FEATURES OF BREEDING VALUE INHERITANCE SIRES OF HOLSTEIN BREED

In our studies, the phenotypic manifestation of the additive form of inheritance of breeding value by milk yield (intermediate and parental dominance) was in 334 (82.2%) bulls, and non-additive form (over-dominance and regression) – in 72 (17.8%) including: over-dominance in 55 (13.5%) and regression in 17 heads (4.2%). In the population assessment, for all forms of inheritance, there was a clear quantitative shift of the breeding value of sons of milk yield to positive (+) values, compared with the breeding value of their parents. This confirms that sons, selected after their evaluation, and recognized as milk yield improvers. The variability of the breeding value of sons by milking depending on the forms of its inheritance has been established. According to the group of bulls by intermediate type of inheritance, milk yield sign were found in 291 (71.7%) sons, whose pedigree value was 606.4 ± 11.6 kg and was higher than the half-sum of both parents (554 kg), which deviates from the action of intermediate inheritance at 52 kg (109%). After all, the recognition of the intermediate nature of inheritance involves obtaining in the offspring of animals with the same set of chromosomes as their parents, and hence with the same phenotype. Therefore, from a theoretical point of view, genetic progress in the population should be not expected from this group of animals. However, in this case, the increase in breeding value was 9%, which is statistically significant (P > 0.99). A rather high variability of the breeding value of sons from its level in their parents with an intermediate form of inheritance has been established. Thus, of the 159 bulls-breeders in which the breeding value was inherited by intermediate form, only 30 sons (7.3% of the total population) of the bull Duster 2147488 (BV +579 kg and mothers with an average BV +632 kg, half the amount of the BV of both parents was +605 kg), was +605.5 ± 30.8 kg and was equal to the half-sum of the BV of both parents, and 9 (2.2%) sons of the bull Manfred 2183007, whose breeding value was, on average, at the population level +856.3 ± 37.6 kg and was equal to the half-sum of the indicator of the parents' BV (+851 kg). The inheritance of breeding value of bulls on quantitative signs of milk productivity in highly consolidated breeds on these signs, at intra-breeding selection occurs by a combination of phenotypic display of action of additive and non-additive (super-dominance) forms of inheritance. The frequency of these forms of inheritance probably is determined by the number and quality of chromosome pairs in the karyotype of animals on the probable basis of their manifestation in the population [15]. The relative variability of breeding value by milk yield along the line "father – son" and "mother – son" depends on the form of its inheritance. The coefficient of phenotypic correlation between the breeding value of parents and sons in the intermediate form of inheritance is +0.524 – +0.560 and increases with parental dominance to +0.907 ± 0.040 and +0.985 ± 0.006, and over-dominance to +0.887 ± 0.044 and +0.905 ± 0.033, at high statistical significant. Inheritance by non-additive form (over-dominance of both parents) is more effectively associated with increasing of breeding value by milk yield their sons than by the additive form.

EFFICIENCY OF THE USE THE CROSSBREEDING OF UKRAINIAN BLACK-AND-WHITE DAIRY AND SWISS CATTLE IN THE STATE STUD FARM "PASICHNA"

