DESIGN OF HIGHLY SPECIFIC OLIGONUCLEOTIDE PRIMERS AND PROBES FOR THE IDENTIFICATION OF NON-TUBERCULOSIS MYCOBACTERIA

The purpose of this work was to develop highly specific oligonucleotide primers and probes for the identification of non-tuberculosis mycobacteria in pathological material taken from tuberculin-responsive cattle. The article presents the result of the development and design of a set of oligonucleotide primers and probes, research of their specificity and sensitivity. The primers and probes developed by us for the identification of non-tuberculosis mycobacteria in order to differentiate nonspecific reactions to tuberculin in cattle have high specificity and sensitivity.

USE OF DIFFERENTIAL LYSIS FOR DNA ISOLATION TO CONFIRM SPERM TRANSFECTION

The purpose of the work. Despite some progress, the creation of transgenic pigs remains a long and inefficient process. One of the key points in the transfection of porcine generative cells is determining the event of the internalization of foreign DNA by cells. The methods currently used to determine the event of the internalization of foreign DNA by cells do not take into account the possibility of the presence of foreign DNA on the surface of sperm, even after washing from the culture medium. With this in mind, the purpose of this work is to develop a method for confirming the transfection of sperm with plasmid DNA. Materials and methods of research. Sperm were washed four times with GCCS diluent. Sperm transfection was carried out in 0.6 ml polypropylene tubes with a lid in a volume of 50 μl of a suspension of protein-washed sperm in GCCS with a sperm concentration of 100 million/ml. To 50 μl of the suspension of washed sperm from proteins it was added 10 μl of the ring form of plasmid pET-28c (Novagen, France). Sperm were incubated in a thermostat at 37.7°C for two hours. Incubated sperm were stored at -20°C. To isolate DNA, 60 μl of a suspension of washed sperm from proteins with plasmid pET-28c was transferred to 1.5 ml of a polypropylene tube with a lid and centrifuged for 5 min under conditions of 12 thousand vol. min, then 35 μl of supernatant was transferred into a clean 1.5 ml tube leaving at the bottom of approximately 25 μl of liquid with sediment. Isolation of DNA from the supernatant: In a 1.5 ml tube containing 35 μl of supernatant, 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 were added to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing the DNA of plasmid pET-28c was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. Isolation of DNA from the precipitate: To the precipitate it was added 100 μl of TE buffer and 2 μl of Proteinase K (20 mg/ml) and kept for 1.5 h at +56°C. After 5 minutes of centrifugation under conditions of 12 thousand vol. min the supernatant was removed, then to the precipitate was added 100 μl of TE buffer. The procedure of washing with TE buffer was repeated twice. To the purified precipitate it was added 7 μl of dithiothreitol (DTT), 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid-state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing boar sperm DNA was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. The amplification was performed on a programmable thermostat TERTSIK-2 (DNA Technology, Russia). Oligonucleotide primers for the amplification of pET-28c DNA had the following structure: T7 promoter – TAATACGACTCACTATAGGG, T7 terminator – CGCTGAGCAATAACTAGC. This pair of oligonucleotide primers allows to obtain a PCR product with a size of 314 b.p. Tubes with PCR products were stored at -20°C. The specificity of the PCR products was checked by 2% agarose gel electrophoresis in 1 × Tris-borate electrode buffer (TBE) for 2 h at a current of 50 mA in a horizontal electrophoretic chamber (Cleaver Scientific Ltd., UK). DNA of plasmid pUC19 hydrolyzed by Msp I endonuclease was used as a molecular weight marker. After electrophoresis, the gel was stained with ethidium bromide solution (10 mg / cm3), and the results of electrophoresis were photographed using a gel documentation system (Cleaver Scientific Ltd., UK). Research results. The amplification of DNA of plasmid pET-28c, which was isolated using differential lysis, allowed to obtain a PCR product with a size of 314 b.p. The size of the PCR product using oligonucleotide primers (T7promoter/T7terminator) was as expected. Thus, evidence was obtained that plasmid DNA can enter sperm. Conclusions. The time required to isolate DNA using differential lysis depends on the qualifications of the staff and the amount of researches and averages 5–6 hours. This method of DNA isolation does not require the complex equipment and significant costs for reagents, but fertilization of eggs with sperm with a confirmed transfection event will save in the next stages of transfection.

