scholarly journals Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties

2021 ◽  
Vol 22 (2) ◽  
Author(s):  
Reny Herawati ◽  
ALNOPRI ALNOPRI ◽  
MASDAR MASDAR ◽  
MARULAK SIMARMATA ◽  
SIPRIYADI SIPRIYADI ◽  
...  
Keyword(s):  
Molecular Analysis ◽  
Evaluation System ◽  
Upland Rice ◽  
Pcr Amplification ◽  
Severe Drought ◽  
Potential Yield ◽  
Rice Varieties ◽  
Dry Land ◽  
Oligonucleotide Primers ◽  
Drought Tolerant

Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse.  Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants.  The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI.  Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively.  Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively.  This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.

scholarly journals Evaluation of Short Duration Drought Tolerant Rice Varieties in Drought Prone Areas of Subarnapur District of Odisha

2020 ◽  
pp. 21-26
Author(s):  
S. Pradhan ◽  
F. H. Rahman ◽  
S. Sethy ◽  
G. Pradhan ◽  
J. Sen
Keyword(s):  
Short Duration ◽  
Upland Rice ◽  
Plant Protection ◽  
Block Design ◽  
Rice Variety ◽  
Rice Varieties ◽  
Agronomic Practices ◽  
Drought Tolerant ◽  
Randomized Block Design ◽  
Sowing Seed

A study was conducted in farmer’s field through technology demonstrations during Kharif season of 2018 and 2019 in Subarnapur district of Odisha to recommend the most suited short duration drought tolerant upland rice variety particular to the locality. Six different varieties like Sahabhagi dhan, Mandakini, Jogesh, DRR-44, and DRR-42 & Khandagiri were taken with four replications in Randomized Block Design in both years. Technology demonstration included not only the improved short duration varieties, but also a package of good agronomic practices viz. line sowing, seed treatment with Bavistin, proper fertilization with dose @ 80:40:40 NPK/ha, pre emergence herbicide application with pretilachlor, needful manual weeding and  need based plant protection chemicals. The results of demonstration showed that farmers could increase rice productivity notably by adopting improved variety Sahabhagi dhan and DRR-44. These varieties recorded higher grain yields of 64% and 46%, respectively, and fetched a sum return of Rs 25620 and Rs 25275 over farmers’ local variety Khandagiri.

High-yielding NERICA mutant rice for upland areas and hope for Bangladeshi farmers.

2021 ◽  
pp. 53-64
Author(s):  
Mirza Mofazzal Islam ◽  
Shamsun Nahar Begum ◽  
Rigyan Gupta
Keyword(s):  
Drought Tolerance ◽  
Grain Yield ◽  
Crop Production ◽  
Upland Rice ◽  
Vital Role ◽  
High Yield ◽  
Rice Varieties ◽  
Commercial Cultivation ◽  
Drought Tolerant ◽  
Different Doses

Abstract Drought is an important stress phenomenon in Bangladesh that greatly hampers crop production. So, it is imperative to develop drought-tolerant rice varieties. Low-yielding, non-uniform flowering and late-maturing Africa rice - New Rice for Africa (NERICA), viz. NERICA-1, NERICA-4 and NERICA-10 varieties - were irradiated with different doses of gamma-rays (250, 300 and 350 Gy) in 2010. M1 plants were grown and M2 plants were selected based on earliness and higher grain yield. The desired mutants along with other mutants were grown as the M3 generation during 2011. A total of 37 mutants from NERICA-1, NERICA-4 and NERICA-10 were selected on the basis of plant height, short duration, drought tolerance and high yield in the M4 generation. In the M5 generation, six mutants were selected for drought tolerance, earliness, grain quality and higher yield. With respect to days to maturity and grain yield (t/ha), the mutant N1/250/P-2-6-1 of NERICA-1 matured earlier (108 days) and had higher grain yield (5.1 t/ha) than the parent. The mutant N4/350/P-4(5) of NERICA-4 also showed a higher grain yield (6.2 t/ha) than its parent and other mutants. On the other hand, NERICA-10 mutant N10/350/P-5-4 matured earlier and had a higher yield (4.5 t/ha) than its parent. Finally, based on agronomic performance and drought tolerance, the two mutants N4/350/P-4(5) and N10/350/P-5-4 were selected and were evaluated in drought-prone and upland areas during 2016 and 2017. These two mutants performed well with higher grain yield than the released upland rice varieties. They will be released soon for commercial cultivation and are anticipated to play a vital role in food security in Bangladesh.

