An Investigation on the Process of Reimbibition of Oil and Its Impact on Oil Recovery in the Yates Field

Summary In mixed- to oil-wet reservoirs characterized by intense natural fracturing where the dominant displacement mechanism is gravity drainage, surfactant injection can lead to a shift in wettability and incremental oil production. In some cases, oil can also reimbibe back into the rock matrix after the oil saturation has been reduced upon initial exposure to surfactant, suggesting limited permanence in the wettability shift. The reimbibition phenomenon is investigated in this paper using Amott cells. Three cationic surfactants (C12-, C12–16-, C16-based) with interfacial tensions (IFT) between 0.18 and 0.95 mN/m were preselected to be evaluated. Current application of the C12-based surfactant in the Yates field is considered successful based on incremental oil recovery seen during the treatment. Silurian dolomite (SD) rock samples were flooded with Yates crude oil before being aged at 60°C for 6 weeks. For the imbibition tests, the aqueous surfactant solution was set as the external phase within the Amott cell, and the recovery of oil was recorded periodically. After the imbibition tests ended, the rock samples were placed in an inverse Amott cell with the Yates oil as the external phase. Baseline tests were first conducted to show that without a surfactant in the oil or brine, no imbibition occurred. With a surfactant concentration of 3,000 ppm, oil recovery at the end of the imbibition tests varied from 34 to 60% of the original oil volume in the core sample. During the reimbibition test, a large amount of oil was able to reimbibe into the rock, displacing the brine. Most of the displacement occurred within the first 2 weeks. The net oil recovery, taken as the final volume of oil recovered in the imbibition test minus the final volume of oil reimbibed into the rock, ranged from 0 to 18%. Given the possibility of surfactant dilution in field applications, another set of tests was conducted with 1,500 ppm. A reduction in oil recovery during imbibition was observed for all the tested surfactants. Partition coefficients were determined for each of the tested surfactants, and the ion-pair mechanism was used to explain the net oil recovery results. Lastly, the impact of rock permeability on reimbibition was investigated. Results show increasing permeability may lead to a linear response in oil reimbibition; therefore, minimizing the permeability range when selecting rock samples may be necessary when conducting the reimbibition test. The importance of oil reimbibition is demonstrated in the experimental study, and we make an argument for conducting both the imbibition and reimbibition tests to better evaluate surfactant efficacy. The improved understanding of wettability alteration should lead to advancements in chemical enhanced oil recovery (EOR) designs for field treatments.

Tissue Expansion after Non-Skin-Sparing Mastectomy: A Comparative Study of Expansion Courses of Prepectoral and Subpectoral Tissue Expander Placement with Acellular Dermal Matrix

Although skin- or nipple-sparing mastectomy has been popular in the treatment of breast cancer, the radical excision of breast tissue is unavoidable in certain circumstances. However, the ability of an acellular dermal matrix (ADM) to expand remains questionable, and this situation may further hinder tissue expansion. From October 2017 to January 2020, patients who underwent immediate breast reconstruction with tissue expander placement using ADM whose initial fill volume was less than 50 mL were retrospectively reviewed. The primary outcomes were the number of visits and number of days required to complete the expansion, and the secondary outcomes were the amount of postoperative expansions, expander fill ratio and expander volume. Between the prepectoral group (n = 26) and subpectoral group (n = 39), the mean number of days (81.46 days versus 88.64 days, p = 0.365) and mean number of visits (5.08 versus 5.69, p = 0.91) required to complete expansion exhibited no significant differences. Additionally, there were no significant differences in the mean amount of postoperative expansion (314.23 mL versus 315.38 mL, p = 0.950), the mean final volume (353.08 mL versus 339.62 mL, p = 0.481) or the mean final volume ratio (0.89 versus 0.86, p = 0.35) between the two groups. Therefore, we suggest that prepectoral tissue expander placement after conventional mastectomy can be a valid option.

