Tomato Yellow Leaf Curl Virus (TYLCV) Promotes Plant Tolerance to Drought

A growing body of research points to a positive interplay between viruses and plants. Tomato yellow curl virus (TYLCV) is able to protect tomato host plants against extreme drought. To envisage the use of virus protective capacity in agriculture, TYLCV-resistant tomato lines have to be infected first with the virus before planting. Such virus-resistant tomato plants contain virus amounts that do not cause disease symptoms, growth inhibition, or yield loss, but are sufficient to modify the metabolism of the plant, resulting in improved tolerance to drought. This phenomenon is based on the TYLCV-dependent stabilization of amounts of key osmoprotectants induced by drought (soluble sugars, amino acids, and proteins). Although in infected TYLCV-susceptible tomatoes, stress markers also show an enhanced stability, in infected TYLCV-resistant plants, water balance and osmolyte homeostasis reach particularly high levels. These tomato plants survive long periods of time during water withholding. However, after recovery to normal irrigation, they produce fruits which are not exposed to drought, similarly to the control plants. Using these features, it might be possible to cultivate TYLCV-resistant plants during seasons characterized by water scarcity.

Download Full-text

First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽

10.1094/pd-90-0379c ◽

2006 ◽

Vol 90 (3) ◽

pp. 379-379 ◽

Cited By ~ 13

Author(s):

K. S. Ling ◽

A. M. Simmons ◽

R. L. Hassell ◽

A. P. Keinath ◽

J. E. Polston

Keyword(s):

South Carolina ◽

The United States ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Pcr Products ◽

Primer Sequence ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽

10.1094/pdis-09-18-1558-pdn ◽

2019 ◽

Vol 103 (6) ◽

pp. 1437-1437 ◽

Cited By ~ 2

Author(s):

M. Granier ◽

L. Tomassoli ◽

A. Manglli ◽

M. Nannini ◽

M. Peterschmitt ◽

...

Keyword(s):

Resistance Gene ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Virus Recombinant ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

Whitefly-mediated transmission and subsequent acquisition of highly similar and naturally occurring Tomato yellow leaf curl virus variants

Phytopathology ◽

10.1094/phyto-06-21-0248-r ◽

2021 ◽

Author(s):

Wendy Marchant ◽

Saurabh Gautam ◽

Bhabesh Dutta ◽

Rajagopalbab Srinivasan

Keyword(s):

Amino Acids ◽

Mixed Infection ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Plant Interactions ◽

Tomato Plants ◽

Individual Host ◽

Field Samples ◽

Leaf Curl Virus ◽

Leaf Curl

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

Download Full-text

Occurrence of Tomato yellow leaf curl virus and Tomato chlorosis virus mixed infections in protected tomato plants, Antalya, Turkey

Phytoparasitica ◽

10.1007/s12600-019-00743-0 ◽

2019 ◽

Vol 47 (3) ◽

pp. 441-449

Author(s):

Mine Gul-Seker ◽

I. Ozer Elibuyuk

Keyword(s):

Tomato Yellow Leaf ◽

Mixed Infections ◽

Yellow Leaf ◽

Tomato Plants ◽

Tomato Chlorosis Virus ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

Interaction between ‘Candidatus Phytoplasma australasiae’ and Tomato yellow leaf curl virus in tomato plants

European Journal of Plant Pathology ◽

10.1007/s10658-020-02114-6 ◽

2020 ◽

Vol 158 (3) ◽

pp. 733-744

Author(s):

Nazanin Ebadi ◽

Gilda Najafipour ◽

Mohammad Mehdi Faghihi ◽

Kavous Ayazpour ◽

Mohammad Salehi

Keyword(s):

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

Rate of Tomato yellow leaf curl virus Translocation in the Circulative Transmission Pathway of its Vector, the Whitefly Bemisia tabaci

Phytopathology ◽

10.1094/phyto.2001.91.2.188 ◽

2001 ◽

Vol 91 (2) ◽

pp. 188-196 ◽

Cited By ~ 99

Author(s):

Murad Ghanim ◽

Shai Morin ◽

Henryk Czosnek

Keyword(s):

Salivary Glands ◽

Bemisia Tabaci ◽

Virus Genome ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

Hemolymph Sample ◽

Infected Tomato ◽

Leaf Curl Virus ◽

Leaf Curl

Whiteflies (Bemisia tabaci, biotype B) were able to transmit Tomato yellow leaf curl virus (TYLCV) 8 h after they were caged with infected tomato plants. The spread of TYLCV during this latent period was followed in organs thought to be involved in the translocation of the virus in B. tabaci. After increasing acquisition access periods (AAPs) on infected tomato plants, the stylets, the head, the midgut, a hemolymph sample, and the salivary glands dissected from individual insects were subjected to polymerase chain reaction (PCR) without any treatment; the presence of TYLCV was assessed with virus-specific primers. TYLCV DNA was first detected in the head of B. tabaci after a 10-min AAP. The virus was present in the midgut after 40 min and was first detected in the hemolymph after 90 min. TYLCV was found in the salivary glands 5.5 h after it was first detected in the hemolymph. Subjecting the insect organs to immunocapture-PCR showed that the virus capsid protein was in the insect organs at the same time as the virus genome, suggesting that at least some TYLCV translocates as virions. Although females are more efficient as vectors than males, TYLCV was detected in the salivary glands of males and of females after approximately the same AAP.