Goal. To study the influence of intermediate crossing on the level of dairy productivity, qualitative milk indicators, exterior features and resistance of the body of pureorgain and local animals. Methods. Selection and genetic analysis, comparative, statistical. The results. Scientific and production studies were conducted on the basis of a tribal factory of the State Enterprise "Pasichnya" IKSGP NAAN "of the StarosinyaVsky district of the Khmelnytsky region in the chains of distinct animals of the Podilsky factory type of Ukrainian Black-and-White dairy (UCHRMP) and local animals derived from the crossing of the BPRMP cows with Bojabs of the Shvitsky breed. According to the results of experimental studies, it has been found that local cows-first-bristles are somewhat inferior to the purest animals of the Ukrainian Black-and-White dairy breed by the magnitude of the NADA (93.8 kg), but it is compensated by milk quality (fat +0.26%, protein +0.19%), where in the general yield of dairy fat (+9.5 kg) and protein (+6.4 kg), they are favorably different from its purgatory rior. The analysis of the results of the reproductive capacity of cows shows that local animals were first fruitfully inseminated at the age of 545 days and the duration of fertility was 283 days, at that time, purely meters were inserted at the age of 567 days, and the duration of the sharing was 281.5 days. Service-period in the cows-first-born of genotypes, respectively, amounted to 97 and 112 days. The obtained data for the morphological and functional properties of the cow-first-prints show that the assessed number of both groups meets the needs of target standards on technological features and have high indicators of the studied functional properties. Comparative analysis of exterior valuation indicators between the studied groups shows that local cows have higher rates over latitudinal gates, in particular, by breast width and width in the ice, at that time inferior to the children's rior in the rectors of height in the racing, in the area of the torso. and hammer. In the study of natural resistance in the studied cows it has been established that the estimated animal groups are characterized by a sufficiently high level of protective functions of the body and adaptation capacity to technological conditions, which creates good opportunities for further effective selection. The general assessment of the natural resistance of cows-firstbody by morphological and biochemical parameters of blood, phagocytic, bactericidal and lysozymic activity showed that local cows according to Method VE Chumachenko and others. (1990) have a natural resistance to 3 points (61) higher than in their pure-breeding rior (58 points). Conclusions. Results of analysis of dairy performance of local cows-first-birthsters derived from the crossing of Ukrainian Black-and-White breeds with bulls of the Shvitskaya breed showed that the data of the animal though inferior to the christening rior of the Ukrainian Black-and-White dairy breed by the magnitude of the NADA but this difference is compensated by the quality of milk, where The total output of dairy fat and protein, they are favorably different from pureoral analogues. By indicators of reproducible ability, it has been found that local animals were first crazy at the age of 823 days that on 21 days earlier than puredom and 15 days they have a smaller service period. An analysis of the results of the estimation of morphological and physiological properties of the elder showed that there are no significant differences in the investigated groups of primary differences. All animals correspond to technological requirements. The exterior evaluation of the investigated groups of the firstborn showed that purely cows, having higher rates in the elevation in the roll, in the height in the ice and a contrary length of the trunk and the intensity, but inferior to the latitude gauge: the width of the breast, width in the machaches and width in the machaches and width in the machach. Animal estimation according to natural resistance indicators found that animals of both groups have a sufficiently high level of protective functions of the body and adaptation capacity to technological conditions that creates good opportunities for further effective selection.

PECULIARITIES OF CHEESE MANUFACTURED FROM BROWN CARPATHIAN CATTLE MILK

Investigation of commercialization possibility of highly endangered Brown Carpathian cattle milk was done at 5 cheese samples. Samples were done on different European high-mountainous cheese-making technologies. Certain physical-and-chemical characteristics of the samples were studied and the organoleptic evaluation was done. It was found, that the milk of Brown Carpathian cattle is valuable from the point of view of its commercialization. Making of cheese from the milk of Brown Carpathian cattle on different technologies showed the superiority of French Beaufort technology for the milk of the breed on texture, taste and aroma of prepared cheese.