An Investigation on the Process of Re-Imbibition of Oil and its Impact on Oil Recovery in the Yates Field

In mixed- to oil-wet reservoirs characterized by intense natural fracturing where the dominant displacement mechanism is gravity drainage, surfactant injection can lead to a shift in wettability and incremental oil production. In some cases, oil can also re-imbibe back into the rock matrix after the oil saturation has been reduced upon initial exposure to surfactant, suggesting limited permanence in the wettability shift. The re-imbibition phenomenon is investigated in this paper utilizing Amott cells. Three cationic surfactants (C12-, C12-16-, C16-based) solutions with interfacial tensions (IFT) between 0.18 to 0.95 mN/m were pre-selected to be evaluated. Current applications of the C12- based surfactant in the Yates field is considered successful based on incremental oil recovery seen during the treatment. Silurian dolomite rock samples were flooded with Yates crude oil before being aged at 140 °F for 6 weeks. For the imbibition tests, synthetic brine was set as the external phase within the Amott cell and the recovery of oil was recorded periodically. After the imbibition tests ended, the rock samples were placed in an inverse Amott cell with the Yates oil as the external phase. Baseline tests were first conducted to show that without a surfactant in the oil or brine, no imbibition occurred. With a surfactant concentration of 3,000 ppm, oil recovery at the end of the imbibition tests varied from 34% to 64% of the original oil volume in the core sample. During the re-imbibition test, a large amount of oil was able to re-imbibe into the rock, displacing the brine. Most of the displacement occurred within the first two weeks. The net oil recovery, taken as the final volume of oil recovered in the imbibition test minus the final volume of oil re-imbibed into the rock, ranged from 0% to 18%. Given the possibility of surfactant dilution in field applications, another set of tests were conducted with 1,500 ppm. A reduction in oil recovery during imbibition was observed for both the C12- based surfactant and the C12-16- mixture. Partition coefficients were determined for each of the tested surfactants and the ion pair mechanism was used to explain the net oil recovery results. Lastly, the impact of rock permeability on re-imbibition was investigated. Results show increasing permeability may lead to a linear response in oil re-imbibition,therefore minimizing the permeability range when selecting rock samples may be necessary when conducting the re-imbibition test. The importance of oil re-imbibition is demonstrated in the experimental study and we make an argument for conducting both the imbibition and re-imbibition tests to better evaluate surfactant efficacy. The improved understanding of wettability alteration should lead to advancements in chemical enhanced oil recovery designs for field treatments.

Miss Marjoribanks’s Pronouns; or, the General, the Particular, and the Novel

Erik Gray, “Miss Marjoribanks’s Pronouns; or, the General, the Particular, and the Novel” (pp. 223–252) The novel as a genre is always concerned with questions of the general and the particular: it details the particulars of everyday lives as representatives of general truths and characteristics. Margaret Oliphant’s Miss Marjoribanks (1866) not only reflects on this familiar binary but also reveals how easily the distinction between its two terms collapses. The tendency of the heroine, Lucilla Marjoribanks, to refer to all men as “They” illustrates this phenomenon. She uses the pronoun, with no antecedent, to refer either to a particular group of men or to men in general; her doing so both demeans men, by grouping them into an indiscriminate mass, and exalts them, by treating them as so significant as to need no introduction. By the same token, Lucilla’s various suitors are at the same time generalized—they appear as nearly interchangeable functions of the marriage plot—and particularized, since marriage itself involves a form of “particular” (Oliphant’s word) attention. And in the election plot that dominates the final volume of the novel, Lucilla’s chosen candidate, Mr. Ashburton, is singled out precisely for being so typical. Miss Marjoribanks thus demonstrates how the very building blocks of narrative, like those of language, effectively confound the distinction between general and particular. In its elucidation of this tendency of the novel genre, and of art in general, lies the genius and importance of Oliphant’s novel.