scholarly journals Study on the Adaptation of Superior and Local Upland Rice Varieties (Oriza sativa) in Dry Climate of West Southeast Moluccas Border Region of Country

2019 ◽  
Vol 7 (1) ◽  
pp. 163
Author(s):  
Sheny S. Kaihatu ◽  
Wahid Wahid ◽  
Edwen D. Waas ◽  
Marthen P. Sirappa
Keyword(s):  
Plant Density ◽  
Upland Rice ◽  
Block Design ◽  
Border Region ◽  
The West ◽  
Rice Varieties ◽  
Local Varieties ◽  
Dry Land ◽  
Yield Increase ◽  
New Varieties

This study on the adaptation of superior and local upland rice on dry climate was carried out from July to October 2017 at the West Southeast Moluccas Main Seed Center involving 15 members of the Webat Farmer Groups. The aim of this study was to obtain adaptive superior and local varieties that could potentially be developed in dry climates (dry land) in the region. Field assessments were done usinged a Randomized Block Design with eight treatments (superior and local varieties of upland rice) and repeated three times. The five superior varieties assessed were Towuti, Inpago 8, Inpago 9, Inpago 10, and Inpago 11 and the three local varieties used were Red Tanimbar, White Tanimbar, and Black Tanimbar. The results of the study showed that the average productivity of superior new varieties of upland rice higher yields (2.03 t ha-1) compared to local varieties (1.24 t ha-1), revealing a yield increase of 63.71 %. Results suggest that there are five varieties of upland rice that have potential to be developed in the West Southeast Moluccas Border Region, namely Inpago 9, Inpago 10, and Inpago 11 (superior new varieties), and Red Tanimbar and White Tanimbar (local varieties). However, the yields obtained in this assessment are still low because the number of productive tillers is also low. This could be due to low plant density caused by the very small number of seeds used per planting hole, and the effect of legowo 2: 1 planting system with a very wide.

Productivity of three varieties of local upland rice on swidden agriculture field in Setulang village, North Kalimantan, Indonesia

2019 ◽  
Vol 21 (1) ◽  
Author(s):  
OKTIANI PERIDA MERANG ◽  
Abubakar M. Lahjie ◽  
SYAHRIR YUSUF ◽  
YOSEP RUSLIM
Keyword(s):  
Sampling Method ◽  
Upland Rice ◽  
Total Production ◽  
Swidden Agriculture ◽  
Rice Varieties ◽  
Dry Land ◽  
Cultivation System ◽  
Fallow Period ◽  
Maximum Production ◽  
One Year

Abstract. Merang OP, Lahjie AM, Yusuf S, Ruslim Y. 2020. Productivity of three varieties of local upland rice on swidden agriculture field in Setulang village, North Kalimantan, Indonesia. Biodiversitas 21: 49-56. Swidden agriculture field is a dry land used by traditional farmers to cultivate some varieties of local upland rice intercropped with vegetables, tubers, and fruits. This rotational cultivation system utilizes the land for planting such food crops in one year period before it is left for fallow periods for years. This study aimed to assess the productivity of local upland rice varieties (i.e. Langsat rice, Telang Usan rice, and Pimping rice) cultivated on swidden agriculture field in regard to the fallow periods. This study was conducted in Setulang village, Malinau District, North Kalimantan Province and employed purposive sampling method using interviews of selected respondents and field observation. Among three varieties of rice in this study, Langsat rice had the longest fallow period with 17 years while Pimping rice had the shortest fallow period with 13 years, with the maximum production were 2,635 kg ha-1 and 1,670 kg ha-1, respectively. Meanwhile, Telang Usan rice reached the maximum production on fallow period of 15 years with the total production of 2,208 kg ha-1. Overall, of the three types of rice planted, the results show that the longer the fallow period, the higher the rice production and the shorter the fallow period, the lower the production. Each type of rice has a different amount of production, although it is planted during the same fallow period.

