scholarly journals Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite

Processes ◽  
2021 ◽  
Vol 9 (1) ◽  
pp. 179
Author(s):  
Mawethu Pascoe Bilibana ◽  
Usisipho Feleni ◽  
Avril Rae Williams ◽  
Emmanuel Iwuoha
Keyword(s):  
Electrochemical Impedance ◽  
Limit Of Detection ◽  
Cross Reactivity ◽  
Dna Aptamer ◽  
Enzyme Linked Immunosorbent Assay ◽  
X Ray ◽  
X Ray Scattering ◽  
Silver Nanocomposite ◽  
Dynamic Linear Range ◽  
Sulfonated Poly

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.

scholarly journals Molecularly Imprinted Nanoparticles Based Sensor for Cocaine Detection

Biosensors ◽  
2020 ◽  
Vol 10 (3) ◽  
pp. 22 ◽  
Author(s):  
Roberta D’Aurelio ◽  
Iva Chianella ◽  
Jack A. Goode ◽  
Ibtisam E. Tothill
Keyword(s):  
Electrochemical Impedance ◽  
Limit Of Detection ◽  
Solid Phase ◽  
Cost Effective ◽  
Cross Reactivity ◽  
P Value ◽  
Sensing Element ◽  
Molecularly Imprinted ◽  
Cost Effective Method ◽  
Cocaine Detection

The development of a sensor based on molecularly imprinted polymer nanoparticles (nanoMIPs) and electrochemical impedance spectroscopy (EIS) for the detection of trace levels of cocaine is described in this paper. NanoMIPs for cocaine detection, synthesized using a solid phase, were applied as the sensing element. The nanoMIPs were first characterized by Transmission Electron Microscopy (TEM) and Dynamic Light Scattering and found to be ~148.35 ± 24.69 nm in size, using TEM. The nanoMIPs were then covalently attached to gold screen-printed electrodes and a cocaine direct binding assay was developed and optimized, using EIS as the sensing principle. EIS was recorded at a potential of 0.12 V over the frequency range from 0.1 Hz to 50 kHz, with a modulation voltage of 10 mV. The nanoMIPs sensor was able to detect cocaine in a linear range between 100 pg mL−1 and 50 ng mL−1 (R2 = 0.984; p-value = 0.00001) and with a limit of detection of 0.24 ng mL−1 (0.70 nM). The sensor showed no cross-reactivity toward morphine and a negligible response toward levamisole after optimizing the sensor surface blocking and assay conditions. The developed sensor has the potential to offer a highly sensitive, portable and cost-effective method for cocaine detection.

Facile caffeine electrochemical detection via electrodeposited Ag nanoparticles with modifier polymers on carbon paste sensor at aqueous and micellar media

2020 ◽  
Vol 98 (4) ◽  
pp. 169-178 ◽  
Author(s):  
M. Shehata ◽  
S.M. Azab ◽  
A.M. Fekry
Keyword(s):  
Ag Nanoparticles ◽  
Surface Characterization ◽  
Electrochemical Impedance ◽  
Limit Of Detection ◽  
Electrochemical Techniques ◽  
Calibration Plot ◽  
Micellar Media ◽  
Carbon Paste ◽  
Detection Range ◽  
X Ray

The analysis and detection of caffeine (Caf) is very useful due to its widespread usage in several daily consumed beverages, food products, and pharmacological preparations with various physiological effects. The preparation of a newly electrodeposited Ag nanoparticles – cellulose acetate phthalate (CAP) – chitosan (Chit) modified carbon paste (ACCMCP) sensor for sensitive determination of Caf in 0.01 mol L−1 H3PO4 solution (pH 1.0–5.0) both in aqueous and micellar media (0.5 mmol L−1 SDS) was achieved. The interaction of Caf was monitored using electrochemical techniques such as cyclic voltammetry, differential pulse voltammetry, electrochemical impedance spectroscopy, and chronoamperometry, and surface characterization was carried out using X-ray diffraction, scanning electron microscope, and energy dispersive X-ray techniques. The linear detection range of Caf was between 4 and 500 μmol L−1 (r2 = 0.955) and the limit of detection obtained from the calibration plot was 0.252 μmol L−1. The sensor was applicable for detecting Caf in numerous real samples with recoveries from 98.03% to 101.60% without interference of any accompanying species, which ensures high method selectivity.