GROWTH AND DEVELOPMENT OF HEIFERS OF THE CREATED SIMМENTAL MEAT BREED

Introduction. When creating the Simmental beef breed of cattle during many years carried out researches to study the effectiveness of the use of meat Simmentals of foreign selection in crossbreeding with cows of Simmental breed of domestic selection. Were created the herds of the desirable type by breeding "in themselves" animals, that meet the requirements of the target standard, formed a genealogical structure. Now carry out the work with related groups of cattle of the created Simmental meat breed, which are the basis for the creation of further lines, but the growth and development of animals of different related groups have not been sufficiently studied. Therefore, the study problems of growth and development of repair heifers of different related groups has not only theoretical, but also practical importance. The purpose of our researches was to study the dynamics of linear growth and weight development of heifers of different related groups of the created Simmental meat breed. Research materials and methods. The researches was carried out on heifers of different related groups of the created Simmental meat breed in PJSC "Dniprovske" of Boryspil district of Kyiv region. To analyze the growth and development of heifers were formed groups of animals depending on their belongings to related groups of 15 heads in each: I Group – Metz 5290; II – Achilles 369; III – Abricot 58311; IV – Huxla 19223; V – Hercules 8942 and VI – Signal 120. Research results. It was determined, that heifers of the II group, which belong to the related group of Achilles 369, by live weight at all ages of periods surpass to peers. Thus, at 18 months of age the advantage of heifers of the II group by live weight in comparison with to peers of the I, III, IV, V and VI groups was 4.1; 3.0; 5.0; 14.1 and 11.4 kg. In heifers of related groups Hercules 8942 and Signal 120, the coefficients of variability of live weight at birth in which were the lowest, and in the following age periods they little changed, therefore at 18 months of age in these heifers they were the highest, comparison with analogues, and was to 8.4 and 9.2%, respectively. When studying the exterior of heifers of different related groups it was determined, that newborn heifers of the I group, which belong to the related group of Metz 5290, surpass their peers in height indicators. Their the height at the withers and the height at the sacrum were 74.0 and 79.1 cm, which is 0.6; 1.3; 2.1; 3.2 and 2.6 cm and is 0.3; 1.2; 2.9; 3.6 and 3.2 cm more than in analogues of the II, III, IV, V and VI groups, respectively. The best indicators of latitudinal measurements had the heifers of the III group, which belong to the related group Abricot 58311. In heifers of this group the width of the chest was 17.6 cm, width in the hip joints – 21.8 cm, width in the hips – 18.1 cm, and width in the ischial tubercles – 12.6 cm. The depth of the chest and the girth of the chest behind the shoulder blades were the highest in heifers of the I group, which belong to the related group of Metz 5290. They were 32.2 and 79.6 cm, respectively. When analyzing the measurements of heifers at 18 months of age, it was determined, that the height indicators had advantage by heifers of the II group, which belong to the related group of Achilles 369. Their, the height at the withers and height at the sacrum were 124.5 and 129.8 cm, which is 0.3; 1.3; 2.5; 5.3 and 4.2 cm and is 0.9; 2.2; 4.1; 6.6 and 5.9 cm more than in analogues of the I, III, IV, V and VI groups, respectively. The best indicators of latitudinal measurements had the heifers of the III group, which belong to the related group of Abricot 58311, since they had increases of measurements width of the chest, width in the hip joints, width in the hips and width in the ischial tubercles for the period from birth to 18 months of age the highest comparison with peers. Such indicators as depth of the chest and the girth of the chest behind the shoulder blades were highest in heifers of the II group, which belong to the related group of Achilles 369. Their increases of measurements depth of the chest and the girth of the chest behind the shoulder blades for the period from birth to 18 months of age also were highest comparison with peers and were 35.5 and 94.2 cm, respectively. Conclusions. It was determined, that the animals of the related group of Achilles 369 at all ages of periods had a large live weight in comparison with their analogues. The lowest coefficient of variability of live weight at 18 months of age was in heifers of the related group Abrikot 58311 and amounted to 6.5%. Heifers of the related group of Achilles 369 had the highest indicators of the following measurements: height at the withers (124.5 cm), height at the sacrum (129.8 cm), depth of the chest (67.4 cm), girth of chest behind the shoulder blades (173.1 cm) and oblique length of body (146.4 cm). The highest latitudinal measurements were observed in the heifers of the related group Abrikot 58311. Thus, the width of the chest was 49.9 cm, the width in the hip joints was 42.2 cm, the width in the hips was 43.3 cm, and the width in the ischial tubercles was 29.2 cm. Heifers of the related group Metz 5290 had the highest half-girth croup (110.2 cm) and girth of metacarpus (18.4 cm). In general, heifers of all groups showed good energy of growth and a typical for beef cattle exterior.

