Selective Chelating Resin for Copper Removal and Recovery in Aqueous Acidic Solution Generated from Synthetic Copper-Citrate Complexes from Bioleaching of E-waste

This research focused on batch experiment using a new generation of chelating resins via an ion exchange process to describe the metabolic adsorption and desorption capacity onto iminodiacetic acid/Chelex 100, bis-pyridylmethyl amine/Dowex m4195, and aminomethyl phosphonic/Lewatit TP260 functional groups in bioleaching. The results showed that Dowex m4195 had the highest performance of adsorption capacity for copper removal in both H+-form and Na+-form. Results for Lewatit TP260 and Chelex 100 revealed lower adsorption performance than results for Dowex m4195. The investigation of desorption from chelating resins was carried out, and it was found that 2 M ammonium hydroxide concentration provided the best desorption capacity of about 64.86% for the H+-form Dowex m4195 followed by 52.55% with 2 M sulfuric acid. Lewatit with 2 M hydrochloric acid gave the best desorption performance in Na+-form while Chelex 100 using hydrochloric at 1 M and 2 M provided similar results in terms of the H+-form and Na+-form. As aspects of the selective chelating resins for copper (II) ions in aqueous acidic solution generated from synthetic copper-citrate complexes from bioleaching of e-waste were considered, H+-form Dowex m4195 was a good performer in adsorption using ammonium hydroxide for the desorption. However, chelating resins used were subsequently reused for more than five cycles with an acidic and basic solution. It can be concluded from these results that selective chelating resins could be used as an alternative for the treatment of copper (II) ions contained in e-waste or application to other divalent metals in wastewater for sustainable water and adsorbent reuse as circular economy.

Oxidative potential of mineral dust particles: A focus on chemical components and cell-free assay

<p>Oxidative potential (OP) assays are feasible methods to comprehensively understand how exposure to atmospheric chemical components can influence the formation of reactive oxygen species (ROS) in the human body. The increase of ROS concentration can enhance the oxidation of numerous components, such as of the DNA, proteins, and lipids, which cause mutations and cell damage, leading to respiratory illness. According to available studies, the mechanisms of PM-related health effects are not totally understood. The aim of the present study is to assess which available assays are suitable for evaluating the OP of different Mineral dust (MD) samples and what limitations may apply to either method. Cell-free assays are assessed including methods based on the interaction of ascorbic acid (AA) and dithiothreitol (DTT) with soluble aerosol chemical components.</p> <p>Oxidative potential experiments were carried out on both commercially available standard solutions, ultrapure water (DTT) and buffer solution (AA), as well as on soluble extracts of one-quarter filter samples obtained using both shaking and ultrasound procedures. Most limitations were related to high concentrations of transition metals in the buffer solution composition, which was treated using Chelex 100 sodium resin. Transition metals were strongly correlated to both methods, such as Ti, Cr, V, and Mn for DTT assays, and Fe, and Sr for AA assay. The mineral dust OP values were lower than the OP of particulate matter samples from urban metropolitan centers. Such results could be related to the fewer metal and quinone concentrations in the MD samples in comparison to the urban sample. DTT assay has shown more sensibility to the MD content compared with AA chemical procedure. These assays contribute to building an impact-evaluation model for assessing the variation of MD OP based on its different chemical composition.</p>

N-acetyltransferase 2 (NAT2) and Cytochrome 2C9 (CYP2C9) Genes Polymorphisms in Type 2 Diabetes Mellitus Patients in Yaoundé, Cameroon

Although several environmental factors influence the onset of type 2 Diabetes Mellitus (T2DM), genetic factors contribute to an individual vulnerability to this disease. This study was aimed at studying CYP2C9*3 single nucleotide polymorphism (SNP) and NAT2 gene polymorphisms, and their correlation, if any, in the susceptibility to type 2 diabetes in Yaoundé, Cameroon. This was a case-control study involving 70 participants living in Yaoundé, Cameroon. DNA was extracted by Chelex 100 method. Polymorphisms of NAT2 gene and CYP2C9*3 SNP were assessed using Polymerase Chain Reaction – Restriction Fragment Length Polymorphism (PCR-RFLP). NAT2 gene characterization revealed the predominance of NAT2*5 alleles (35%) and slow metabolizing phenotype (72.9%). CYP2C9 gene characterization revealed the predominance of the wild-type allele (54%) and intermediate metabolizing phenotype (91%). Individuals with the “NAT2 slow metabolizer” phenotype were more likely to have T2DM while those with “intermediate metabolizer” phenotype were less likely to develop this disease (OR = 3.9740, P = 0.0009 and OR = 0.1406, P = 0.0044, respectively). CYP2C9*3 had no discernable predisposition to T2DM (OR= 0.1765, P= 0.1981). This study demonstrates that the NAT2 slow metabolizer phenotype could be associated with the development of T2DM in Yaoundé, Cameroon.

