Three Complete Mitochondrial Genomes of Orestes guangxiensis, Peruphasma schultei, and Phryganistria guangxiensis (Insecta: Phasmatodea) and Their Phylogeny

Insects of the order Phasmatodea are mainly distributed in the tropics and subtropics and are best known for their remarkable camouflage as plants. In this study, we sequenced three complete mitochondrial genomes from three different families: Orestes guangxiensis, Peruphasma schultei, and Phryganistria guangxiensis. The lengths of the three mitochondrial genomes were 15,896 bp, 16,869 bp, and 17,005 bp, respectively, and the gene composition and structure of the three stick insects were identical to those of the most recent common ancestor of insects. The phylogenetic relationships among stick insects have been chaotic for a long time. In order to discuss the intra- and inter-ordinal relationship of Phasmatodea, we used the 13 protein-coding genes (PCGs) of 85 species for maximum likelihood (ML) and Bayesian inference (BI) analyses. Results showed that the internal topological structure of Phasmatodea had a few differences in both ML and BI trees and long-branch attraction (LBA) appeared between Embioptera and Zoraptera, which led to a non-monophyletic Phasmatodea. Consequently, after removal of the Embioptera and Zoraptera species, we re-performed ML and BI analyses with the remaining 81 species, which showed identical topology except for the position of Tectarchus ovobessus (Phasmatodea). We recovered the monophyly of Phasmatodea and the sister-group relationship between Phasmatodea and Mantophasmatodea. Our analyses also recovered the monophyly of Heteropterygidae and the paraphyly of Diapheromeridae, Phasmatidae, Lonchodidae, Lonchodinae, and Clitumninae. In this study, Peruphasma schultei (Pseudophasmatidae), Phraortes sp. YW-2014 (Lonchodidae), and species of Diapheromeridae clustered into the clade of Phasmatidae. Within Heteropterygidae, O. guangxiensis was the sister clade to O. mouhotii belonging to Dataminae, and the relationship of (Heteropteryginae + (Dataminae + Obriminae)) was recovered.

Download Full-text

Comparative analysis of twelve mitogenomes of Caliscelidae (Hemiptera: Fulgoromorpha) and their phylogenetic implications

PeerJ ◽

10.7717/peerj.12465 ◽

2021 ◽

Vol 9 ◽

pp. e12465

Author(s):

Nian Gong ◽

Lin Yang ◽

Xiangsheng Chen

Keyword(s):

Nucleotide Diversity ◽

Stop Codon ◽

Purifying Selection ◽

Sister Group ◽

Mitochondrial Genomes ◽

Protein Coding ◽

Phylogenetic Implications ◽

Basal Position ◽

High Support ◽

Complete Mitochondrial Genomes

Here, the complete mitochondrial genomes (mitogenomes) of 12 Caliscelidae species, Augilina tetraina, Augilina triaina, Symplana brevistrata, Symplana lii, Neosymplana vittatum, Pseudosymplanella nigrifasciata, Symplanella brevicephala, Symplanella unipuncta, Augilodes binghami, Cylindratus longicephalus, Caliscelis shandongensis, and Peltonotellus sp., were determined and comparatively analyzed. The genomes varied from 15,424 to 16,746 bp in size, comprising 37 mitochondrial genes and an A+T-rich region. The typical gene content and arrangement were similar to those of most Fulgoroidea species. The nucleotide compositions of the mitogenomes were biased toward A/T. All protein-coding genes (PCGs) started with a canonical ATN or GTG codon and ended with TAN or an incomplete stop codon, single T. Among 13 PCGs in 16 reported Caliscelidae mitogenomes, cox1 and atp8 showed the lowest and highest nucleotide diversity, respectively. All PCGs evolved under purifying selection, with atp8 considered a comparatively fast-evolving gene. Phylogenetic relationships were reconstructed based on 13 PCGs in 16 Caliscelidae species and five outgroups using maximum likelihood and Bayesian inference analyses. All species of Caliscelidae formed a steadily monophyletic group with high support. Peltonotellini was present at the basal position of the phylogenetic tree. Augilini was the sister group to Caliscelini and Peltonotellini.