USE OF DIFFERENTIAL LYSIS FOR DNA ISOLATION TO CONFIRM SPERM TRANSFECTION

The purpose of the work. Despite some progress, the creation of transgenic pigs remains a long and inefficient process. One of the key points in the transfection of porcine generative cells is determining the event of the internalization of foreign DNA by cells. The methods currently used to determine the event of the internalization of foreign DNA by cells do not take into account the possibility of the presence of foreign DNA on the surface of sperm, even after washing from the culture medium. With this in mind, the purpose of this work is to develop a method for confirming the transfection of sperm with plasmid DNA. Materials and methods of research. Sperm were washed four times with GCCS diluent. Sperm transfection was carried out in 0.6 ml polypropylene tubes with a lid in a volume of 50 μl of a suspension of protein-washed sperm in GCCS with a sperm concentration of 100 million/ml. To 50 μl of the suspension of washed sperm from proteins it was added 10 μl of the ring form of plasmid pET-28c (Novagen, France). Sperm were incubated in a thermostat at 37.7°C for two hours. Incubated sperm were stored at -20°C. To isolate DNA, 60 μl of a suspension of washed sperm from proteins with plasmid pET-28c was transferred to 1.5 ml of a polypropylene tube with a lid and centrifuged for 5 min under conditions of 12 thousand vol. min, then 35 μl of supernatant was transferred into a clean 1.5 ml tube leaving at the bottom of approximately 25 μl of liquid with sediment. Isolation of DNA from the supernatant: In a 1.5 ml tube containing 35 μl of supernatant, 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 were added to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing the DNA of plasmid pET-28c was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. Isolation of DNA from the precipitate: To the precipitate it was added 100 μl of TE buffer and 2 μl of Proteinase K (20 mg/ml) and kept for 1.5 h at +56°C. After 5 minutes of centrifugation under conditions of 12 thousand vol. min the supernatant was removed, then to the precipitate was added 100 μl of TE buffer. The procedure of washing with TE buffer was repeated twice. To the purified precipitate it was added 7 μl of dithiothreitol (DTT), 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid-state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing boar sperm DNA was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. The amplification was performed on a programmable thermostat TERTSIK-2 (DNA Technology, Russia). Oligonucleotide primers for the amplification of pET-28c DNA had the following structure: T7 promoter – TAATACGACTCACTATAGGG, T7 terminator – CGCTGAGCAATAACTAGC. This pair of oligonucleotide primers allows to obtain a PCR product with a size of 314 b.p. Tubes with PCR products were stored at -20°C. The specificity of the PCR products was checked by 2% agarose gel electrophoresis in 1 × Tris-borate electrode buffer (TBE) for 2 h at a current of 50 mA in a horizontal electrophoretic chamber (Cleaver Scientific Ltd., UK). DNA of plasmid pUC19 hydrolyzed by Msp I endonuclease was used as a molecular weight marker. After electrophoresis, the gel was stained with ethidium bromide solution (10 mg / cm3), and the results of electrophoresis were photographed using a gel documentation system (Cleaver Scientific Ltd., UK). Research results. The amplification of DNA of plasmid pET-28c, which was isolated using differential lysis, allowed to obtain a PCR product with a size of 314 b.p. The size of the PCR product using oligonucleotide primers (T7promoter/T7terminator) was as expected. Thus, evidence was obtained that plasmid DNA can enter sperm. Conclusions. The time required to isolate DNA using differential lysis depends on the qualifications of the staff and the amount of researches and averages 5–6 hours. This method of DNA isolation does not require the complex equipment and significant costs for reagents, but fertilization of eggs with sperm with a confirmed transfection event will save in the next stages of transfection.