Optimized Protocol for Chelex-based Extraction of DNA from Historical Skeletal Remains and Forensic Trace Samples

PCR-based analysis of skeletonized human remains is a common aspect in both forensic human identification as well as Ancient DNA research. In this, both areas not merely utilize very similar methodology, but also share the same problems regarding quantity and quality of recovered DNA and presence of inhibitory substances in samples from excavated remains. To enable amplification based analysis of the remains, development of optimized DNA extraction procedures is thus a critical factor in both areas.The method paper here presents an optimized protocol for DNA extraction from ancient skeletonized remains using Chelex-100, with improved effectively in yielding amplifiable extracts from sample material excavated after centuries in a soil environment, which consequently have high inhibitor content and overall limited DNA preservation. Further studies showed that the optimized protocol can likewise be utilized for extraction of DNA from common and trace Forensic sample material.

DNA HASIL EKSTRAKSI DARI BERCAK SPERMA PADA KAIN KATUN DAN POLIESTER YANG DISIMPAN HINGGA 40 HARI

DNA adalah alat bukti penting dalam penyidikan berbasis forensik yang berguna dalam proses pemecahan dan penyelesaian kasus kriminal. Pemerkosaan adalah tindak kriminalitas yang dapat meninggalkan barang bukti berupa bercak sperma pada kain. Bercak tersebut dapat diproses agar diperoleh DNA milik pelaku, sehingga identitasnya dapat diungkap. Penelitian ini bertujuan untuk mengetahui apakah DNA dari bercak sperma pada kain berjenis katun dan poliester yang tersimpan selama 0, 20, dan 40 hari dapat diekstraksi, serta untuk mengetahui bagaimana kualitas dan kuantitas DNA yang berhasil diekstraksi dari bercak sperma tersebut. Penelitian dilaksanakan pada bulan September hingga Desember 2020 di Laboratorium Serologi dan Molekuler UPT Forensik dan Laboratorium Biomedik Terpadu Universitas Udayana. Metode penelitian terdiri dari preparasi sampel, ekstraksi DNA menggunakan Chelex 100 resin, dan kuantifikasi serta kualifikasi DNA menggunakan NanoDrop. Perolehan data kuantitas DNA dianalisis dengan metode two-way ANOVA dan chi-squared test. Hasil penelitian menunjukkan bahwa DNA dapat diekstraksi dari bercak sperma pada kain katun dan poliester yang disimpan hingga 40 hari. Kualitas dan kuantitas DNA hasil ekstraksi mengalami penurunan seiring dengan pertambahan periode masa simpan. Penurunan kuantitas DNA pada kain katun terjadi sebesar 80.42% (segar-0 hari), 12.02% (0 hari-20 hari), dan 0.78% (20 hari-40 hari). Penurunan pada kain poliester terjadi sebesar 62.16% (segar-0 hari), 11.40% (0 hari-20 hari), dan 8.47% (20 hari-40 hari). Analisa statistik terhadap kuantitas DNA menunjukkan bahwa laju penurunan konsentrasi DNA dipengaruhi oleh jenis kain yang digunakan.