Study of Sodium Chloride Production Using Gradual Evaporation of Seawater from Nggolonio Sea, East Nusa Tenggara

Sea water as a raw material resources for the kitchen salt production, besides containing NaCl, has also containing other dissolved salts such as hygroscopic calcium and magnesium salts. The high content of other salts cause industrial NaCl has a low quality. This aim research was to find out the effect of seawater evaporation on NaCl content changes. Seawater obtained from Nggolonto, Nagekeo, NTT, was used with an initial volume of 200 mL, then it was concentrated in varying of final volume, i.e. 20, 23, 25, 27 and 29 mL. The NaCl content was calculated based on total chloride ion content, corrected toward magnesium and calcium ions content and the presence of sulphate anion. In addition, the chloride and magnesium also calcium ions content was analyzed volumetrically, while the sulphate anion was determined spectrophotometrically. The research result showed that NaCl content increase significantly up to 27 mL of final volume and was constantly afterward. Furthermore, the highest of NaCl content obtained from final volume of 29 mL was 96.01%. Nevertheless, comparing to SNI 06-0303-1989, its content was still below the standard of 98.5%.

The Cambridge World History of Slavery

Medieval slavery has received little attention relative to slavery in ancient Greece and Rome and in the early modern Atlantic world. This imbalance in the scholarship has led many to assume that slavery was of minor importance in the Middle Ages. In fact, the practice of slavery continued unabated across the globe throughout the medieval millennium. This volume – the final volume in The Cambridge World History of Slavery – covers the period between the fall of Rome and the rise of the transatlantic plantation complexes by assembling twenty-three original essays, written by scholars acknowledged as leaders in their respective fields. The volume demonstrates the continual and central presence of slavery in societies worldwide between 500 CE and 1420 CE. The essays analyze key concepts in the history of slavery, including gender, trade, empire, state formation and diplomacy, labor, childhood, social status and mobility, cultural attitudes, spectrums of dependency and coercion, and life histories of enslaved people.

Multi-Step Cellular and Tissue Selection of Soybean for Resistance to Osmotic Stress Using Peg 6000 Invitro Conditions

Cell and tissue selection in vitro allows targeted selection of the desired traits under severe selective conditions at the level of individual cells and tissues. On the basis of multistage cell and tissue selection with the use of a selective agent - neutral osmotic polyethylene glycol 6000 in increasing concentrations -5%, 10%, 15%, 20% of the final volume of the nutrient medium, callus of the Zhansaya soybean variety that are stably resistant to osmotic stress have been obtained. Regeneration from callus was noted only in8.3 % of the planted callus 6 soybean regenerants plants resistant to osmotic stress were obtained from callus.

Analysis of volatile compounds and antioxidant activity of Colombian ginger (Zingiber officinale) essential oil obtained by hydrohydraulic distillation assisted by microwave radiation

The (Zingiber officinale) is a plant of the zingiberáceas family, its rhizome is widely used in gastronomy for its pungent aroma and flavor. Essential oils (EO) are natural compounds; they have 25 to 70 components with different concentrations. Α-Zingiberene and α-Felandrene are the main components with volumes between 20% and 70%. For the extraction of the AE samples from 10 Colombian geographical locations were used, obtained by microwave radiated hydrodistillation (MWHD) and stored at 4°C in amber vials. 50 µL of EA and 1.0 µL of (n-tetradecane) internal standard were dissolved in dichloromethane to a final volume of 1.0 mL. The EO components were performed on a triple quadruple mass detector gas chromatograph (BRUKER 450GC-320). For its antioxidant activity (AA) the methodology of Prior for DPPH* and ABTS+ was used. The extractions showed a yield between 0.053 and 0.109 percent; and 300 g of sample at 700 watts and 40 minutes of process were used. The chromatographic profile showed 43 components referring to ketones, alcohols, cyclic ethers, aldehydes and 23 hydrocarbons, with α-Zingiberene being the majority, considered as a molecular marker of this EO. The AA presents significant differences between the samples evaluated for the localities studied.