Download Full-text

The nucleotide sequence of a recombinant tomato yellow leaf curl virus strain frequently detected in Sicily isolated from tomato plants carrying the Ty-1 resistance gene

Archives of Virology ◽

10.1007/s00705-017-3674-9 ◽

2017 ◽

Vol 163 (3) ◽

pp. 795-797 ◽

Cited By ~ 10

Author(s):

Stefano Panno ◽

Andrea Giovanni Caruso ◽

Salvatore Davino

Keyword(s):

Nucleotide Sequence ◽

Resistance Gene ◽

Virus Strain ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

A Novel Source of Resistance to Tomato Yellow Leaf Curl Virus Exhibiting a Symptomless Reaction to Viral Infection

Journal of the American Society for Horticultural Science ◽

10.21273/jashs.123.6.1004 ◽

1998 ◽

Vol 123 (6) ◽

pp. 1004-1007 ◽

Cited By ~ 81

Author(s):

M. Friedmann ◽

M. Lapidot ◽

S. Cohen ◽

M. Pilowsky

Keyword(s):

Natural Infection ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Susceptible Parent ◽

Partial Dominance ◽

Disease Symptoms ◽

Leaf Curl Virus ◽

Very High ◽

Different Levels ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), transmitted by the tobacco whitefy (Bemisia tabaci Genn.), can be devastating to tomato (Lycopersicon esculentum L.) crops in tropical and subtropical regions. The development of resistant cultivars is the best option for control of TYLCV. However, all the available resistant commercial cultivars tested at the Volcani Center, when inoculated with TYLCV, developed different levels of disease symptoms. In this study, we report the development of a breeding line, TY172, which is a symptomless carrier of TYLCV. Line TY172, whether infected in the greenhouse with viruliferous whiteflies, or when grown in the field under natural infection, showed no symptoms of the disease. Viral DNA was detected in infected TY172 plants, albeit at much lower levels than a susceptible infected control. In addition, grafting experiments using infected susceptible scions grafted onto TY172 stocks, showed that even when exposed continuously to very high levels of virus, line TY172 did not develop disease symptoms, nor did it accumulate high levels of the virus. When TY172 was crossed with susceptible lines, the hybrids exhibited milder symptoms and lower viral content than the susceptible parent, yet higher than that of TY172, suggesting a partial dominance for the TY172 resistance. Upon inoculation of F2 populations, the amount of symptomless individuals appeared in a ratio of≈7:64. This suggests that at least three genes may account for the resistance.

Download Full-text

Tomato curly stunt virus, a New Begomovirus of Tomato Within the Tomato yellow leaf curl virus-IS Cluster in South Africa

Plant Disease ◽

10.1094/pdis.2000.84.7.810b ◽

2000 ◽

Vol 84 (7) ◽

pp. 810-810 ◽

Cited By ~ 8

Author(s):

G. Pietersen ◽

A. M. Idris ◽

K. Krüger ◽

J. K. Brown

Keyword(s):

South Africa ◽

Sequence Analysis ◽

Mosaic Virus ◽

Tomato Yellow Leaf ◽

African Cassava Mosaic Virus ◽

Yellow Leaf ◽

Tomato Plants ◽

Leaf Curl Virus ◽

Cassava Mosaic Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV) causes a serious disease of tomato in many countries throughout the world. Preliminary reports suggested that TYLC disease was present in 1997 in South Africa. In 1998 140 ha of tomato fields in the Onderberg area were assessed for possible presence of TYLCV. Symptoms like those caused by TYLCV isolates in Israel were observed in most fields, and disease incidence ranged from <1 to 50%. Yield losses in individual plants ranged from negligible to 100% and appeared related to the age of the plants at time of infection. Two isolates of the suspect virus were experimentally transmitted from symptomatic tomato to virus-free, glasshouse-grown tomato seedlings by colony. Field and colony whiteflies were identified as the Bemisia tabaci based on mt COI sequence analysis (1). Attempts to transmit the suspect begomovirus by sap inoculation between tomato plants were unsuccessful. Polymerase chain reaction (PCR) amplification with degenerate PCR primers (2) that permit detection of the coat protein gene (AV1) and the common region (CR) of other begomoviruses yielded an amplicon of the expected size (2,100 bp), suggesting begomovirus association with diseased tomato plants. Nucleotide (nt) sequence analysis of AV1 for both tomato isolate AF261885 indicated that they were indistinguishable and shared less than 78% sequence identity with other well-studied begomoviruses, indicating a distinct, previously undescribed begomovirus species. AV1 sequence comparisons also revealed that its closest relatives were members of the TYLCV cluster, which includes South African cassava mosaic virus (77.4%) (AF11785), East African cassava mosaic virus (77.3%) (AJ006459), and TYLCV-IS (76.2%) (X15656). The theoretical Rep binding element in the CR, TCGGT, was identical to TYLCV-IS and Cotton leaf curl virus-Pakistan (AJ002448) (AJ002449). Here, we provisionally designate this new tomato-infecting begomoviral species, Tomato curly stunt virus from South Africa (ToCSV-SA). References: (1) D. R. Frohlich et al. Mol. Ecol. 8:1683, 1999. (2) A. M. Idris and J. K. Brown. Phytopathology 88:648, 1998.

Download Full-text