scholarly journals Determination of transgene stability in Nannochloropsis sp. transformed with immunogenic peptide for oral vaccination against vibriosis

2021 ◽  
Author(s):  
Aisamuddin Ardi Zainal Abidin ◽  
Nur Adila Othman ◽  
Fatimah Md. Yusoff ◽  
Zetty Norhana Balia Yusof
Keyword(s):  
Pcr Amplification ◽  
Aquatic Organisms ◽  
Fourth Generation ◽  
Antibiotics Resistance ◽  
Fish Feed ◽  
Gene Fragment ◽  
Dna And Rna ◽  
Transgenic Lines ◽  
Vaccine Carrier ◽  
The Stability

AbstractVibriosis is one of the common diseases caused by gram-negative bacteria from the genus Vibrio. To treat vibriosis, vaccination has been proven to be the most effective treatment as it can avoid the risk of drugs or antibiotics resistance. Microalgae are commonly used as feed for aquatic organisms and Nannochloropsis sp. is one of the highly utilized species for fish feed. This study focused on the use of microalga, Nannochloropsis sp. as a vaccine carrier. Transgenic Nannochloropsis sp. harbouring an outer membrane protein kinase (OmpK) gene fragment of the Vibrio species namely V1, V2, CV1, CV2, CPV1 and CPV2 were utilized in this study. The stability of OmpK gene in transgenic Nannochloropsis sp. over a number of generations was evaluated. DNA and RNA from the Nannochloropsis sp. transgenic lines were extracted and subjected to PCR amplification of OmpK gene fragment. The OmpK gene fragment was successfully amplified and expressed up to the fifth generation (F5). For V1, V2, CV1 and CV2, the gene was present and expressed in fourth generation (F4) and F5 respectively but CPV1 and CPV2 the OmpK genes were present up to F4. From the results obtained, Nannochloropsis sp. is shown to be suitable as a vaccine carrier and can be utilized as a vaccine carrier to ameliorate vibriosis.

scholarly journals G-quadruplexes: a promising target for cancer therapy

2021 ◽  
Vol 20 (1) ◽  
Author(s):  
Nils Kosiol ◽  
Stefan Juranek ◽  
Peter Brossart ◽  
Annkristin Heine ◽  
Katrin Paeschke
Keyword(s):  
Breast Cancer ◽  
Structure Formation ◽  
Genome Instability ◽  
Treatment Options ◽  
Personalized Treatment ◽  
Cancer Development ◽  
Intratumor Heterogeneity ