scholarly journals Voltammetric Electrochemical Sensor for Phylogenetic Study in Acer Linn.

Biosensors ◽  
2021 ◽  
Vol 11 (9) ◽  
pp. 323
Author(s):  
Qingwei Zhou ◽  
Kewei Liu ◽  
Xiaolong Li ◽  
Yonghua Gu ◽  
Yuhong Zheng ◽  
...  
Keyword(s):  
Phylogenetic Tree ◽  
Electrochemical Sensor ◽  
Plant Species ◽  
Phenolic Acids ◽  
Plant Tissue ◽  
Phylogenetic Study ◽  
Full Agreement ◽  
Traditional Classification ◽  
Electrochemical Fingerprint ◽  
Taxonomic System

Acer Linn. is a highly divergent species morphology in the maple family (Aceraceae). It is one of the genera facing a very difficult taxonomic situation. The phylogeny of the genus and the taxonomic system under the genus remain unclear. The use of electrochemical fingerprints for plant phylogenetic study is an emerging application in biosensors. In this work, leaves of 18 species of Acer Linn. with an exo-taxa were selected for electrochemical fingerprint recording. Two different conditions were used for improving the data abundance. The fingerprint of all species showed a series of oxidation peaks. These peaks can be ascribed to the oxidation of flavonols, phenolic acids, procyanidins, alkaloids, and pigments in plant tissue. These electrochemical fingerprints can be used for the identification of plant species. We also performed a phylogenetic study with data from electrochemical fingerprinting. The phylogenetic tree of Acer is divided into three main clades. The result is in full agreement with A. shangszeense var. anfuense, A. pictum subsp. mono, A. amplum, A. truncatum, and A. miaotaiense, belonging to the subsection Platanoidea. A. nikoense and A. griseum were clustered together in the dendrogram. Another group that fits the traditional classification results is in the subsection Integrifolia.

Species-specific changes in tissue morphogenesis induced by two arthropod leaf gallers in Lantana camara L. (Verbenaceae)

2008 ◽  
Vol 56 (2) ◽  
pp. 153 ◽  
Author(s):  
Maria Zabelê Dantas Moura ◽  
Geraldo Luiz Gonçalves Soares ◽  
Rosy Mary dos Santos Isaias
Keyword(s):  
Plant Species ◽  
Plant Tissue ◽  
Rio Grande ◽  
Lantana Camara ◽  
Rio Grande Do Sul ◽  
Spongy Parenchyma ◽  
Extended Phenotype ◽  
Tissue Morphogenesis ◽  
Species Specific ◽  
In Cells

When different cecidogenous species attack the same plant species, each one causes distinct plant tissue reorganisation, and forms typical gall structures. Two Lantana camara L. leaf galls induced by Aceria lantanae (Cook) (Acarina: Eriophyidae) and Schismatodiplosis lantanae (Rübsaamen) (Diptera: Cecidomyiidae) were collected in a subspontaneous population at Rio Grande do Sul, Brazil. A. lantanae crinckle galls were uni- or multi-chambered and contained several mites, caused by several leaf foldings, and consisted of hyperplasic epidermis and parenchyma. S. lantanae induced uni-chambered pouch galls inhabited by one larvae or pupa. This gall consisted predominantly of hypertrophied spongy parenchyma. Our results documented how these herbivores acted in cells with the same initial morphogenetic competence, altering leaf pattern, and inducing their specific extended phenotype.

scholarly journals UHPLC-(ESI)-HRMS and NMR-Based Metabolomics Approach to Access the Seasonality of Byrsonima intermedia and Serjania marginata From Brazilian Cerrado Flora Diversity

2021 ◽  
Vol 9 ◽  
Author(s):  
Ana C. Zanatta ◽  
Wagner Vilegas ◽  
RuAngelie Edrada-Ebel
Keyword(s):  
Medicinal Plants ◽  
Plant Species ◽  
Phenolic Acids ◽  
Shikimic Acid ◽  
Metabolite Profile ◽  
Native Plant ◽  
Brazilian Cerrado ◽  
Multivariate Statistical ◽  
Native Plant Species ◽  
Rich Diversity

Seasonality is one of the major environmental factors that exert influence over the synthesis and accumulation of secondary metabolites in medicinal plants. The application of the metabolomics approach for quality control of plant extracts is essentially important because it helps one to establish a standard metabolite profile and to analyze factors that affect the effectiveness of the medicinal plants. The Brazilian Cerrado flora is characterized by a rich diversity of native plant species, and a number of these plant species have been found to have suitable medicinal properties. Some of these plant species include Byrsonima intermedia and Serjania marginata. To better understand the chemical composition of these plant species, we conducted a study using the state-of-the-art techniques including the HPLC system coupled to an Exactive-Orbitrap high resolution mass spectrometer with electrospray ionization interface UHPLC-(ESI)-HRMS and by NMR being performed 2D J-resolved and proton NMR spectroscopy. For the analysis, samples were harvested bimonthly during two consecutive years. UHPLC-(ESI)-HRMS data were preprocessed and the output data uploaded into an in-house Excel macro for peak dereplication. MS and NMR data were concatenated using the data fusion method and submitted to multivariate statistical analysis. The dereplication of LC-HRMS data helped in the annotation of the major compounds present in the extracts of the three plant species investigated allowing the annotation of 68 compounds in the extracts of B. intermedia (cinnamic acids, phenolic acids derived from galloyl quinic and shikimic acid, proanthocyanidins, glycosylated flavonoids, triterpenes and other phenols) and 81 compounds in the extracts of S. marginata (phenolic acids, saponins, proanthocyanidins, glycosylated flavonoids among other compounds). For a better assessment of the great number of responses, the significance of the chemical variables for the differentiation and correlation of the seasons was determined using the variable importance on projection (VIP) technique and through the application of the false discovery rate (FDR) estimation. The statistical data obtained showed that seasonal factors played an important role on the production of metabolites in each plant species. Temperature conditions, drought and solar radiation were found to be the main factors that affected the variability of phenolic compounds in each species.

scholarly journals Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence

2021 ◽  
Vol 8 (3) ◽  
Author(s):  
K M Kiran ◽  
B V Sandeep
Keyword(s):  
Phylogenetic Analysis ◽  
Phylogenetic Tree ◽  
Gene Sequence ◽  
Phylogenetic Study ◽  
Rbcl Gene ◽  
Evolutionary Divergence ◽  
Multiple Sequence ◽  
Sorghum Propinquum ◽  
Oryza Punctata ◽  
Mangrove Associate

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

scholarly journals Characterization of rbcL and trnL Plastid DNA Sequences of Vuralia turcica (Fabaceae; Papilionoideae)

2019 ◽  
Vol 7 (6) ◽  
pp. 908
Author(s):  
Dilek Tekdal
Keyword(s):  
Molecular Markers ◽  
Phylogenetic Tree ◽  
Plant Species ◽  
Dna Sequences ◽  
Its Region ◽  
Plastid Dna ◽  
Accession Number ◽  
Molecular Information

Vuralia turcica is endemic to Turkey and currently endangered. Little molecular information is available for this plant. Previous characterization and classification of V. turcica have been based on the DNA sequences of the ITS region. Molecular markers are essential for studying of genotyping and biogeography, but any of each marker is not enough to characterize a plant species in its use alone. In this study, the chloroplast rbcL and trnL regions were amplified in V. turcica using the primers that have been published in the previous studies. Successfully amplified DNA fragments were extracted and commercially sequenced. The partial rbcL and trnL sequences were submitted to the NCBI database (accession number KX164510, KX164511, respectively). Amplified both DNA of two regions of rbcL and trnL were used to construct a phylogenetic tree.

Phomopsis subordinaria and associated stalk disease in natural populations of Plantago lanceolate

1987 ◽  
Vol 65 (11) ◽  
pp. 2318-2325 ◽  
Author(s):  
Marianne P. de Nooij ◽  
Huub A. van der Aa
Keyword(s):  
Natural Selection ◽  
Plant Species ◽  
Plant Tissue ◽  
Plantago Lanceolata ◽  
Natural Populations ◽  
Taxonomic Position ◽  
Selection For ◽  
Viable Seeds

Natural populations of Plantago lanceolata L. can be infected by the fungus Phomopsis subordinaria (Desm.) Trav., which causes a stalk disease. Inoculation experiments revealed that the fungus needs a wound to enter the plant tissue. Symptoms of the disease in the field and from inoculation experiments in the greenhouse are described and the taxonomic position of the fungus is discussed. The pathogen could not be isolated from other plant species in heavily infected Pl. lanceolata populations and can be regarded as specialized on Pl. lanceolata. Other species of the genus Plantago differed considerably in their susceptibility to the disease. Comparison of Pl. lanceolata genotypes indicated that there is variation in susceptibility among host genotypes. Because the disease may reduce the production of viable seeds, the possibility of natural selection for resistance in the host is considered.

scholarly journals Chloroplast Genome Draft of Dryobalanops aromatica Generated Using Oxford Nanopore Technology and Its Potential Application for Phylogenetic Study

Forests ◽  
2021 ◽  
Vol 12 (11) ◽  
pp. 1515
Author(s):  
Dwi Wahyuni ◽  
Fifi Gus Dwiyanti ◽  
Rahadian Pratama ◽  
Muhammad Majiidu ◽  
Henti Hendalastuti Rachmat ◽  
...  
Keyword(s):  
Dna Sequencing ◽  
Phylogenetic Tree ◽  
Chloroplast Genome ◽  
Dna Sequences ◽  
Genetic Relationships ◽  
Phylogenetic Study ◽  
Phylogenomic Analysis ◽  
Rbcl Gene ◽  
Oxford Nanopore ◽  
Long Read

Kapur (Dryobalanops aromatica) is an important dipterocarp species currently classified as vulnerable by the IUCN Red List Threatened Species. Science-based conservation and restoration efforts are needed, which can be supported by new genomic data generated from new technologies, including MinION Oxford Nanopore Technology (ONT). ONT allows affordable long-read DNA sequencing, but this technology is still rarely applied to native Indonesian forest trees. Therefore, this study aimed to generate whole genome datasets through ONT and use part of these data to construct the draft of the chloroplast genome and analyze the universal DNA barcode-based genetic relationships for D. aromatica. The method included DNA isolation, library preparation, sequencing, bioinformatics analysis, and phylogenetic tree construction. Results showed that the DNA sequencing of D. aromatica resulted in 1.55 Gb of long-read DNA sequences from which a partial chloroplast genome (148,856 bp) was successfully constructed. The genetic relationship was analyzed using two selected DNA barcodes (rbcL and matK), and its combination showed that species of the genus Dryobalanops had a close relationship as indicated by adjacent branches between species. The phylogenetic tree of matK and the combination of the matK and rbcL genes showed that D. aromatica was closely related to Dryobalanops rappa, whereas the rbcL gene showed group separation between D. aromatica and D. rappa. Therefore, a combination of the matK and rbcL genes is recommended for future use in the phylogenetic or phylogenomic analysis of D. aromatica.

scholarly journals In vitro Propagation of Albizia guachapele, Cedrela odorata, Platymiscium pinnatum and Guaiacum sanctum

1970 ◽  
Vol 18 (2) ◽  
pp. 151-156
Author(s):  
L. Valverde-Cerdas ◽  
A. Rojas-Vargas ◽  
A. Hine-Gómez
Keyword(s):  
Costa Rica ◽  
Key Words ◽  
Plant Species ◽  
Plant Tissue ◽  
In Vitro Propagation ◽  
Cedrela Odorata ◽  
Resistant Material ◽  
In Vitro Micropropagation ◽  
Guaiacum Sanctum

In Costa Rica Albizia guachapele, Cedrela odorata, Platymiscium pinnatum and Guaiacum sanctum are important plant species in both economic and ecological terms and their wood is precious and reported to be highly resistant material. This research has evaluated the in vitro micropropagation as a technology focused to conserve these species. Findings include percentage of germination of seeds and contamination, induction of buds, rooting and growth of micro-cuttings of these four species. Key words:  In vitro, Propagation, Albizia guachapele, Cedrela odorata, Platymiscium pinnatum, Guaiacum sanctum D.O.I. 10.3329/ptcb.v18i2.3397 Plant Tissue Cult. & Biotech. 18(2): 151-156, 2008 (December)

A phylogenetic study of Chinese Velarifictorus Randell, 1964 based on COI gene with describing one new species (Orthoptera: Gryllidae: Gryllinae)

Zootaxa ◽  
2018 ◽  
Vol 4531 (4) ◽  
pp. 499
Author(s):  
GUANG-YU CHEN ◽  
CHU-ZE SHEN ◽  
YUN-FEI LIU ◽  
WANG LIAO ◽  
ZHU-QING HE
Keyword(s):  
New Species ◽  
Phylogenetic Tree ◽  
Coi Gene ◽  
East China ◽  
Phylogenetic Study ◽  
Type Specimens ◽  
Western Yunnan ◽  
Normal University ◽  
One New Species

Eight species of genus Velarifictorus Randell, 1964 have been recorded from China prior to this study. Here we describe one new species, Velarifictorus dianxiensis He sp. nov. from western Yunnan. COI genes of Velarifictorus spp. were used to reconstruct a phylogenetic tree for confirming the relationships of these species. The type specimens are deposited in Museum of Biology, East China Normal University (ECNU). 

Sign in / Sign up

Export Citation Format

Share Document