scholarly journals The Detection of viruses in olive cultivars in Greece, using a rapid and effective RNA extraction method, for certification of virus-tested propagation material

2020 ◽  
Vol 59 (1) ◽  
pp. 203-211
Author(s):  
Matthaios M. MATHIOUDAKIS ◽  
Maria SAPONARI ◽  
Beata HASIÓW-JAROSZEWSKA ◽  
Toufic ELBEAINO ◽  
Georgios KOUBOURIS
Keyword(s):  
Rna Extraction ◽  
Germplasm Collection ◽  
Virus Infections ◽  
Arabis Mosaic Virus ◽  
Leaf Yellowing ◽  
Production And Distribution ◽  
Olive Cultivars ◽  
Certification Programme ◽  
Leafroll Virus ◽  
Propagation Material

Although Greece is the world’s third largest olive production country, information about the presence of olive viruses is limited. A survey for the presence of virus infections in the ten most important Greek cultivars was conducted in a germplasm collection olive grove located in Chania, Crete. Samples were RT-PCR assayed for the presence of Arabis mosaic virus (ArMV), Cherry leafroll virus (CLRV), Strawberry latent ring spot virus (SLRSV), and Olive leaf yellowing-associated virus (OLYaV), amplifying part of the capsid protein (ArMV), the 3΄UTR (CLSRV, SLRSV) or the HSP70h (OLYaV) gene. Total RNAs were purified using the Trizol method, yielding good quality and purity, thereby confirming application of the method as a rapid economic extraction protocol for detection of olive viruses. SLRSV was the most predominant virus, with an infection rate of 55%, followed by CLRV and OLYaV in 5% of the tested samples. ArMV was detected only in one sample. Mixed virus infections were also commonly detected. The DNA amplicons of the obtained viruses from the infected samples were sequenced. The partial sequences of ArMV, CLRV and SLRSV from olives, which are reported for the first time, showed 74-100% nucleotide similarity with available homologous sequences from other crops, whereas OLYaV isolates showed high sequence variability of 25%. The phylogenetic analysis based on olive-OLYaV HSP70h partial-nucleotide sequences grouped the olive isolate sequences according to the geographical origins of the host germplasm collection. This is the first official report of the occurrence of olive viruses in Greece, emphasizing the need to implement a certification programme for production and distribution of high-quality (virus-free) olive propagation material, in Greece and more generally in the Mediterranean basin.

scholarly journals Studies on the Occurrence of Viruses in Planting Material of Grapevines in Southwestern Germany

Viruses ◽  
2021 ◽  
Vol 13 (2) ◽  
pp. 248
Author(s):  
Noemi Messmer ◽  
Patricia Bohnert ◽  
Stefan Schumacher ◽  
René Fuchs
Keyword(s):  
Preventive Measures ◽  
Control Measures ◽  
Grapevine Fanleaf Virus ◽  
Arabis Mosaic Virus ◽  
Planting Material ◽  
General Decline ◽  
Grapevine Pinot Gris Virus ◽  
Propagation Material

Viral diseases in viticulture lead to annual losses in the quantity and quality of grape production. Since no direct control measures are available in practice, preventive measures are taken to keep the vines healthy. These include, for example, the testing of propagation material for viruses such as Arabis mosaic virus (ArMV), Grapevine fanleaf virus (GFLV) or Grapevine leafroll-associated virus 1 (GLRaV-1) and 3 (GLRaV-3). As long-term investigations have shown, GLRaV-1 (2.1%) occurs most frequently in southwestern German wine-growing regions, whereas GLRaV-3 (<0.1%) is almost never found. However, tests conducted over 12 years indicate that there is no general decline in virus-infected planting material. Thus, it can be assumed that a spread of the viruses via corresponding vectors still takes place unhindered. Beyond the examinations regulated within the German Wine Growing Ordinance, one-time tests were carried out on Grapevine Pinot gris virus (GPGV). This analysis showed that GPGV was found in 17.2% of the samples.

scholarly journals Virus Surveys in Olive Orchards in Greece Identify Olive Virus T, a Novel Member of the Genus Tepovirus

Pathogens ◽  
2021 ◽  
Vol 10 (5) ◽  
pp. 574
Author(s):  
Evanthia Xylogianni ◽  
Paolo Margaria ◽  
Dennis Knierim ◽  
Kyriaki Sareli ◽  
Stephan Winter ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Leaf Roll ◽  
Virus Infections ◽  
Northern Greece ◽  
Coat Protein Region ◽  
Cherry Leaf Roll Virus ◽  
Leaf Yellowing ◽  
Olive Trees ◽  
Olive Varieties ◽  
Viral Sequences