Download Full-text

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

Indian Journal of Animal Research ◽

10.18805/ijar.b-1394 ◽

2021 ◽

Author(s):

Handong Wang ◽

Ye Chen ◽

Wei Shi ◽

Yongyao Guo ◽

Jinghong He ◽

...

Keyword(s):

Tandem Repeats ◽

Complete Mitochondrial Genome ◽

Sister Group ◽

Recent Common Ancestor ◽

Phylogenetic Study ◽

Mitochondrial Genomes ◽

Evolutionary Analysis ◽

Habitat Distribution ◽

Remarkable Feature ◽

Most Recent Common Ancestor

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

Download Full-text

Two complete mitochondrial genomes of Crocodylus and implications for crocodilians phylogeny

Amphibia-Reptilia ◽

10.1163/156853810791769464 ◽

2010 ◽

Vol 31 (3) ◽

pp. 299-309 ◽

Cited By ~ 8

Author(s):

Peng Yan ◽

Ge Feng ◽

Xiaoqiang Li ◽

Xiaobing Wu

Keyword(s):

Phylogenetic Analyses ◽

Sister Group ◽

Molecular Data ◽

Mitochondrial Genomes ◽

Trna Genes ◽

Nucleotide Level ◽

Protein Coding ◽

Genome Features ◽

Gavialis Gangeticus ◽

Complete Mitochondrial Genomes

AbstractThe complete mitochondrial (mt) genomes of two crocodilians: Crocodylus palustris and Crocodylus mindorensis, were sequenced in order to examine their gene and genome features. Additionally, we intended to increase the amount of molecular data suitable for phylogenetic analysis. Their gene orders conform to other crocodilians that have been sequenced, except the arrangement of two tRNA genes differ from other vertebrates, showing that the gene order of crocodilians is remarkably conserved. Phylogenetic analyses (maximum likelihood, Bayesian inference) based on the mt protein-coding genes at the nucleotide level were performed among crocodilians for which complete mt genomes were available. The results suggest that the gharial (Gavialis gangeticus) joins the false gharial (Tomistoma schlegelii) on a common branch, that constitutes a sister group to traditional Crocodylidae. In this report, Mecistops cataphractus is evidently most closely related to Osteolaemus tetraspis. They are isolated as sister taxon from the main clades in Crocodylus. Regarding Paleosuchus, it appears as sister group to Caiman within the Alligatoridae. In particular, relationships among species of Crocodylus (true crocodiles) are discussed.

Download Full-text

Complete Mitochondrial Genomes of Two Toxin-Accumulated Nassariids (Neogastropoda: Nassariidae: Nassarius) and Their Implication for Phylogeny

International Journal of Molecular Sciences ◽

10.3390/ijms21103545 ◽

2020 ◽

Vol 21 (10) ◽

pp. 3545

Author(s):

Yi Yang ◽

Hongyue Liu ◽

Lu Qi ◽

Lingfeng Kong ◽

Qi Li

Keyword(s):

Biological Significance ◽

Morphological Characteristics ◽

Time Estimation ◽

Rrna Genes ◽

Mitochondrial Genomes ◽

Sister Group Relationship ◽

Protein Coding ◽

Protein Coding Genes ◽

Rna Genes ◽

Complete Mitochondrial Genomes

The Indo-Pacific nassariids (genus Nassarius) possesses the highest diversity within the family Nassariidae. However, the previous shell or radula-based classification of Nassarius is quite confusing due to the homoplasy of certain morphological characteristics. The toxin accumulators Nassarius glans and Nassarius siquijorensis are widely distributed in the subtidal regions of the Indo-Pacific Ocean. In spite of their biological significance, the phylogenetic positions of N. glans and N. siquijorensis are still undetermined. In the present study, the complete mitochondrial genomes of N. glans and N. siquijorensis were sequenced. The present mitochondrial genomes were 15,296 and 15,337 bp in length, respectively, showing negative AT skews and positive GC skews as well as a bias of AT rich on the heavy strand. They contained 13 protein coding genes, 22 transfer RNA genes, two ribosomal RNA genes, and several noncoding regions, and their gene order was identical to most caenogastropods. Based on the nucleotide sequences combining 13 protein coding genes and two rRNA genes, a well-supported phylogeny of Nassarius was reconstructed, and several morphological synapomorphies were observed corresponding to the phylogenetic framework. In addition, the sister group relationship between N. variciferus and the remaining toxin-accumulated nassariids was determined, suggesting that the phylogeny might be related to their diet. The divergence time estimation analysis revealed a correlation between speciation events of nassariids and glacial cycles during the Pliocene-Pleistocene epoch.