scholarly journals Verifikasi Lokus Aluminum Tolerance (Alt) pada Tiga Populasi BC3F1 Padi

2019 ◽  
Vol 47 (1) ◽  
pp. 9-17
Author(s):  
Muhammad Rauful Mizan ◽  
Desta Wirnas ◽  
Dan Joko Prasetiyono
Keyword(s):  
Upland Rice ◽  
Aluminum Tolerance ◽  
Al Toxicity ◽  
Marginal Lands ◽  
Rice Varieties ◽  
Dry Land ◽  
P Deficiency ◽  
Materials Used ◽  
Nutrient Solutions ◽  
Recipient Parent

Most of marginal lands in Indonesia are in the form of acid dry land with low available P and high Al concentrations. Development of tolerant rice varieties to P deficiency and Al toxicity is one way to increase rice production. This study aimed to select BC3F1-Pup1+Alt genotypes from three crosses based on foreground and background markers. This research was conducted at the Indonesian Center for Agricultural Biotechnology and Genetic Resources Research and Development, Bogor, from August to December 2015. The materials used were 300 genotypes of BC3F1 Dodokan-Pup1+Alt, BC3F1 Situ Bagendit-Pup1+Alt, BC3F1 Batur-Pup1+Alt, and the parents. The research included selection in modified Yoshida’s nutrient solutions (0.5 ppm P dan 60 ppm Al) followed by foreground selection and background selection. Selection using Yoshida’s nutrient solution resulted in 150 genotypes with longer root than the recipient parent in each of the BC3F1 populations. Selection with foreground markers using markers RM1361 and RM12031 produced 85 genotypes of BC3F1 Dodokan-Pup1+Alt (56.6%), 105 genotypes of BC3F1 Situ Bagendit-Pup1+Alt (70%), and 77 genotypes of BC3F1 Batur-Pup1+Alt (51.33%). Selection using background markers revealed that genotype number 116 (BC3F1 Dodokan-Pup1+Alt), number 2 (BC3F1 Situ Bagendit-Pup1+Alt), and number 129 (BC3F1 Batur-Pup1+Alt) were the best genotypes with percentage of parent recovery of 95%, 90%, and 90.5%, respectively. These three genotypes were verified to have Alt loci and had the largest genetic proportion of restoring parents. Keywords: Alt, background markers, foreground markers, Pup1, upland rice

scholarly journals Farmers’ Preferred Traits and Perceptions of Drought Stress on Rainfed Upland Rice Production across Two Rice Growing States of Nigeria

2019 ◽  
Vol 7 (2) ◽  
pp. 160
Author(s):  
Christian Okechukwu Anyaoha ◽  
Uyokei Uba ◽  
Ejiro Onotugoma ◽  
Semon Mande ◽  
Vernon Gracen ◽  
...  
Keyword(s):  
Drought Stress ◽  
Upland Rice ◽  
Rice Variety ◽  
Rice Production ◽  
Comparative Approach ◽  
Structured Interviews ◽  
Rice Varieties ◽  
Rice Farmers ◽  
Drought Tolerant ◽  
Rainfed Upland