Field surveys were conducted in Greek olive orchards from 2017 to 2020 to collect information on the sanitary status of the trees. Using a high-throughput sequencing approach, viral sequences were identified in total RNA extracts from several trees and assembled to reconstruct the complete genomes of two isolates of a new viral species of the genus Tepovirus (Betaflexiviridae), for which the name olive virus T (OlVT) is proposed. A reverse transcription–polymerase chain reaction assay was developed which detected OlVT in samples collected in olive growing regions in Central and Northern Greece, showing a virus prevalence of 4.4% in the olive trees screened. Sequences of amplified fragments from the movement–coat protein region of OlVT isolates varied from 75.64% to 99.35%. Three olive varieties (Koroneiki, Arbequina and Frantoio) were infected with OlVT via grafting to confirm a graft-transmissible agent, but virus infections remained latent. In addition, cucumber mosaic virus, olive leaf yellowing-associated virus and cherry leaf roll virus were identified.

Cherry leafroll virus infections are affected by a satellite RNA that the virus does not support

Virology ◽  
1987 ◽  
Vol 160 (1) ◽  
pp. 183-190 ◽  
Author(s):  
Fernando Ponz ◽  
Adib Rowhani ◽  
S.M. Mircetich ◽  
George Bruening
Keyword(s):  
Virus Infections ◽  
Satellite Rna ◽  
Leafroll Virus

A Brief Outline of Infectious Diseases of Olive

2013 ◽  
Vol 1 (1) ◽  
pp. 1-9
Author(s):  
Giovanni P. Martelli
Keyword(s):  
Viral Infections ◽  
Middle Eastern ◽  
Mechanical Transmission ◽  
Virus Infections ◽  
Preventive Control ◽  
Ribonucleic Acids ◽  
Virus Identification ◽  
Worldwide Distribution ◽  
Viral Aetiology ◽  
Leafroll Virus

Abstract: Virus infections of olive (Olea europaea), to which littte attention has been paid up to a relatively recent past, are surprisingly widespread, as shown by: (i) the very high presence (above 50% in average) of double-stranded ribonucleic acids (dsRNAs) in the plants analysed in the course of field surveys carried out especially in the Mediterranean and Middle Eastern countries; (ii) the identification in these plants of 15 different viruses with diverse taxonomic allocation. Infections are generally symptomless. When shown, symptoms consist of deformations of fruits and leaves and of foliar discolourations ranging from chlorosis to bright yellowing. “Bumpy fruits” and the “Leaf yellowing complex” are the only two diseases whose viral aetiology seems to be convincingly ascertained. Virus identification is not based on biotests (mechanical transmission to herbaceous hosts is unreliable and there are no differential woody indicators available) nor on immunoenzymatic assays (ELISA), which are also unreliable, but on nucleic acid-based techniques (various RT-PCR protocols). The economic impact of infections has not been determined although recent reports indicate that some viruses seem to affect the yield and the quality of the oil. For an ultimate answer, a comparison needs to be done between selected and sanitazied accessions and their infected counterparts. Equally scanty is the information on the epidemiology of olive-infecting viruses, except for three necroviruses (OLV-1, TNV-D and OMMV), whose transmission through soil, direct or mediated by Olpidium brassicae, has been experimentally ascertained. Olive latent virus 1 (OLV-1) and Cherry leafroll virus (CLRV) are transmitted through seeds and seedlings and, like all the other viruses, with propagating material (nursery productions), which is the major responsible for their worldwide distribution. Viral infections have been detected in 22 countries in the five continents. Preventive control through certification schemes is desirable. One of such schemes designed and implemented in Italy, is based on the pomological and sanitary selection and sanitation of mother stocks.

scholarly journals DNA Sequence Analysis of Microsatellite Markers Enhances Their Efficiency for Germplasm Management in an Italian Olive Collection

2006 ◽  
Vol 131 (3) ◽  
pp. 352-359 ◽  
Author(s):  
Innocenzo Muzzalupo ◽  
Nicola Lombardo ◽  
Aldo Musacchio ◽  
Maria Elena Noce ◽  
Giuseppe Pellegrino ◽  
...  
Keyword(s):  
Sequence Analysis ◽  
Microsatellite Markers ◽  
Dna Sequence ◽  
Genetic Relationships ◽  
Germplasm Collection ◽  
Electrophoretic Analysis ◽  
Dna Sequence Analysis ◽  
Germplasm Management ◽  
Olive Cultivars ◽  
High Level