Design and validation of oligonucleotide primers suitable for waterborne bacterial pathogen detection via real-time qPCR

Fecal coliforms have been used as indicators to evaluate health risks associated with the microbiological quality of water for many years. Recent studies have challenged their ability to accurately predict bacterial numbers in the natural environment. DNA-based assays are proposed candidates to replace existing methods, but protocols suited for standardized direct-use have not yet been sufficiently developed. The objective of this study was to examine the feasibility of using real-time quantitative PCR (qPCR) to detect contamination from five waterborne bacterial pathogens in surface and treated drinking waters. Robust oligonucleotide primers were assembled to target virulence-associated genes. Primers were found to have high specificity and increased sensitivity for low pathogen loads of 10 cells/mL, as determined experimentally via qPCR. Detection of pathogenic cells directly from an environmental matrix has also been demonstrated using a filtration-extraction procedure. The developed protocols have shown their potential for use in conjunction with traditional indicator techniques.

Design and validation of oligonucleotide primers suitable for waterborne bacterial pathogen detection via real-time qPCR

Fecal coliforms have been used as indicators to evaluate health risks associated with the microbiological quality of water for many years. Recent studies have challenged their ability to accurately predict bacterial numbers in the natural environment. DNA-based assays are proposed candidates to replace existing methods, but protocols suited for standardized direct-use have not yet been sufficiently developed. The objective of this study was to examine the feasibility of using real-time quantitative PCR (qPCR) to detect contamination from five waterborne bacterial pathogens in surface and treated drinking waters. Robust oligonucleotide primers were assembled to target virulence-associated genes. Primers were found to have high specificity and increased sensitivity for low pathogen loads of 10 cells/mL, as determined experimentally via qPCR. Detection of pathogenic cells directly from an environmental matrix has also been demonstrated using a filtration-extraction procedure. The developed protocols have shown their potential for use in conjunction with traditional indicator techniques.

Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties

Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse. Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants. The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI. Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively. Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively. This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.

Synthesis of Libraries and Multi-Site Mutagenesis using a PCR derived, dU-containing Template

Directed DNA libraries are useful because they focus genetic diversity in the most important regions within a sequence. Ideally, all sequences in such libraries should appear with the same frequency and there should be no significant background from the starting sequence. These properties maximize the number of different sequences that can be screened. Described herein is a method termed SLUPT (Synthesis of Libraries via a dU-containing PCR Template) for generating highly targeted DNA libraries and/or multi-site mutations wherein the altered bases may be widely distributed within a target sequence. This method is highly efficient and modular. Moreover, multiple distinct sites, each with one or more base changes, can be altered in a single reaction. There is very low background from the starting sequence, and SLUPT libraries have similar representation of each base at the positions selected for variation. The SLUPT method utilizes a single stranded dU-containing DNA template that is made by PCR. Synthesis of the template in this way is significantly easier than has been described earlier. A series of oligonucleotide primers that are homologous to the template and encode the desired genetic diversity are extended and ligated in a single reaction to form the mutated product sequence or library. After selective inactivation of the template, only the product library is amplified. There are no restrictions on the spacing of the mutagenic primers except that they cannot overlap.