scholarly journals Morphology of a Blend of Zinc Neutralized Sulfonated Poly(Phenylene Oxide) or Polystyrene and an Amino Silicone

1996 ◽  
Vol 461 ◽  
Author(s):  
Alan A. Jones ◽  
Paul T. Inglefield ◽  
Changlai Yang ◽  
Pamela Bergquist ◽  
Jiefeng Shi ◽  
...  
Keyword(s):  
Electron Microscopy ◽  
Small Angle ◽  
Domain Size ◽  
Proton Spin ◽  
Zinc Ions ◽  
X Ray ◽  
X Ray Scattering ◽  
Phenylene Oxide ◽  
Sulfonated Poly ◽  
Ray Scattering

AbstractA polymer blend of an ionomer based on zinc neutralized sulfonated poly(phenylene oxide) or polystyrene with a silicone copolymer containing 6.45% propylamine groups in place of one of the methyl groups on a backbone silicon was prepared. Carbon-13 magic angle spinning spectra show coordination of the amine by the zinc ions. Morphological characterization was made by NMR spectroscopy based on proton spin diffusion, by small angle x-ray scattering and by energy filtered transmission electron microscopy. All experiments show domains in the range of 1 to 1000 nm and domain size can be controlled by the extent of coordination of the amine groups by the zinc ions and by thermal history. The different morphological experiments lead to an apparent hierarchy of domain sizes. The NMR experiment yields the smallest domains, 2 to 10 nm, where contrast is produced by differences in chain mobility. Small angle x-ray scattering indicates domains of 16 nm while electron microscopy indicates domains in the range of 100 to 1000 nm. The variation of the domain size between experiments may reflect the different sources of contrast in each case.

scholarly journals Development of an Immunoassay for the Detection of Amyloid Beta 1-42 and Its Application in Urine Samples

2020 ◽  
Vol 2020 ◽  
pp. 1-9
Author(s):  
Anurak Wongta ◽  
Surat Hongsibsong ◽  
Somporn Chantara ◽  
Mookda Pattarawarapan ◽  
Ratana Sapbamrer ◽  
...  
Keyword(s):  
Amyloid Beta ◽  
Limit Of Detection ◽  
Cross Reactivity ◽  
Urine Samples ◽  
Enzyme Linked Immunosorbent Assay ◽  
Inexpensive Method ◽  
Amyloid Beta Peptides ◽  
Beta Peptides ◽  
The Cross ◽  
Sequence Similarities

Amyloid beta peptides (Aβ1-42) have been found to be associated with the cause of Alzheimer’s disease (AD) and dementia. Currently, methods for detecting Aβ1-42 are complicated and expensive. The present study is aimed at developing an indirect competitive enzyme-linked immunosorbent assay (ic-ELISA) to detect Aβ1-42 by using a polyclonal antibody from alpaca, an application used in urine samples. The serum was collected from the alpaca after immunizing it with Aβ1-42 at 500 μg/injection 5 times. The ic-ELISA was developed and showed a half-maximal inhibitory concentration ( I C 50 ) of 103.20 ng/ml. The limit of detection (LOD) was 0.39 ng/100 μl. The cross-reactivity was tested with Aβ1-40 and 8 synthesized peptides that had sequence similarities to parts of Aβ1-42. The cross-reactivity of Aβ1-40 and peptide 1 (DAEFRHDSGYE) was 55% and 69.4%, respectively. The ic-ELISA was applied to analyze Aβ1-42 in the urine and precipitated protein urine samples. This method can be used for detecting a normal level of total soluble Aβ (approximately 1 ng in 5 mg of precipitated urine protein) and can be used for detecting the early stages of AD. It is considered to be an easy and inexpensive method for monitoring and diagnosing AD.

scholarly journals Sensitive and Selective Electrochemical Detection of Epirubicin as Anticancer Drug Based on Nickel Ferrite Decorated with Gold Nanoparticles

Micromachines ◽  
2021 ◽  
Vol 12 (11) ◽  
pp. 1334
Author(s):  
Mohammad Mehmandoust ◽  
Nevin Erk ◽  
Ceren Karaman ◽  
Fatemeh Karimi ◽  
Sadegh Salmanpour
Keyword(s):  
Electron Microscopy ◽  
Gold Nanoparticles ◽  
Nickel Ferrite ◽  
Electrochemical Impedance ◽  
Limit Of Detection ◽  
Differential Pulse ◽  
X Ray ◽  
Transmission Electron ◽  
The Stability ◽  
Electrochemical Electrode

The accurate and precise monitoring of epirubicin (EPR), one of the most widely used anticancer drugs, is significant for human and environmental health. In this context, we developed a highly sensitive electrochemical electrode for EPR detection based on nickel ferrite decorated with gold nanoparticles (Au@NiFe2O4) on the screen-printed electrode (SPE). Various spectral characteristic methods such as Fourier transform infrared spectra (FT-IR), X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM), ultraviolet-visible spectroscopy (UV-Vis), energy-dispersive X-ray spectroscopy (EDX) and electrochemical impedance spectroscopy (EIS) were used to investigate the surface morphology and structure of the synthesized Au@NiFe2O4 nanocomposite. The novel decorated electrode exhibited a high electrocatalytic activity toward the electrooxidation of EPR, and a nanomolar limit of detection (5.3 nM) was estimated using differential pulse voltammetry (DPV) with linear concentration ranges from 0.01 to 0.7 and 0.7 to 3.6 µM. The stability, selectivity, repeatability reproducibility and reusability, with a very low electrode response detection limit, make it very appropriate for determining trace amounts of EPR in pharmaceutical and clinical preparations.

scholarly journals Single-Laboratory Validation of the Biosense Direct Competitive Enzyme-Linked Immunosorbent Assay (ELISA) for Determination of Domoic Acid Toxins in Shellfish

2007 ◽  
Vol 90 (4) ◽  
pp. 1000-1010 ◽  
Author(s):  
Hans Kleivdal ◽  
Sven-Inge Kristiansen ◽  
Mona V Nilsen ◽  
Lyn Briggs
Keyword(s):  
Immunosorbent Assay ◽  
Domoic Acid ◽  
Matrix Effects ◽  
Limit Of Detection ◽  
Method Comparison ◽  
Cross Reactivity ◽  
Enzyme Linked Immunosorbent Assay ◽  
Shellfish Poisoning ◽  
Relative Standard

Abstract Method validation was conducted for an enzyme-linked immunosorbent assay (ELISA) for the determination of domoic acid (DA) toxins, known to give amnesic shellfish poisoning (ASP) symptoms, in shellfish. The calibration curve range of the assay is approximately 10260 pg/mL, with a dynamic working range for DA toxins in shellfish from 0.01 to at least 250 mg/kg. The ASP ELISA showed no significant cross-reactivity to structural analogs, and proved to be robust to deliberate alterations of the optimal running conditions. The shellfish matrix effects observed with mussels, oysters, and scallops were eliminated by diluting shellfish extracts 1:200 prior to analysis, leading to a limit of detection at 0.003 mg/kg. Thirteen blank shellfish homogenates were spiked with certified mussel material containing DA to levels in the range of 0.125 mg DA/kg, and analyzed in quadruplicate on 3 different days. The relative standard deviation (RSD) under intra-assay repeatability conditions ranged from 6.5 to 13.1%, and under interassay repeatability conditions the RSD ranged from 5.7 to 13.4%, with a mean value of 9.3%. The recoveries ranged from 85.5 to 106.6%, with a mean recovery of 102.2%. A method comparison was conducted with liquid chromatography with ultraviolet detection, using naturally contaminated scallop samples (n = 27) with DA levels at 0244 mg/kg. The overall correlation coefficient was 0.960 and the slope of the regression was 1.218, indicating a good agreement between the methods.