Genetic diversity studies using microsatelite analysis were carried out in a set of 39 accessions of Olea europaea L., corresponding to the majority of the regional autochthon germplasm in Apulia. Samples of olive leaves were harvested from plants growing in the olive germplasm collection of the Consiglio per la Ricerca e Sperimentazione in Agricoltura (C.R.A.) - Istituto Sperimentale per l'Olivicoltura at Rende in Cosenza Italy. Herein, we evaluated the extent to which microsatellite analysis using electrophoresis was capable of identifying traditional olive cultivars. In addition, the DNA sequence of all amplicons was determined and the number of repeat units was established for each sample. Using five loci, electrophoretic analysis identified 24 genotype profiles, while DNA sequence analysis detected 28 different genotype profiles, identifying 54% of cultivars. The remaining 46% were composed of seven different accession groups containing genetically indistinguishable cultivars, which are presumably synonyms. This study demonstrates the utility of microsatellite markers for management of olive germplasm and points out the high level of polymorphisms in microsatellite repeats when coupled with DNA sequence analysis. The establishment of genetic relationships among cultivars in the Apulian germplasm collection allows for the construction of a molecular database that can be used to establish the genetic relationships between known and unknown cultivars.

scholarly journals Comparison of Next-Generation Sequencing Versus Biological Indexing for the Optimal Detection of Viral Pathogens in Grapevine

2015 ◽  
Vol 105 (6) ◽  
pp. 758-763 ◽  
Author(s):  
Maher Al Rwahnih ◽  
Steve Daubert ◽  
Deborah Golino ◽  
Christina Islas ◽  
Adib Rowhani
Keyword(s):  
Next Generation Sequencing ◽  
Host Plants ◽  
Next Generation ◽  
Virus Infections ◽  
Laboratory Procedure ◽  
Viral Pathogens ◽  
Dna And Rna ◽  
Next Generation Sequencing Ngs ◽  
Generation Sequencing ◽  
Propagation Material

A bioassay is routinely used to determine the viral phytosanitary status of commercial grapevine propagation material in many countries around the world. That test is based on the symptoms developed in the field by specific indicator host plants that are graft-inoculated from the vines being tested. We compared the bioassay against next-generation sequencing (NGS) analysis of grapevine material. NGS is a laboratory procedure that catalogs the genomic sequences of the viruses and other pathogens extracted as DNA and RNA from infected vines. NGS analysis was found to be superior to the standard bioassay in detection of viruses of agronomic significance, including virus infections at low titers. NGS was also found to be superior to the bioassay in its comprehensiveness, the speed of its analysis, and for the discovery of novel, uncharacterized viruses.

scholarly journals Evaluation of sanitary status of grapevines in the Czech Republic

2011 ◽  
Vol 49 (No. 2) ◽  
pp. 63-66 ◽  
Author(s):  
P. Komínek ◽  
V. Holleinová
Keyword(s):  
Czech Republic ◽  
Grapevine Virus ◽  
Arabis Mosaic Virus ◽  
The Czech Republic ◽  
Grapevine Virus A ◽  
Grapevine Virus B ◽  
Near Future ◽  
Infected Grapevine ◽  
Das Elisa ◽  
Propagation Material

A survey was made to evaluate sanitary status of grapevines in the Czech Republic with regard to occurrence of economically important viruses. Propagation material of 109 grapevine clones was tested for presence of Grapevine fanleaf virus, Arabis mosaic virus, Grapevine leafroll-associated virus 1, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine virus B and Grapevine fleck virus. Dormant canes were collected and cortical scrappings were analyzed by DAS-ELISA. All seven viruses tested were found to be widely spread in Czech propagation material of grapevine. From 330 individual vines tested, 148 vines were found to be infected with at least one virus. From 109 clones tested, in 98 clones at least one vine negative for tested pathogens was found. Such vines were promoted as candidate plants into screenhouse in Faculty of Horticulture Lednice and will be further tested by other methods. Sanitation of infected grapevine clones is needed in near future.

scholarly journals Characterization of Cherry leafroll virus in Sweet Cherry in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1067-1067 ◽  
Author(s):  
K. C. Eastwell ◽  
W. E. Howell
Keyword(s):  
Mosaic Virus ◽  
Sweet Cherry ◽  
The United States ◽  
Ringspot Virus ◽  
Natural Occurrence ◽  
Rt Pcr ◽  
Fresh Market ◽  
Arabis Mosaic Virus ◽  
Leafroll Virus ◽  
Cherry Trees

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Sign in / Sign up

Export Citation Format

Share Document