The intermittent and widespread occurrence of drought in rainfed upland rice fields across sub-Sahara Africa has led to tremendous decrease in food security in the region. Although high yielding, drought tolerant varieties have been developed over years to mitigate this trend, limited adoption had been recorded for most of these materials. This study investigated farmers’ perceptions on drought stress and their preferred traits in new upland rice varieties across two major upland rice growing states in Nigeria. Participatory Rural Appraisal was conducted among 119 rice farmers using comparative approach, probing and semi structured interviews. Result based on farmers knowledge of changes in rainfall pattern and preferred traits such as plant architecture and grain shapes in a new upland rice variety differed significantly across the two state. The results identified drought stress as one of the main constraints to upland rice production across communities. The ideal upland rice variety desired by most respondents in both states should be of medium plant height (115-130cm) characterized by white, long and bold grains. This study has demonstrated the importance of understanding farmer’s desired traits in a new upland rice variety and the need to incorporate identified traits in creation of resilient new upland rice varieties adaptable to rain-fed upland rice growing regions of Nigeria.

scholarly journals Formation of upland rice drought-tolerant mutants by mutation induction and in vitro selection

2020 ◽  
Vol 21 (4) ◽  
Author(s):  
Rossa Yunita ◽  
ISWARI S. DEWI ◽  
ENDANG GATI LESTARI ◽  
RAGAPADMI PURNAMANENGSIH ◽  
SUCI RAHAYU ◽  
...  
Keyword(s):  
In Vitro Selection ◽  
Gamma Ray ◽  
Upland Rice ◽  
Mutation Induction ◽  
Selection Methods ◽  
Rice Varieties ◽  
Drought Tolerant ◽  
Gamma Ray Irradiation

Abstract. Yunita R, Dewi IS, Lestari EG, Purnamanengsih R, Rahayu S, Mastur. 2020. Formation of upland rice drought-tolerant mutants by mutation induction and in vitro selection. Biodiversitas 21: 1476-1482. Increased production can be done by increasing the planting area, but the available land is sub-optimal land with drought stress. Drought-tolerant rice varieties are needed to utilize this land. To create drought-tolerant rice can use induction mutation and in vitro selection methods. This study aims to obtain tolerant upland rice mutants through mutation and in vitro selection. The parents used were Batutegi and Situpatenggang varieties. This research consisted of several main activities, namely callus induction, determination of LD 50% value ofPEG determination of LC 50% value of gamma-ray irradiation, mutation induction and in vitro selection, bud regeneration and acclimatization. The results of this study are mutant callus formed by gamma-ray irradiation at a dose of 24.68 Gy for Situpatenggang and 22.15 Gy for Batutegi (LD50) and selected on PEG media at a dose of 24.11% for Situpatenggang and 25.18% for Batutegi (LC50). The mutant callus regenerated on MS + BA 3 mg/L + Zeatin 0.1 mg/L produced 83 Situpatenggang shoots and 73 Batutegi shoots and successfully acclimatized were 52 Situpatenggang lines and 49 Batuteg linesBatutegi

scholarly journals TEKNOLOGI PIRAMIDA GEN TANAMAN PADI DALAM MENGHADAPI PERUBAHAN IKLIM GLOBAL

2020 ◽  
Vol 19 (3B) ◽  
Author(s):  
Fatimah Fatimah ◽  
Joko Prasetiyono ◽  
Sustiprijatno Sustiprijatno
Keyword(s):  
Climate Change ◽  
Food Security ◽  
Phenotypic Selection ◽  
Rice Varieties ◽  
New Variety ◽  
Dry Land ◽  
Agriculture Sector ◽  
Drought Tolerant ◽  
Gene Pyramid ◽  
Marker Assisted Backcrossing

In the attempt to maintain and hopefully increase national rice production, it is necessary to prepare agriculture sector in facing the impacts of climate change, land degradation, dry land, flooding, slowing production, and population growth rate. Adaptation efforts play an important role in ensuring the sustainability of food security. The development of adaptive rice varieties to abiotic stresses specifically drought and submergence stresses are expected to minimize damage, survive stress, continue to grow and produce. Development of Inpari 30 rice varieties tolerant to submergence to drought tolerant to have a broader spectrum of tolerance through marker-assisted backcrossing methods with the gene pyramid approach. The development of new variety using Inpari 30 as the background is one of the applications of pyramiding gene in Indonesia. Combining conventional breeding with molecular markers and phenotypic selection (drought and submergence) is expected to produce rice lines tolerant to drought and submergence with stabil yields and accelerate the homozygosity of the genome in the third generation. This is an alternative solution to dealing with climate change to support the national food security program.  

scholarly journals Physiological Response of Upland Rice Varieties to Furrow with Organic Matter on Agroforestry System with Kayu Putih (Melaleuca leucadendra L.)