COMPARATIVE ANALYSIS OF THE MORPHOLOGICAL CONDITION OF IN VIVO OBTAINS OF EMBRYOS FROM DONOR COWS OF DIFFERENT BREEDS

The aim of the study was a comparative analysis of the morphological status of embryos of cattle obtained in vivo from purebred and local donor cows of the I and II generations. The object of experimental studies were obtained embryos of cattle in vivo. They were obtained in the experimental farm "Ukrainka" of the Institute of Animal Science of the UAAS of Ukraine from 1985 to 1990. Information about animals and the results of research are stored in the archives of the Private Company "Bioservice". In order to study the stages of development of seven-day-old embryos of cattle, the embryo productivity of 11 purebred and 72 local donor cows was analyzed. Purebred cows were Ayshir (4 heads), Simmental (1 head) and Ukrainian Black-and-White dairy (6 heads) breeds. Crossbreeds of the first generation were donor cows from crossing red steppe and Holstein (2 goals), Simmental and Holstein (12 goals) and Ukrainian Black-and-White dairy and Holstein (9 goals) breeds. The crossbreeds of the second generation were donor cows from crossing red steppe and Holstein (14 goals), Simmental and Montbeliard (22 goals) and Ukrainian Black-and-White dairy and Holstein (13 goals) breeds. According to the results of the conducted research, a statistically significant difference (p < 0.01) between purebred (7.8%) and local donor cows of the I and II generation (0.6 and 1.4%, respectively) was established by the number of embryos. obtained at the stage of expanded blastocyst. There was also a statistically significant difference (p < 0.001) at the stage of late blastocyst between purebred (38.0%) and local donor cows of the I and II generation (7.1 and 9.2%, respectively). The analysis of the obtained research results shows that from purebred donor cows a significantly larger (p < 0.001) total number of blastocysts was obtained by 60.4% compared to local donor cows of the I and II generation (19.6 and 24.2%, respectively). It was found that at the stage of late morula found significantly more embryos 44.7% and 32.9 (p < 0.01), respectively, in donor cows of the second and fourth generation compared to purebred 19.4%. It should be noted that at the stage of early morula, a significantly larger number of embryos (p < 0.001) was obtained from donor cows of the I and II generation (13.6 and 3.2%, respectively) compared to purebred 0.0%. According to the results of the comparative analysis of the total number of obtained morulae, a significantly higher number of embryos (p < 0.001) obtained from donor cows of the I and II generation (48.6 and 50.0%, respectively) was found in comparison with purebred 21.7%. It was found that purebred donor cows received a greater 82.2% of the total number of suitable embryos compared to 68.2% (p < 0.001) of local donor cows of the first and 73.5% (p < 0.05) from local donor cows of the second generations. Further development of extracted morulae in vitro from purebred and local donor cows on the seventh day at a temperature of 37.5°C for 15 hours led to the formation of full-fledged blastocysts at 73.0% (400 of 548). It was found that purebred donor cows received more blastocysts (p < 0.001) compared to local donor cows of the first generation by 40.8% and 36.2% compared to local donor cows of the second generation. It was found that from local donor cows of the second generation received 28.3%, and from local donor cows of the first generation by 26.9% more (p < 0.001) morula compared to purebred donor cows. According to the results of the research, it was found that purebred donor cows received a higher total number of embryos (molula + blastocyst) compared to local donor cows of the first generation by 14.0% (p < 0.001) and 8.7% < 0.05) compared with local donor cows of the second generation.

INFLUENCE OF BOOR GENOTYPE ON HEMATOLOGICAL AND BIOCHEMICAL INDICATORS OF BLOOD IN HYBRID PIGS

Purpose of research: In the process of growth and development of pigs, to study the hematological and biochemical parameters of the blood of young pigs obtained by combining two breed sows with purebred and hybrid boars. Material and research methods. The studies were carried out at the State Agrarian University of Moldova and at the pork production enterprise "SC Agroseminvest SRL". To achieve the goal, the research material was two breed sows large white x Landrace (maternal form) and purebred and hybrid boars: I-pietrain; II-large white x landrace x pietrain; III-(large white x landrace x pietrain) x pietrain; IV-duroc; V-pietrain x duroc, (paternal form). In order to determine the influence of hybrid boars on the growth and development of the offspring, five experimental groups were formed according to the principle of analogs of 6 sows and 30 heads of young animals (15 pigs and 15 castrates). Research results .The data obtained indicate an insignificant increase in the hemoglobin content in group I in comparison with group V animals with a moderate significance of the difference, which was 4 g/l (B ≥ 0.95). Consequently, in groups where meat breeds Pietrain and Duroc were used in various combinations, the hemoglobin content was higher. The best results in terms of the content of erythrocytes were obtained in groups III and V, respectively 7.61 x 1012 и and 7.59 x 1012, and a significant difference was established between groups III and IV (B ≥ 0.99), while in the second group the content of erythrocytes was 0.39 lower than in group III (7.22 x 10¹²). Reliable data on the ALT content were obtained between young pigs of groups I and V (B ≥ 0.95). Some tendencies towards a higher content of AST in the second group have been established. The blood glucose level in hybrid young animals in different combination combinations ranged from 5.68 mmol/l (group I) to 6.19 (group II), and the calcium level from 2.55 mmol/l (group III) to 2.81 mmol/l (group II) with a moderate tendency to increase these indicators in group II. Conclusions: A higher hemoglobin content was found in the I group of animals in comparison with the V group with a moderate significance of the difference, which was 4 g/l (B ≥ 0.95). A significant difference was established between groups III and IV (B ≥ 0.99). A higher content of protein in the blood is found in groups I–II, and is more than 89 g/l. In hybrid young animals, the glucose level in different combination combinations ranged from 5.68 mmol/l (group I) to 6.19 (group II), and the calcium level from 2.55 mmol/l (group III) to 2.81 mmol/l (Group II) with a moderate tendency to an increase in these indicators in group II.