Comparative studies on the adsorption of various radioactive nuclides from waste aqueous solutions on graphene oxide, inorganic and organic ion exchangers

Adsorption of the radionuclides 141Ce, 140La, 140Ba, 137+134Cs, 131I, 125Sb, 103Ru, 95Nb and 95Zr are studied on graphene oxide from waste aqueous solution samples and their adsorption behaviors are compared to that on the inorganic ion exchanger Ceric tungstate as well as on the strong acidic cation exchanger Dowex-50X8 H+ form, the chelating resin Chelex-100 Na+ form and the strong basic anion exchanger AG-1X8 Cl− form. The waste samples are dilute aqueous solutions resulting from previous work. These solutions contained neither oxidizing nor reducing agents, consequently, it is expected that these radionuclides are existing in their most stable oxidation states, i.e. Ce(III), La(III), Ba(II), Cs(I), Ru(III) & (IV), Sb(III) & (V), Nb(V) and Zr(IV). The adsorption is studied under static conditions for all these radioactive nuclides in the presence of each other. Gamma radiometric analysis is carried out for these radionuclides. Effect of some factors on the adsorption is studied such as pH, graphene oxide particle sizes, contact time, temperature and other parameters. Complete removal of some radionuclides is achieved from these waste solutions by adsorption on graphene oxide. Some separation alternatives for some of these radionuclides are also achieved.

Potensi dan Karakteristik Bakteri Simbion Karang Lunak Sinularia sp. sebagai Anti Bakteri Escherichia coli dari Perairan Pulau Gili Labak Madura Indonesia

Gili Labak merupakan pulau kecil di Kabupaten Sumenep-Madura yang memiliki keanekaragaman karang lunak melimpah salah satunya Sinularia sp.. Beberapa studi literatur menyatakan bahwa Sinularia sp. memiliki berbagai jenis bakteri simbion yang berperan penting dalam siklus hidup karang lunak ini. Bakteri yang bersimbiosis dengan Sinularia sp. memiliki potensi besar sebagai agen anti bakteri khususnya bakteri gram negatif Escherichia coli. Identifikasi isolat bakteri yang bersimbiosis dengan Sinularia sp. ini merupakan alternatif upaya pemanfaatan sumberdaya karang lunak secara konservatif dan keberlanjutan. Penelitian ini bertujuan untuk mengetahui potensi anti bakteri dan mengidentifikasi jenis bakteri simbion dari ekstrak karang lunak Sinularia Sp. yang berasal dari perairan Gili Labak Madura. Metode yang digunakan dalam penelitian ini adalah uji zona hambat bakteri menggunakan overlay dan metode difusi dengan media ZoBell 2216E. Karakteristik molekuler sampel diamati menggunakan metode PCR 16s rDNA dengan ekstraksi DNA menggunakan Chelex 100 dan Primer amplifikasi PCR 27F dan 1492R. Pohon filogenetik dibangun dengan menggunakan aplikasi MEGA 6. Hasil penelitian diketahui dari 4 isolat bakteri (L2.2, L2.3, L2.4, dan L2.5), terdapat 1 isolat yang yang memiliki aktivitas antibakteri Escherichia coli kuat yaitu Isolat L2.5. Isolat L2.5 memiliki diameter zona hambat terbesar yaitu 2.207 ± 0.401 cm. Strain bakteri aktif di Isolat L2.5 adalah Virgibacillus marismortui dengan kemiripan urutan 100%. Hasil penelitian ini menjadi informasi awal yang dapat digunakan sebagai referensi untuk mengoptimalkan potensi pemanfaatan bakteri Virgibacillus marismortui di bidang bioteknologi laut khususnya industri farmasi di masa yang akan datang. Gili Labak is a small island in Madura district which has a diversity of soft coral Sinularia sp. Several literature studies state that Sinularia sp. has various types of symbiotic bacteria that play an important role in the life cycle of this soft coral. This symbiotic bacterium with Sinularia sp. has great potential as an antibacterial agent especially inhibiting of gram-negative bacteria Escherichia coli. Identification of bacterial isolates that are in symbiosis with Sinularia sp. is an alternative to conservative and sustainable use of soft coral resources. This study aims to determine the anti-bacterial potential and identify the type of bacteria from the soft coral extract of Sinularia sp. from the waters of Gili Labak-Madura. The method used in this research is bacterial inhibition zone test using overlay and diffusion methods with ZoBell 2216E media. Molecular characteristics of samples were observed using PCR 16s rDNA method with DNA extraction using Chelex 100 and PCR amplification primers 27F and 1492R. Phylogenetic trees were constructed using MEGA 6 application. The results showed that there were 4 isolates (L2.2, L2.3, L2.4, and L2.5), there was 1 isolate that had strong Escherichia coli antibacterial activity, namely Isolate L2.5. L2.5 isolate has the largest inhibitory zone diameter of 2.207 ± 0.401 cm. The active bacterial strain in the L2.5 isolate was Virgibacillus marismortui with 100% sequence similarity. The results of this study serve as initial information that can be used as a reference to optimize the potential utilization of Virgibacillus marismortui bacteria in marine biotechnology, especially the pharmaceutical industry in the future.