Detection of bisphenol A in water samples using ELISA determination method

2011 ◽  
Vol 11 (1) ◽  
pp. 55-60 ◽  
Author(s):  
J. Zheng ◽  
S. Q. Zhao ◽  
X. T. Xu ◽  
K. Zhang
Keyword(s):  
Drinking Water ◽  
Bisphenol A ◽  
Water Samples ◽  
Limit Of Detection ◽  
Industrial Effluent ◽  
Cross Reactivity ◽  
Enzyme Linked Immunosorbent Assay ◽  
Uv Spectrophotometry ◽  
Inhibition Concentration

In order to study whether bisphenol A (BPA) can pass into drinking water from polycarbonate barrel and exist in the river and industrial effluent the indirect competitive enzyme-linked immunosorbent assay (ELISA) for the determination of BPA was established. The results presented an inhibition concentration at 50% absorbance (IC50) of 0.123 mg L−1, and the limit of detection (LOD) is 9.934 μg L−1. The specificity of antiserum was proved well because the cross-reactivity with benzene, tert-butylbenzene, hydroquinone and o-hydroxybenzoic acid were found lower than 0.01%, except phenol was 0.26%. The method was found to be reliable and repeatable. It was used for monitoring the concentration of BPA in the barreled drinking water. The results confirmed BPA can pass into barreled drinking water from the polycarbonate barrel and concentration increased as days went on. A certain content of BPA was found in industrial effluent. The results of ELISA were consistent with the results of UV spectrophotometry. BPA could not be found in the water samples obtained from Zhujiang River. The established method shows specific recognition of BPA and could be applied in detection of environmental BPA.

Indirect Differential Pulse Voltammetric Determination of Fluoride Ions at Carbon Paste Electrode Modified with Porous and Electroactive Fe3+/Fe2+ Based-Metal Organic Frameworks Type MIL-101(Fe)

2021 ◽  
Author(s):  
Ashraf Mahmoud ◽  
Mater Mahnashi ◽  
Samer Abu-Alrub ◽  
Saad Kahatani ◽  
Mohamed El-Wekil
Keyword(s):  
Carbon Paste Electrode ◽  
Electrochemical Impedance ◽  
Limit Of Detection ◽  
Metal Organic Frameworks ◽  
Differential Pulse ◽  
Carbon Paste ◽  
X Ray ◽  
Metal Organic ◽  
Paste Electrode

Abstract An innovative and reliable electrochemical sensor was proposed for simple, sensitive and selective determination of F- ions. The sensor is based on the fabrication of porous and electroactive Fe-based metal organic frameworks [MIL-101(Fe)]. It was blended with graphite powder and liquid paraffin oil to from carbon paste electrode (CPE). The MIL-101(Fe)@CPE was characterized using different techniques such as scanning electron microscope, powder X-ray diffraction spectroscopy, Fourier transform infrared spectroscopy, energy dispersive X-ray, cyclic voltammetry, electrochemical impedance spectroscopy, differential pulse voltammetry. The MIL-101(Fe)@CPE exhibited two redox peaks (anodic and cathodic) corresponding to Fe3+ and Fe2+, respectively. The determination of F- ions based on the formation of a stable fluoroferric complex with Fe3+/ Fe2+, decreasing the currents of redox species. It was found that the anodic peak current (Ipa) is linearly proportional to the concentration of F- in the range of 0.67-130 µM with a limit of detection (S/N=3) of 0.201 µM. The electrode exhibited good selectivity towards F- detection with no significant interferences from common anions. The as-fabricated sensor was applied for the determination of F- in environmental water samples with recoveries % and RSDs % in the range of 98.1-102.4 % and 2.4-3.7 %, respectively.