IDENTIFICATION OF SUNFLOWER PATHOGENIC FUNGUS PLENODOMUS LINDQUISTII USING PCR WITH SPECIES-SPECIFIC OLIGONUCLEOTIDE PRIMERS

Plenodomus lindquistii causes Phoma black stem of sunflower which is the most common stem disease of this crop in Russia. The diagnostics of both field specimens and pure cultures of P. lindquistii is troublesome. Molecular methods involving the use of the PCR are rapid diagnostic express tests that can precisely identify and detect fungal species. The aim of this study was to develop species-specific oligonucleotide primers for selective amplification of P. lindquistii DNA. The primers LepliF2/LepliR2 were designed on the basis of ITS region analysis and showed stable amplification of the target fungus DNA with no cross-reaction with other fungal species. The primers are recommended for express detection of the causative agent of Phoma black stem of sunflower. This is the first PCR assay that could be used to rapidly reveal and identify this pathogen.

DNA Variations between Medicago truncatula Symbiotic Mutant Line and Native Variant Using Fluorescence-Based AFLP Marker

Genetic mutagenesis is a very efficient tool in studying genes function. Because of great benefits of legumes as human food and animal feed worldwide, we used a model plant Medicago truncatula for identification gene function related to nitrogen fixation process. Our mutant is a Medicago mutant line contains a tobacco Tnt1 retro-transposon mobile element with the two Long Terminal Repeats (LTR) inserted within the genome. Our mutant is predicted to contain a mutation in gene/s belonging to symbiotic interaction between legume and rhizobia. A novel technique was used based on using fluorescent oligonucleotide primers against oligonucleotide primers for Tnt1-LTRs of our mutant. This novel protocol was very successful in detection the polymorphism between our mutant line and the wild variant R108 using Biosystems 310 Genetic Analyzer. Electropherograms of the mutant line and wild type gave a total of 561 well- resolved AFLP peaks, 357of which were polymorphic peaks and 204 were monomorphic peaks. This novel technique enables the calculation percentage of polymorphism between the mutant line and the wild type. Additionally primers combinations amplified more bands from others to detect polymorphism between the plants

EFFICACY OF SPECIFIC PREVENTION OF INFLUENZA IN INDIVIDUALS WITH POLYMORPHISMS ARG753GLN OF TLR-2, LEU412PHE OF TLR-3, ASP299GLY OF TLR-4 GENES

The aim: Is to study the efficacy of influenza vaccination for individuals with polymorphism Arg753Gln of TLR-2 gene, Leu412Phe of TLR-3 gene, and Asp299Gly of TLR-4 gene. Materials and methods: 66 people with mutant genotypes and normal distribution of alleles of TLR-2, TLR-3, TLR-4 genes, aged 18-63, were inoculated with anti-influenza vaccine. The genotyping of Arg753Gln polymorphic site of TLR-2, Asp299Gly of TLR-4, and Leu412Phe of TLR-3 gene was carried out by polymerase chain reaction with oligonucleotide primers usage. The immunological efficacy of vaccination was evaluated by seroconversion, seroprotection, and dynamics of mean geometric titers of antibodies. Results: It has been established that individuals with mutant genotypes Arg/Gln of TLR-2, Leu/Phe, Phe/Phe of TLR-3, Asp/Gly of TLR-4 genes have a vaccinal response to administering anti-influenza vaccine at the level of subjects with normal distribution of TLR alleles, as evidenced by the growth in dynamics of mean geometric titers of antibodies to vaccine strains, the level of seroprotection and seroconversion. Clinical and epidemiological efficacy of vaccination in this category of people is characterized by: reduction of ARI cases in the postvaccinal period by 2,0-3,0 times; prevention of pneumonia in all vaccinated subjects; decrease in the frequency of bronchitis by 2,5-3,8 times. Conclusions: Effectiveness of influenza vaccination in individuals with Arg573Gln polymorphism of TLR-2, Leu412Phe of TLR-3, Asp299Gly of TLR-4 genes by immune and clinical epidemiological parameters is determined at the level of vaccinated subjects with normal distribution of TLR-2, TLR-3, TLR-4 alleles. Specific influenza immunization of people with polymorphic modified genotypes of TLR-2, TLR-3, TLR-4 genes can prevent the development of pneumonia and reduce the incidence of bronchitis.