Download Full-text

Characterization of the Complete Mitochondrial Genomes from Two Nitidulid Pests with Phylogenetic Implications

Insects ◽

10.3390/insects11110779 ◽

2020 ◽

Vol 11 (11) ◽

pp. 779

Author(s):

Xiaoxiao Chen ◽

Qing Song ◽

Min Huang

Keyword(s):

Tandem Repeats ◽

Stop Codon ◽

Phylogenetic Analyses ◽

Sister Group ◽

Start Codon ◽

Mitochondrial Genomes ◽

Sister Group Relationship ◽

Rich Region ◽

Phylogenetic Implications ◽

Complete Mitochondrial Genomes

The complete mitochondrial genomes of Xenostrongylusvariegatus and Epuraea sp. were sequenced and analyzed. The total genome lengths are 17,657 and 16,641 bp, with an A+T content of 77.2% and 76.4%, respectively. Each mitochondrial genome consists of 37 coding genes and a non-coding (AT-rich) region. All protein-coding genes (PCGs) start with the standard start codon, ATN, and end with complete stop codons, TAA and TAG, or an incomplete stop codon, T. All tRNAs can be folded into the typical clover-leaf secondary structure, with the exception of trnS1 in both species with a reduced dihydrouridine (DHU) arm. The AT-rich region has tandem repeats differing in both number and length. Genetic distance and Ka/Ks analyses show that nad6 has a higher variability and more rapid evolutionary rate than other PCGs. Both maximum likelihood and Bayesian inference phylogenetic analyses based on 13 PCGs and 2 ribosome DNAs (rDNAs) agree with the previous phylogenies in supporting the Nitidulidae monophyly and the sister-group relationship of Kateretidae + (Monotomidae + Nitidulidae).

Download Full-text

Comparative mitochondrial genomes of four species of Sinopodisma and phylogenetic implications (Orthoptera, Melanoplinae)

ZooKeys ◽

10.3897/zookeys.969.49278 ◽

2020 ◽

Vol 969 ◽

pp. 23-42

Author(s):

Qiu Zhongying ◽

Chang Huihui ◽

Yuan Hao ◽

Huang Yuan ◽

Lu Huimeng ◽

...

Keyword(s):

Phylogenetic Analysis ◽

Bayesian Inference ◽

Mitochondrial Genomes ◽

Rich Region ◽

Stem Loop ◽

Protein Coding ◽

Protein Coding Genes ◽

Phylogenetic Implications ◽

Relationship Of ◽

Complete Mitochondrial Genomes

In this study, the whole mitochondrial genomes (mitogenomes) from four species were sequenced. The complete mitochondrial genomes of Sinopodisma pieli, S. houshana, S. qinlingensis, and S. wulingshanensis are 15,857 bp, 15,818 bp, 15,843 bp, and 15,872 bp in size, respectively. The 13 protein-coding genes (PCGs) begin with typical ATN codons, except for COXI in S. qinlingensis, which begins with ACC. The highest A+T content in all the sequenced orthopteran mitogenomes is 76.8% (S. qinlingensis), followed by 76.5% (S. wulingshanensis), 76.4% (S. pieli) and 76.4% (S. houshana) (measured on the major strand). The long polythymine stretches (T-stretch) in the A+T-rich region of the four species are not adjacent to the trnI locus but are inside the stem-loop sequences on the major strand. Moreover, several repeated elements are found in the A+T-rich region of the four species. Phylogenetic analysis based on 53 mitochondrial genomes using Bayesian Inference (BI) and Maximum Likelihood (ML) revealed that Melanoplinae (Podismini) was a monophyletic group; however, the monophyly of Sinopodisma was not supported. These data will provide important information for a better understanding of the phylogenetic relationship of Melanoplinae.