Development of an Indirect Competitive Enzyme-Linked Immunosorbent Assay Based on the Multiepitope Peptide for the Synchronous Detection of Staphylococcal Enterotoxin A and G Proteins in Milk

2015 ◽  
Vol 78 (2) ◽  
pp. 362-369 ◽  
Author(s):  
MINGYAN LIANG ◽  
TINGTING ZHANG ◽  
XUELAN LIU ◽  
YANAN FAN ◽  
SHENGLIN XIA ◽  
...  
Keyword(s):  
Immunosorbent Assay ◽  
Limit Of Detection ◽  
Signal To Noise Ratio ◽  
Food Poisoning ◽  
High Sensitivity ◽  
Cross Reactivity ◽  
Enzyme Linked Immunosorbent Assay ◽  
Synchronous Detection ◽  
Standard Curve ◽  
Stability And Accuracy

Staphylococcal food poisoning (SFP), one of the most common foodborne diseases, results from ingestion of staphylococcal enterotoxins (SEs) in foods. In our previous studies, we found that SEA and SEG were two predominant SE proteins produced by milk-acquired S. aureus isolates. Here, a tandemly arranged multiepitope peptide (named SEAGepis) was designed with six linear B-cell epitopes derived from SEA or SEG and was heterologously expressed. The SEAGepis-specific antibody was prepared by immunizing rabbit with rSEAGepis. Then, an indirect competitive enzyme-linked immunosorbent assay (ic-ELISA) based on rSEAGepis and the corresponding antibody was developed to simultaneously detect SEA and SEG. Under the optimized conditions, the ic-ELISA standard curve for rSEAGepis was constructed in the concentration range of 0.5 to 512 ng/ml, and the average coefficients of variation of intra-and interassay were 4.28 and 5.61% during six standard concentrations. The average half-maximal inhibitory concentration was 5.07 ng/ml, and the limit of detection at a signal-to-noise ratio of 3 was 0.52 ng/ml. The anti-rSEAGepis antibody displayed over 90% cross-reactivity with SEA and SEG but less than 0.5% cross-reactivity with other enterotoxins. Artificially contaminated milk with different concentrations of rSEAGepis, SEA, and SEG was detected by the established ic-ELISA; the recoveries of rSEAGepis, SEA, and SEG were 91.1 to 157.5%, 90.3 to 134.5%, and 89.1 to 117.5%, respectively, with a coefficient of variation below 12%. These results demonstrated that the newly established ic-ELISA possessed high sensitivity, specificity, stability, and accuracy and could potentially be a useful analytical method for synchronous detection of SEA and SEG in milk.

scholarly journals Electrochemical ELISA Protein Biosensing in Undiluted Serum Using a Polypyrrole-Based Platform

Sensors ◽  
2020 ◽  
Vol 20 (10) ◽  
pp. 2857 ◽  
Author(s):  
Sunil K. Arya ◽  
Pedro Estrela
Keyword(s):  
Serum Proteins ◽  
Electrochemical Impedance ◽  
Limit Of Detection ◽  
Enzyme Linked Immunosorbent Assay ◽  
Protein Markers ◽  
Necrosis Factor Alpha ◽  
Force Microscopy ◽  
Atomic Force ◽  
Tnf Α ◽  
Undiluted Serum

An electrochemical enzyme-linked immunosorbent assay (ELISA) biosensor platform using electrochemically prepared ~11 nm thick carboxylic functionalized popypyrrole film has been developed for bio-analyte measurement in undiluted serum. Carboxyl polypyrrole (PPy-COOH) film using 3-carboxy-pyrrol monomer onto comb-shaped gold electrode microarray (Au) was prepared via cyclic voltammetry (CV). The prepared Au/PPy-COOH was then utilized for electrochemical ELISA platform development by immobilizing analyte-specific antibodies. Tumor necrosis factor-alpha (TNF-α) was selected as a model analyte and detected in undiluted serum. For enhanced performance, the use of a polymeric alkaline phosphatase tag was investigated for the electrochemical ELISA. The developed platform was characterized at each step of fabrication using CV, electrochemical impedance spectroscopy and atomic force microscopy. The bioelectrodes exhibited linearity for TNF-α in the 100 pg/mL–100 ng/mL range when measured in spiked serum, with limit of detection of 78 pg/mL. The sensor showed insignificant signal disturbance from serum proteins and other biologically important proteins. The developed platform was found to be fast and specific and can be applicable for testing and measuring various biologically important protein markers in real samples.

Sign in / Sign up

Export Citation Format

Share Document