USE OF DIFFERENTIAL LYSIS FOR DNA ISOLATION TO CONFIRM SPERM TRANSFECTION

The purpose of the work. Despite some progress, the creation of transgenic pigs remains a long and inefficient process. One of the key points in the transfection of porcine generative cells is determining the event of the internalization of foreign DNA by cells. The methods currently used to determine the event of the internalization of foreign DNA by cells do not take into account the possibility of the presence of foreign DNA on the surface of sperm, even after washing from the culture medium. With this in mind, the purpose of this work is to develop a method for confirming the transfection of sperm with plasmid DNA. Materials and methods of research. Sperm were washed four times with GCCS diluent. Sperm transfection was carried out in 0.6 ml polypropylene tubes with a lid in a volume of 50 μl of a suspension of protein-washed sperm in GCCS with a sperm concentration of 100 million/ml. To 50 μl of the suspension of washed sperm from proteins it was added 10 μl of the ring form of plasmid pET-28c (Novagen, France). Sperm were incubated in a thermostat at 37.7°C for two hours. Incubated sperm were stored at -20°C. To isolate DNA, 60 μl of a suspension of washed sperm from proteins with plasmid pET-28c was transferred to 1.5 ml of a polypropylene tube with a lid and centrifuged for 5 min under conditions of 12 thousand vol. min, then 35 μl of supernatant was transferred into a clean 1.5 ml tube leaving at the bottom of approximately 25 μl of liquid with sediment. Isolation of DNA from the supernatant: In a 1.5 ml tube containing 35 μl of supernatant, 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 were added to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing the DNA of plasmid pET-28c was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. Isolation of DNA from the precipitate: To the precipitate it was added 100 μl of TE buffer and 2 μl of Proteinase K (20 mg/ml) and kept for 1.5 h at +56°C. After 5 minutes of centrifugation under conditions of 12 thousand vol. min the supernatant was removed, then to the precipitate was added 100 μl of TE buffer. The procedure of washing with TE buffer was repeated twice. To the purified precipitate it was added 7 μl of dithiothreitol (DTT), 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid-state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing boar sperm DNA was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. The amplification was performed on a programmable thermostat TERTSIK-2 (DNA Technology, Russia). Oligonucleotide primers for the amplification of pET-28c DNA had the following structure: T7 promoter – TAATACGACTCACTATAGGG, T7 terminator – CGCTGAGCAATAACTAGC. This pair of oligonucleotide primers allows to obtain a PCR product with a size of 314 b.p. Tubes with PCR products were stored at -20°C. The specificity of the PCR products was checked by 2% agarose gel electrophoresis in 1 × Tris-borate electrode buffer (TBE) for 2 h at a current of 50 mA in a horizontal electrophoretic chamber (Cleaver Scientific Ltd., UK). DNA of plasmid pUC19 hydrolyzed by Msp I endonuclease was used as a molecular weight marker. After electrophoresis, the gel was stained with ethidium bromide solution (10 mg / cm3), and the results of electrophoresis were photographed using a gel documentation system (Cleaver Scientific Ltd., UK). Research results. The amplification of DNA of plasmid pET-28c, which was isolated using differential lysis, allowed to obtain a PCR product with a size of 314 b.p. The size of the PCR product using oligonucleotide primers (T7promoter/T7terminator) was as expected. Thus, evidence was obtained that plasmid DNA can enter sperm. Conclusions. The time required to isolate DNA using differential lysis depends on the qualifications of the staff and the amount of researches and averages 5–6 hours. This method of DNA isolation does not require the complex equipment and significant costs for reagents, but fertilization of eggs with sperm with a confirmed transfection event will save in the next stages of transfection.

Parfit’s Final Arguments in Normative Ethics

This paper starts by juxtaposing the normative ethics in the final part of Parfit’s final book, On What Matters, volume iii (2017), with the normative ethics in his earlier books, Reasons and Persons (1984) and On What Matters, volume i (2011). The paper then addresses three questions. The first is, where does the reflective-equilibrium methodology that Parfit endorsed in the first volume of On What Matters lead? The second is, is the Act-involving Act Consequentialism that Parfit considers in the final volume of On What Matters as plausible as Rossian deontology? The third is, how is the new argument that Parfit puts forward for Rule Consequentialism supposed to work?