Download Full-text

Three Complete Mitochondrial Genomes of Erotylidae (Coleoptera: Cucujoidea) with Higher Phylogenetic Analysis

Insects ◽

10.3390/insects12060524 ◽

2021 ◽

Vol 12 (6) ◽

pp. 524

Author(s):

Jing Liu ◽

Yuyu Wang ◽

Ruyue Zhang ◽

Chengmin Shi ◽

Weicheng Lu ◽

...

Keyword(s):

Phylogenetic Analyses ◽

Genomic Analysis ◽

Sister Group ◽

Mitochondrial Genomes ◽

Protein Coding ◽

Transfer Rnas ◽

Next Generation Sequencing Technology ◽

The Family ◽

Mt Genome ◽

Complete Mitochondrial Genomes

The family Erotylidae belongs to the superfamily Cucujoidea, which are phytophagous and mycophagous. So far, only two representative complete mitochondrial (mt) genomes of Erotylidae have been sequenced. Mitochondrial genomes of Tritoma metasobrina, Neotriplax arisana, and Episcapha opaca, which all belong to the subfamily Erotylinae, were sequenced using next-generation sequencing technology to better understand the diversity of mt genomes of Erotylidae. A comparative mt genomic analysis was conducted on the three sequenced representatives of Erotylinae and Languriinae sp. (Languriinae). The size of the complete mt genome of the 4 species ranged from 15,581 bp to 16,502 bp in length, including 37 genes (13 protein-coding genes, 22 transfer RNAs, and 2 ribosomal RNAs) and the control region. The arrangements of their mt genomes are highly consistent with other Coleoptera species. The start codons of two PCGs (ND1 and ND5) and the stop codons of one PCG (ATP8) were illustrated differences between Languriinae sp. and the other three species. All tRNAs of these 4 species exhibited cloverleaf secondary structures except that the dihydorouridine (DHU) arm of tRNASer(AGN) was absent. The phylogenetic analyses using both Bayesian inference (BI) and maximum likelihood (ML) methods all supported that Erotylidae as monophyletic. Erotylinae was monophyletic being the sister group to Xenocelinae. Languriinae was closely related to ‘Erotylinae-Xenocelinae’. Our results recovered Languriinae nested within Erotylidae.

Download Full-text

Two Complete Mitochondrial Genomes From Leuctridae (Plecoptera: Nemouroidea): Implications for the Phylogenetic Relationships Among Stoneflies

Journal of Insect Science ◽

10.1093/jisesa/ieab009 ◽

2021 ◽

Vol 21 (1) ◽

Author(s):

Jinjun Cao ◽

Ying Wang ◽

Xuan Guo ◽

Guoquan Wang ◽

Weihai Li ◽

...

Keyword(s):

Phylogenetic Relationships ◽

Mitochondrial Genomes ◽

Protein Coding ◽

Protein Coding Genes ◽

Morphological Studies ◽

Maximum Likelihood Tree ◽

The Family ◽

Family Level ◽

Long Time ◽

Complete Mitochondrial Genomes

Abstract The family-level relationships within Plecoptera have been a focused area of research for a long time. Its higher classification remains unstable, and the phylogenetic relationships within Plecoptera should be re-examined. Here, we sequenced and analyzed two complete mitochondrial genomes (mitogenomes) of Paraleuctra cercia and Perlomyia isobeae of the family Leuctridae. We reconstructed the phylogeny of Plecoptera based on 13 protein-coding genes (PCGs) from published stoneflies. Our results showed that the Bayesian inference and maximum-likelihood tree had similar topological structures except for the positions of two families, Peltoperlidae and Scopuridae. The Plecoptera is divided into two clades, the suborder Antarctoperlaria and the suborder Arctoperlaria. The two suborders subsequently formed two groups, Eusthenioidea and Gripopterygoidea, and Euholognatha and Systellognatha, which is consistent with the results of morphological studies. In addition, the Leuctridae is the earliest branch within the superfamily Nemouroidea. But the monophyly of Perloidea and Pteronarcyoidea are still not well supported.