REPRODUCING QUALITIES OF SOWS OF DIFFERENT FAMILIES OF LARGE WHITE AND POLTAVA MEAT BREEDS IN THE TRIBAL HERDS OF PIGS OF KHMELNYCHINA

Goal. To assess the reproductive ability of inspected sows of different families of large white and Poltava meat breeds in breeding herds of Khmelnytsky region on the main selection signs using the evaluation indices of reproductive qualities. Methods. Comparison, zootechnical and biometric analyzes. Results. The reproductive qualities of sows of different families in breeding herds of pigs of large white and Poltava meat breeds of farms of Khmelnytsky region were evaluated. Among the families of large white breed, the best indicators for assessing the reproductive capacity of inspected sows were found in the family of the Sorceress, in which the main feature – fertility by modal class of distribution was 10.8 heads piglets per 1 farrowing, which is 2.8% more than the Taiga family of the same class. According to the modal class M+, the fertility of the Sorceress family (12.0 piglets per farrowing) was 0.3 heads higher than that of the females of this class of the Taiga family (11.7 heads per farrowing). The modal class М¯ of the firstborn family of the Sorceress was the best with a fertility of 9.7 heads, which is 3.2% higher than the Taiga family. Indicators of the number of piglets at weaning at the age of 30 days, the weight of the nest at weaning, the live weight of 1 head of piglets and preservation of offspring (9.5 heads; 94.1 kg; 9.9 kg; 87.9%), by class (М°), the Sorceress family was 3.2 heads bigger; 7.4 kg; 2.0 kg and 0.5% compared to the Taiga family. As a result of ranking sows by evaluation indices of reproductive qualities, I (evaluation index by a limited number of traits) and P (complex evaluation index) had an advantage by the most prolific sows of the Sorceress family of class M+, in which these indices were 43.0 and 96.1 points. In the process of research of reproductive ability of sows of Poltava meat breed of different families it was established that on the basis of fertility the Rosinka family is the best, whose fertility by distribution by class (М°) was 10.7 heads. piglets per 1 farrowing. It exceeds the average value for 5 families: 0.4 heads of Dorza and Vorskla families, 0.6 goals. Bystro's family and 1 goal. the Palm family. According to the modal class M+, the Rosinka family (11.8 piglets per 1 farrowing) has 0.3 heads more fertility than the Dorza and Vorskla families, 0.6 goals higher. and 0.1 heads than the Bistra and Palma families. The lowest fertility of sows in the class (М°) was recorded in the Dorza family (8.9 heads of piglets per farrowing). It should be noted that the Dorza family and the smallest Palma family in the M+ class have the best nest weight at weaning at the age of 45 days (138.7 and 144.2 kg), which is 18.6 more than in the М° class. and 20.7 kg. According to the indicators of the number of piglets at weaning and live weight of 1 head, the Palma's family of class M+ (10.6 heads and 13.6 kg) is distinguished. The best preservation of the offspring in the Palma's family of class M¯ = 94.7%. As a result of ranking sows of different families of Poltava meat breed according to the estimated indices of reproductive qualities, it was noted that the highest number of points in the modal class (М°) was obtained by the family Rosinka I = 40.8 and P = 94.8, which is more than the average for all families by 2.1 and 3.6 points. According to the evaluation indices (I) and (P), the best were sows of the Rosinka family of class M+, in which these indices corresponded to the values of 42.7 and 99.4 points. Conclusions. Among different families, the best results of assessing the reproductive capacity of sows on the main selection traits and evaluation indices were found in the families of the Sorceress of the Great White breed and the family of Rosinka of the Poltava meat breed, which should continue to be used for breeding in breeding herds of pigs. An important factor in increasing the productivity of sows, of course, should be the correct selection of the level of reproductive breeding traits and a significant increase in feeding and housing conditions.

THE GROWTH AND REPRODUCTIVE ABILITY OF HEIFERS AND FIRST-CALF COWS UKRAINIAN RED AND BLACK-SPOTTED DAIRY BREEDS IN THE CONDITIONS OF THE CENTRAL REGION OF UKRAINE