2019 ◽  
Vol 34 (2) ◽  
pp. 223
Author(s):  
Puji Lestari Tarigan ◽  
Tohari Tohari ◽  
Priyono Suryanto
Keyword(s):  
Plant Physiology ◽  
Organic Matter ◽  
Drought Stress ◽  
Upland Rice ◽  
Agroforestry System ◽  
Rice Varieties ◽  
Dry Land ◽  
Organic Matters ◽  
Water Transportation ◽  
Significant Difference

<p>Drought is one of the major limitations in dry land cultivation. Drought affects plant physiology processes such as photosynthesis, respiration, mineral and water transportation, and transpiraton, briefly called drought stress. Drought stress can be avoided by managing environment. Furrow containing organic matter for rain fed rice has been the subject of many studies, with special emphasis on soil moisture. This research is aimed to know the effects of the furrow containing organic matter on physiological responses of several upland rice varieties on agroforestry system based on <em>k</em><em>ayu putih</em> (cajuput). The experimental design applied the strip plot design. The vertical factor is the furrow system of treatment consisting of 2 levels i.e. without furrow + without organic matter and furrow + organic matters. The horizontal factors are the upland rice varieties consisting of 3 varieties i.e. Situ Patenggang, Situ Bagendit and Ciherang. The collected data were analyzed by Analysis of Variance (ANOVA) applying a level of significance α = 5%. Whenever significant differences among treatments were found, further analysis was carried out by applying the Tukey's HSD (Honestly Significant Difference) test α = 5% levels. The result shows that drought affects plant physiology and can be avoided by using furrow containing organic matters. Situ Patenggang with furrow containing organic matters has the higher physiology capability, it had photosynthesis 387.18 µmol CO<sub>2 </sub>per clump s<sup>-1</sup>, transpiration 3038.50 mg per clump per secondand CO<sub>2 </sub>721.11 mol CO<sub>2</sub> clump per mol. There different plant requirements for Cu between varieties.</p>

scholarly journals Morphological Indices of Drought Tolerant of Some Paddy Varieties (Oryza sativa L.) In West Sumatera Using Standard Evaluation System (SES) For Rice

BioScience ◽  
2019 ◽  
Vol 3 (1) ◽  
pp. 60 ◽  
Author(s):  
Syauli Mardita ◽  
Violita Violita
Keyword(s):  
Evaluation System ◽  
Oryza Sativa L ◽  
Morphological Changes ◽  
State University ◽  
Dry Land ◽  
Drought Tolerant ◽  
System Method ◽  
Resistant Varieties ◽  
Morphological Index ◽  
Rice Seeds

Rice is an important food crop that consumed by more than half of the world's population, but almost every year there is decrease rice production in field, this is due availability of land and water as main source of agriculture. Therefore optimization of dry land as agricultural is needed, but many things are of concern to dry land, especially water sources are minimal. Therefore, it is need have rice seeds are suitable and adaptive to dry land, the response of rice plants to drought can observed from physiological, morphological and anatomical changes. This research was conducted in August to December 2018 in research laboratories, wire houses and plant physiology laboratories, Faculty of Mathematics and Natural Sciences, Padang State University. This study was to obtain a drought tolerant morphological index from several paddy seeds in West Sumatera, so indexes showed that rice seeds were tolerant to drought by observing morphological changes, namely leaf rolling (DPD), shoot top index (IKP). ), and plant recorvry (TP) using the SES (Standard Evaluation System) method for rice. Data is processed using cluster analysis with hierarchical analysis methods. The results showed the most resistant varieties to drought stress were’s Baroto, Situ Bagendit, Randah Kuniang, and Harum.

Sign in / Sign up

Export Citation Format

Share Document