Gray mold of yacon and sunflower caused by Botrytis cinerea

2011 ◽  
Vol 77 (3) ◽  
pp. 217-219 ◽  
Author(s):  
Keisuke Tomioka ◽  
Toyozo Sato
Keyword(s):  
2021 ◽  
Vol 22 (4) ◽  
pp. 1694
Author(s):  
Jiao Sun ◽  
Chen-Hao Sun ◽  
Hao-Wu Chang ◽  
Song Yang ◽  
Yue Liu ◽  
...  

Cyclophilin (Cyp) and Ca2+/calcineurin proteins are cellular components related to fungal morphogenesis and virulence; however, their roles in mediating the pathogenesis of Botrytis cinerea, the causative agent of gray mold on over 1000 plant species, remain largely unexplored. Here, we show that disruption of cyclophilin gene BcCYP2 did not impair the pathogen mycelial growth, osmotic and oxidative stress adaptation as well as cell wall integrity, but delayed conidial germination and germling development, altered conidial and sclerotial morphology, reduced infection cushion (IC) formation, sclerotial production and virulence. Exogenous cyclic adenosine monophosphate (cAMP) rescued the deficiency of IC formation of the ∆Bccyp2 mutants, and exogenous cyclosporine A (CsA), an inhibitor targeting cyclophilins, altered hyphal morphology and prevented host-cell penetration in the BcCYP2 harboring strains. Moreover, calcineurin-dependent (CND) genes are differentially expressed in strains losing BcCYP2 in the presence of CsA, suggesting that BcCyp2 functions in the upstream of cAMP- and Ca2+/calcineurin-dependent signaling pathways. Interestingly, during IC formation, expression of BcCYP2 is downregulated in a mutant losing BcJAR1, a gene encoding histone 3 lysine 4 (H3K4) demethylase that regulates fungal development and pathogenesis, in B. cinerea, implying that BcCyp2 functions under the control of BcJar1. Collectively, our findings provide new insights into cyclophilins mediating the pathogenesis of B. cinerea and potential targets for drug intervention for fungal diseases.


2017 ◽  
Vol 107 (3) ◽  
pp. 362-368 ◽  
Author(s):  
Wayne M. Jurick ◽  
Otilia Macarisin ◽  
Verneta L. Gaskins ◽  
Eunhee Park ◽  
Jiujiang Yu ◽  
...  

Botrytis cinerea causes gray mold and is an economically important postharvest pathogen of fruit, vegetables, and ornamentals. Fludioxonil-sensitive B. cinerea isolates were collected in 2011 and 2013 from commercial storage in Pennsylvania. Eight isolates had values for effective concentrations for inhibiting 50% of mycelial growth of 0.0004 to 0.0038 μg/ml for fludioxonil and were dual resistant to pyrimethanil and thiabendazole. Resistance was generated in vitro, following exposure to a sublethal dose of fludioxonil, in seven of eight dual-resistant B. cinerea isolates. Three vigorously growing B. cinerea isolates with multiresistance to postharvest fungicides were further characterized and found to be osmosensitive and retained resistance in the absence of selection pressure. A representative multiresistant B. cinerea strain caused decay on apple fruit treated with postharvest fungicides, which confirmed the in vitro results. The R632I mutation in the Mrr1 gene, associated with fludioxonil resistance in B. cinerea, was not detected in multipostharvest fungicide-resistant B. cinerea isolates, suggesting that the fungus may be using additional mechanisms to mediate resistance. Results from this study show for the first time that B. cinerea with dual resistance to pyrimethanil and thiabendazole can also rapidly develop resistance to fludioxonil, which may pose control challenges in the packinghouse environment and during long-term storage.


2021 ◽  
Author(s):  
Shuen-Huang Tsai ◽  
Yu-Ting Chen ◽  
Yu-Liang Yang ◽  
Bo-Yi Lee ◽  
Chien-Jui Huang ◽  
...  

Paenibacillus polymyxa is a beneficial bacterium for plant health. Paenibacillus polymyxa TP3 exhibits antagonistic activity toward Botrytis cinerea and alleviates gray mold symptoms on the leaves of strawberry plants. Moreover, suppression of gray mold on the flowers and fruits of strawberry plants in field trials, including vegetative cells and endospores, was demonstrated, indicating the potential of strain TP3 as a biological control agent. To examine the anti-B. cinerea compounds produced by P. polymyxa TP3, matrix‐assisted laser‐desorption/ionization time‐of‐flight mass spectrometry was performed and fusaricidin-corresponding mass spectra were detected. Moreover, fusaricidin-related signals appeared in imaging mass spectrometry of TP3 when confronted with B. cinerea. By using liquid chromatography-mass spectrometry-based molecular networking approach, several fusaricidins were identified including a new variant of m/z 917.5455 with serine in the first position of the hexapeptide. Via advanced mass spectrometry and network analysis, fusaricidin-type compounds produced by P. polymyxa TP3 were efficiently disclosed and were presumed to play roles in the antagonism against gray mold pathogen B. cinerea.