USE OF DIFFERENTIAL LYSIS FOR DNA ISOLATION TO CONFIRM SPERM TRANSFECTION

The purpose of the work. Despite some progress, the creation of transgenic pigs remains a long and inefficient process. One of the key points in the transfection of porcine generative cells is determining the event of the internalization of foreign DNA by cells. The methods currently used to determine the event of the internalization of foreign DNA by cells do not take into account the possibility of the presence of foreign DNA on the surface of sperm, even after washing from the culture medium. With this in mind, the purpose of this work is to develop a method for confirming the transfection of sperm with plasmid DNA. Materials and methods of research. Sperm were washed four times with GCCS diluent. Sperm transfection was carried out in 0.6 ml polypropylene tubes with a lid in a volume of 50 μl of a suspension of protein-washed sperm in GCCS with a sperm concentration of 100 million/ml. To 50 μl of the suspension of washed sperm from proteins it was added 10 μl of the ring form of plasmid pET-28c (Novagen, France). Sperm were incubated in a thermostat at 37.7°C for two hours. Incubated sperm were stored at -20°C. To isolate DNA, 60 μl of a suspension of washed sperm from proteins with plasmid pET-28c was transferred to 1.5 ml of a polypropylene tube with a lid and centrifuged for 5 min under conditions of 12 thousand vol. min, then 35 μl of supernatant was transferred into a clean 1.5 ml tube leaving at the bottom of approximately 25 μl of liquid with sediment. Isolation of DNA from the supernatant: In a 1.5 ml tube containing 35 μl of supernatant, 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 were added to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing the DNA of plasmid pET-28c was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. Isolation of DNA from the precipitate: To the precipitate it was added 100 μl of TE buffer and 2 μl of Proteinase K (20 mg/ml) and kept for 1.5 h at +56°C. After 5 minutes of centrifugation under conditions of 12 thousand vol. min the supernatant was removed, then to the precipitate was added 100 μl of TE buffer. The procedure of washing with TE buffer was repeated twice. To the purified precipitate it was added 7 μl of dithiothreitol (DTT), 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid-state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing boar sperm DNA was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. The amplification was performed on a programmable thermostat TERTSIK-2 (DNA Technology, Russia). Oligonucleotide primers for the amplification of pET-28c DNA had the following structure: T7 promoter – TAATACGACTCACTATAGGG, T7 terminator – CGCTGAGCAATAACTAGC. This pair of oligonucleotide primers allows to obtain a PCR product with a size of 314 b.p. Tubes with PCR products were stored at -20°C. The specificity of the PCR products was checked by 2% agarose gel electrophoresis in 1 × Tris-borate electrode buffer (TBE) for 2 h at a current of 50 mA in a horizontal electrophoretic chamber (Cleaver Scientific Ltd., UK). DNA of plasmid pUC19 hydrolyzed by Msp I endonuclease was used as a molecular weight marker. After electrophoresis, the gel was stained with ethidium bromide solution (10 mg / cm3), and the results of electrophoresis were photographed using a gel documentation system (Cleaver Scientific Ltd., UK). Research results. The amplification of DNA of plasmid pET-28c, which was isolated using differential lysis, allowed to obtain a PCR product with a size of 314 b.p. The size of the PCR product using oligonucleotide primers (T7promoter/T7terminator) was as expected. Thus, evidence was obtained that plasmid DNA can enter sperm. Conclusions. The time required to isolate DNA using differential lysis depends on the qualifications of the staff and the amount of researches and averages 5–6 hours. This method of DNA isolation does not require the complex equipment and significant costs for reagents, but fertilization of eggs with sperm with a confirmed transfection event will save in the next stages of transfection.