Introduction. The significant and long-term increasing of milk yield is possible only with proper organization of heifer breeding. Therefore, now is important to study the ontogenetic patterns of living mass formation. It is known, that between the growth rate of heifers and their future milk productivity exists correlation. The young age’s animals, which have a high growth energy, in the first lactation give 5000–6000 kg of milk. The force of influence of the live weight the heifers on variability of milk productivity, in depending on the age and lactation, is concluded 8.21–42.87%. The aim of our research was to study the dynamics of live weight, reproductive capacity and the level of their interconnection of heifers and first-born cows of Ukrainian Red and Black-and-White dairy breeds. Materials and methods of research. The research was carried out on first-born, heifers of Ukrainian Red (UR) and Black-and-White dairy breeds (UBS) in SE «SH «Elitne» ISА NAAS». Groups of animals (n = 15) were formed for research by the method of analog pairs. Growth indicators were studied: live weight at 3-, 6-, 9-, 12- and 15-month-old age, at the first insemination. Reproductive ability was studied: age of the first insemination and calving, duration of pregnancy of heifers and first-born, duration of service and intercorporeal periods. Along with the main studied indicators, auxiliary indicators were calculated: reproductive capacity, fertility index and possible yield of calves per 100 cows. The biometric processing of the obtained data was carried out according to the method of N. A. Plokhinsky, using Microsoft Excel software. Research results. The studies of ontogenetic patterns in formation the live weight of repair heifers in controlled herds demonstrated a fairly high level of their cultivation. However, it was found that the growth rate of live weight of heifers in the studied breeds at different ages was different. Thus, at the age of six months, the animals of the Ukrainian Black-and-White dairy breed significantly outnumbered the analogues of the Ukrainian Red dairy breed. The interbreed difference in this period by live weight was 5.0 ± 1.70 kg (P < 0.01). At 9, 12, and 15 months their weight gaining was 15.0 ± 3.42 kg, respectively; 26.0 ± 4.08 kg; and 29.0 ± 6.48 kg, at P < 0.001. In general, during the growing period, the absolute increasing in live weight of UBS heifers by 7.0% exceeded that of UR heifers. At the same time, heifers of the Ukrainian Black-and-White dairy breed were more precocious and had the age of the first insemination, which was 14.5 months at a live weight of 400 kg, while the peers of the Ukrainian Red dairy breed were 15.4 months and 402 kg. Characterizing the coefficient of variation of live weight of heifers, we should note the tendency to decrease with age in both breeds. Thus, the level in the for Ukrainian Red reached 11.6% in three months, for Ukrainian Black-and-White – 15.0%, at the age of 15 months respectively 8.9% and 8.4%. It was established the significant coefficients of recurrence of live weight of heifers during the year with such at 9, 12 and 15 months of age with high degrees of probability. This indicates the possibility of effective early selection. The studies of the reproductive capacity of heifers and first-born demonstrated, that the age of first insemination and calving were significantly lower in heifers of the Ukrainian Black-and-White dairy breed. The difference was 26.0 ± 9.8 days (td = 2.65, at P < 0.05) and 22.0 ± 9.5 days (td = 2.31, at P < 0.05), respectively. However, in terms of duration of pregnancy and service period of first-born cows, Ukrainian Red animals had positively lower values in compare to the analogues of Ukrainian Black-and-White dairy breed, which provided a higher reproductive capacity at the level of (0.90 vs. 0.88) and estimated possibility yield of calves per 100 cows (90.3 vs. 87.7 heads). However, the fertility index for both breeds was at the same level 48.7–48.8. The interconnection of live weight of animals at different ages with the indicators of reproductive capacity was mostly the opposite in direction at an unreliable level in most cases. However, both breeds show a positive interconnection between live weight at 6 months of age and fertility index, between live weight at 1st insemination and age of 1st insemination, and between live weight at 1st insemination and coefficient of reproducibility Conclusions. It was found, that at different ages the heifers of the Ukrainian Black-and-White dairy breed significantly (p < 0.01) outnumbered the analogues of the Ukrainian Red dairy breed, and the coefficient of variation with age on this basis decreased for both breeds. The coefficients of recurrence of live weight of the studied heifers, which are quite significant at high degrees of probability, were revealed, which indicates the possibility of effective early selection. Thus, the live weight of Ukrainian Black-and-White heifers at 9, 12 and 15 months of age can be reliably predicted by its size at the age of three months after birth - heifers of Ukrainian Red dairy breed a little later. There was a positive interconnection between live weight at 6 months age and fertility index, between live weight at the first insemination and age of the first insemination and between live weight at the first insemination and кcoefficient of reproducibility.