FLORESTA ◽  
2013 ◽  
Vol 43 (2) ◽  
pp. 225
Author(s):  
Miriam Machado Cunico ◽  
Celso Garcia Auer ◽  
Marlon Wesley Machado Cunico ◽  
Obdulio Gomes Miguel ◽  
Patricio Peralta Zamora ◽  
...  

 Extratos etanólicos de anestesia, Ottonia martiana Miq., foram reavaliados quanto à inibição do crescimento micelial dos fungos Cylindrocladium spathulatum (pinta-preta da erva-mate) e Botrytis cinerea (mofo-cinzento do eucalipto), por meio do planejamento fatorial. A ocorrência de decomposição de bioativos no processo de autoclavagem também foi investigada, por meio de teste de eficiência de extratos filtrados (filtro Millipore) e esterilizados (autoclave) no controle dos fitopatógenos, nas concentrações de 1, 10, 100 e 1000 ppm. Os extratos etanólicos filtrado e esterilizado inibiram o crescimento micelial dos fungos e foram mais ativos frente a B. cinerea.O extrato filtrado exibiu maior potencial antifúngico que o extrato esterilizado. O processo de esterilização por autoclavagem causou pequena decomposição dos bioativos presentes no extrato de anestesia.Palavras-chave: Anestesia; mofo-cinzento; pinta-preta. Abstract Fungitoxic potential of ethanolic extracts of anestesia in the control of phytopathogenic diseases. The antifungal potential of anestesia, Ottonia martiana Miq. was reassessed by factorial design, in vitro testing of fungal mycelial growth compared to the pathogenic isolates Cylindrocladium spathulatum, causal agent of black spot onyerba mate, and Botrytis cinerea causal agent of gray-mold on eucalypts. Occurrence of decomposition of bioactive of the autoclaving process was investigated using foliar detached test compared to the pathogens (1000 ppm). Ethanolic extracts - EBEtOH (filtered and autoclaved) inhibited the mycelial growth of C. spathulatum and B. cinerea (1000 ppm) and were more pronounced against B. cinerea (43.6 % and 68.9 %). EBEtOH filtered (0.22 µm) presented higher activity than EBEtOH autoclaved (C. spathulatum: 52.8 % and 43.6 %, B. cinerea: 68.9 % and 43.6 %), suggesting little decomposition ofbioactive after autoclaving. EBEtOH filtrate presented potential inhibition of 28 % in eucalypt leaves against B. cinerea.  Keywords: Ottonia martiana; black spot; gray-mold.


Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.


2018 ◽  
Vol 36 (2) ◽  
pp. 45-57
Author(s):  
Ben A. Bergmann ◽  
John M. Dole

Abstract We assessed the degree to which 16 post-infection treatments controlled Botrytis (Botrytis cinerea Pers. ex. Fr.) damage in cut roses (Rosa × hybrida). Additional experiments examined whether essential oils (EO) of cinnamon (Cinnamomum zeylanicum Blume) leaf (CLO), clove (Eugenia caryophyllata Thunb.) bud (CBO), and thyme (Thymus vulgaris L.) (TO) could reduce damage in Botrytis-infected cut roses. The 16 treatments applied to ‘Light Orlando' cut roses differed in reducing Botrytis damage and causing phytotoxicity damage. Only the synthetic fungicide fludioxonil [applied as 0.23 g · L−1 (0.00024 oz · fl oz−1) Medallion®] resulted in the desirable combination of greatly reduced stem termination frequency due to Botrytis damage and relatively minor flower phytotoxicity. When applied to cut rose ‘Freedom' or cultivars with light colored flowers (‘Cool Water', ‘Jessika', ‘Polar Star', ‘Tiffany'), all EO aqueous solutions caused pronounced phytotoxicity damage, but only TO reduced Botrytis damage significantly compared to untreated flowers. Roses exposed to EO vapor rather than an aqueous solution tended to exhibit less phytotoxicity. Vapors of CLO and CBO tended to reduce Botrytis damage less and caused greater flower phytotoxicity than TO vapor and aqueous fludioxonil. Thyme oil vapor exposures of 4.6 and 9.1 ppm warrant further investigation. Index words: Botrytis blight, Botrytis cinerea Pers. ex. Fr., cut flowers, floriculture, fungicide, gray mold, Rosa × hybrida. Chemicals used in this study: Bacillus subtilis (Cease®), bleach (Clorox®), chlorothalonil (Daconil®), copper sulphate (Phyton® 27), fenhexamide (Elevate®), fludioxonil (Medallion®), hydrogen peroxide (ZeroTol® 2.0), iprodione (Chipco® 26019 Flo), potassium bicarbonate (Milstop®), pyraclostrobin + boscalid (Pageant® Intrinsic®). Species used in this study: Rose (Rosa × hybrida) ‘Cool Water', ‘Freedom', ‘Jessika', ‘Polar Star', ‘Tiffany', Botrytis (Botrytis cinerea Pers. ex. Fr.).


