using multiplex systems. This method, therefore, can be considered as an alternative to the existing lineup for molecular diagnosis of malaria in endemic countries.

Download Full-text

Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite

Processes ◽

10.3390/pr9010179 ◽

2021 ◽

Vol 9 (1) ◽

pp. 179

Author(s):

Mawethu Pascoe Bilibana ◽

Usisipho Feleni ◽

Avril Rae Williams ◽

Emmanuel Iwuoha

Keyword(s):

Electrochemical Impedance ◽

Limit Of Detection ◽

Cross Reactivity ◽

Dna Aptamer ◽

Enzyme Linked Immunosorbent Assay ◽

X Ray ◽

X Ray Scattering ◽

Silver Nanocomposite ◽

Dynamic Linear Range ◽

Sulfonated Poly

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.

Download Full-text