ELEMENT OF SELECTION – STATE BOOKS OF BREEDING ANIMALS IN UKRAINE FOR THE PERIOD 2002–2010 YEARS

The issue of registration of breeding animals of different breeds is dealt with by organizations that keep state books of breeding animals. In Ukraine, the functions of keeping state books of breeding animals in cattle breeding, pig breeding, sheep breeding and horse breeding belong to the powers of the minister, which ensures the formation of state policy in the field of animal husbandry. The issue of animal breeding books is relevant because it is an ongoing process that requires a set of measures aimed at registration, maintenance and promotion of domestic breeding livestock. The purpose of research. To monitor the state books of breeding animals (SBBA) in dairy and meat cattle breeding, sheep breeding and pig breeding for the period 2002–2010. Also, establish the number of potential females that could be entered in the stud books. Materials and methods of research. The material for the study was data on the presence of breeding cows of dairy and meat production, sows and ewes of breeds registered in the State Register of Breeding Subjects in Animal Husbandry (until 2009, the State Breeding Register, SBR) during 2002–2019. The results of research. According to the SBR, 15 dairy breeds of cattle have been registered in Ukraine. During the study period, 15 volumes of SBBA of four breeds of dairy cattle were published in Ukraine, which included information on 12331 breeding animals, including 11477 cows. The largest number of recorded breeding animals of the Ukrainian Black-and-White dairy cattle, of which 144 breeding bulls and 4989 cows, are concentrated in six volumes. In second place is the Ukrainian Red-and-White dairy cattle, namely 4554 animals. Then there is the Simmental with 871 animals, of which 809 cows, and the red steppe 1773 heads, including 1609 cows. It is established that 48.7% of breeding animals were born in the period from 1990 to 1999. A small proportion, namely 0.3%, are animals born before 1979, and only 24% after 2000. Younger animals are recorded in the breeding books of Ukrainian Black-and-White dairy cattle and Ukrainian Red-and-White dairy cattle, and older – in the books of the red steppe. Of the 14 meat breeds used in Ukraine, only 5 have breeding animals that are registered with the SBBA. The total number of meat-producing animals recorded in the SBBA is 5586, including 4649 cows. Of the twelve breeds of pigs bred in Ukraine, only seven breeds, namely the Ukrainian white steppe (1451 heads) and Ukrainian spotted steppe (974), Myrhorod breed (123), Great Black (181), Landrace (727), Poltava meat breed (290) and Ukrainian meat breed (300) during the study period were published state pedigree books. Half (50.7%) of all recorded breeding pigs have a year of birth before 2000. Young (born in 2000) animals are recorded in the breeding books of the Landrace breed and the Ukrainian white steppe, Ukrainian meat breed and Poltava meat breed, where their share varies from 64 to 98%. During the study period, 9 volumes of state books of breeding sheep were published. In addition to Tsigai (884 goals), Askanian Karakul (700), fine-wool (1168), meat-wool with crossbred wool (1917) and Sokol (443), in 2003, 2004 and 2009 3 volumes of SBBA sheep of the Prekos breed were published. The calculation of potential females that could be recorded in the state breeding books revealed the presence of 1251102 breeding animals, including 100796 ewes, 70678 sows, 71341 beef cows and 1008287 dairy cows. The largest number of potential females of different breeds in cattle breeding, sheep breeding and pig breeding in the regions of Ukraine showed a certain pattern, namely the centers for dairy cattle breeding – Vinnytsia (83395 heads), Kyiv (111650), Khmelnytsky (64667), Cherkasy (68035) regions, beef cattle breeding – Volyn (13.466 head), Chernihiv (10.907 head), sheep breeding – Kherson (13.837), Odessa (19078) and pig breeding – Dnipropetrovsk (6452), Poltava (4621). The main goal for calculating potential females was to try to determine the size of the breed in dairy and beef cattle, sheep breeding and pigs breeding. Because the more animals included in the breeding model, the better the results of genetic improvement. In addition, it is possible to address the dynamics of the development of breeding traits, identify successful methods of selection and selection, assessment of population and genetic parameters over time and the creation of breeding programs with breeds of farm animals. Conclusion. State books of breeding animals are an important element of selection. Animal information databases help to estimate the populations of domestic and transboundary breeds in general by a set of characteristics, to determine the population-genetic parameters over time and to develop programs for the improvement of farm animals. Studies have identified a significant number (1251102 heads) of breeding cows, ewes and sows, which at one time could be recorded in the breeding books of the respective breeds.