2018 ◽  
Vol 7 (3) ◽  
pp. 131-131
Author(s):  
Raees Ahmed ◽  
Amjad S. Gondal ◽  
Muhammad Tariq Khan ◽  
Shazia Shahzaman ◽  
Sajjad Hyder

Gray mold caused by Botrytis cinerea is an important disease that attacks fruits, leaves and twigs of peach. Peach is grown on an area of 18,008 ha with an average production of 72,085 tons per year in Pakistan (FAO, 2017). During May 2017, brown spots on 33% of the peach fruits examined were observed in Swat district of KPK province of Pakistan. Infected fruits were incubated at 25±2 °C in a humid chamber resulted in greyish mycelial growth with light brown lesions. Hyphal growths on infected fruits were cultured on PDA media and purified by hyphal tip method. Morphologically whitish grey growth was observed on PDA and later on dark sclerotia were observed after 6-7 days of incubation. Hyphae were found septate with branched hyaline conidiophores having a bunch of ovoid conidia at their tips. Further confirmations were done by amplifying internal transcribed spacer regions (Andrew et al., 2009) and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) region of the isolates (Li et al., 2012). Amplicons sequenced from Macrogen Korea were blasted and submitted in NCBI showed that ITS sequences (Accessions MH049690 and MH049691) were 99% identical with already reported (MG878388 and MG654661) sequences and the G3PDH gene sequences (Accessions MH560352 and MH560353) were 99 % identical with already reported (Accessions MG204876) sequences of B. cinerea. Pathogenicity was confirmed on healthy peach fruits disinfected with 50% ethanol, inoculated by placing a plug of about 1cm2 taken from the edge of actively growing B. cinerea isolate (BTS-16). Fruits were incubated at 25±2 °C in a humid chamber (Abata et al., 2016). A set of healthy fruits mock-inoculated with a plug of agar medium were used as control. Three days after inoculation, inoculated fruits showed sunken lesions with cottony greyish mycelial growth on their surface. Fungus isolated from these infections was re-confirmed as B. cinerea. Conducive environment for the disease progression in nearby areas can result into a huge loss in peach produce so there is a need to devise management strategies to cope with the pathogen. This is the first report of gray mold disease of peach caused by B. cinerea from Pakistan. 


2021 ◽  
Author(s):  
Lincoln A. Harper ◽  
Scott Paton ◽  
Barbara Hall ◽  
Suzanne McKay ◽  
Richard P. Oliver ◽  
...  

AbstractGray mold, caused by Botrytis cinerea, is an economically important disease of grapes in Australia and across grape growing regions worldwide. Control of this disease relies heavily on canopy management and the application of single site fungicides. Fungicide application can lead to the selection of fungicide resistant B. cinerea populations, which has an adverse effect on the chemical control of the disease. Characterising the distribution and severity of resistant B. cinerea populations is needed to inform resistance management strategies. In this study, 725 isolates were sampled from 75 Australian vineyards during 2013 – 2016 and were screened against seven fungicides with different MOAs. The resistance frequencies for azoxystrobin, boscalid, fenhexamid, fludioxonil, iprodione, pyrimethanil and tebuconazole were 5, 2.8, 2.1, 6.2, 11.6, 7.7 and 2.9% respectively. Nearly half of the resistant isolates (43.7%) were resistant to more than one of the fungicides tested. The frequency of vineyards with at least one isolate simultaneously resistant to 1, 2, 3, 4 or 5 fungicides was 19.5, 7.8, 6.5, 10.4 and 2.6%.Resistance was associated with previously published genotypes in CytB (G143A), SdhB (H272R/Y), Erg27 (F412S), Mrr1 (D354Y), Os1 (I365S, N373S + Q369P, I365S + D757N) and Pos5 (P319A, L412F). Expression analysis was used to characterise fludioxonil resistant isolates exhibiting overexpression (6.3 - 9.6-fold) of the ABC transporter encoded by AtrB (MDR1 phenotype). Novel genotypes were also described in Mrr1 (S611N, D616G) and Cyp51 (P357S). Resistance frequencies were lower when compared to most previously published surveys of both grape and non-grape B. cinerea resistance. Nonetheless, continued monitoring of critical chemical groups used in Australian vineyards is recommended.


Sign in / Sign up

Export Citation Format

Share Document