Download Full-text

The First Two Complete Mitochondrial Genomes of Neoephemeridae (Ephemeroptera): Comparative Analysis and Phylogenetic Implication for Furcatergalia

Genes ◽

10.3390/genes12121875 ◽

2021 ◽

Vol 12 (12) ◽

pp. 1875

Author(s):

Ran Li ◽

Zhenxing Ma ◽

Changfa Zhou

Keyword(s):

Phylogenetic Trees ◽

Purifying Selection ◽

Sister Group ◽

Phylogenetic Position ◽

Sister Group Relationship ◽

General Reference ◽

Protein Coding ◽

The Family ◽

Conserved Gene ◽

Relationship Of

Mayflies of the family Neoephemeridae are widespread in the Holarctic and Oriental regions, and its phylogenetic position is still unstable in the group Furcatergalia (mayflies with fringed gills). In the present study, we determined the complete mitogenomes of two species, namely Potamanthellus edmundsi and Pulchephemera projecta, of this family. The lengths of two mitogenomes were 15,274 bp and 16,031 bp with an A + T content of 73.38% and 73.07%, respectively. Two neoephemerid mitogenomes had a similar gene size, base composition, and codon usage of protein-coding genes (PCGs), and the sequenced gene arrangements were consistent with the putative ancestral insect mitogenomes as understood today. The most variable gene of Furcatergalia mitogenomes was ND2, while the most conserved gene was COI. Meanwhile, the analysis of selection pressures showed that ND6 and ATP8 exhibited a relaxed purifying selection, and COI was under the strongest purifying selection. Phylogenetic trees reconstructed based on two concatenated nucleotide datasets using both maximum likelihood (ML) and Bayesian inference (BI) estimations yielded robust identical topologies. These results corroborated the monophyly of seven studied families and supported the family Leptophlebiidae as being of the basal lineage of Furcatergalia. Additionally, the sister-group relationship of Caenidae and Neoephemeridae was well supported. Methodologically, our present study provides a general reference for future phylogenetic studies of Ephemeroptera at the mitogenome level.

Download Full-text

The phylogenetic position of the tuatara, Sphenodon (Sphenodontida, Amniota), as indicated by cladistic analysis of the ultrastructure of spermatozoa

Philosophical Transactions of the Royal Society B Biological Sciences ◽

10.1098/rstb.1992.0019 ◽

1992 ◽

Vol 335 (1274) ◽

pp. 207-219 ◽

Cited By ~ 26

Keyword(s):

Cladistic Analysis ◽

Sister Group ◽

Sister Taxon ◽

Phylogenetic Position ◽

Sister Group Relationship ◽

Usual Concept ◽

Cladistic Analyses ◽

Relationship Of

Sphenodon has traditionally been regarded as a little changed survivor of the Permo-Triassic thecodont or eosuchian ‘stem reptiles’ but has alternatively been placed in the Lepidosauria as the plesiomorphic or even apomorphic sister-taxon of the squamates. A cladistic analysis of 16 characters from spermatozoal ultrastructure of Sphenodon and other amniotes unequivocally confirms its exceedingly primitive status. The analysis suggests that monotremes are the sister-group of birds; squamates form the sister-group of a bird + monotreme clade while the three sister-groups successively below the bird + monotreme + squa- mate assemblage are the caiman, the tuatara and the outgroup (turtles). The monotreme + bird couplet, supports the concept of the Haemothermia, but can only be regarded heuristically. The usual concept of mammals as a synapsid-derived outgroup of all other extant amniotes is not substantiated spermatologically. All cladistic analyses made, and a separate consideration of apomorphies, indicate that Sphenodon is spermatologically the most primitive amniote, excepting the Chelonia. It is advanced (apomorphic) for the amniotes in only two of the 16 spermatozoal characters considered. A close, sister-group relationship of Sphenodon with squamates is not endorsed.

Download Full-text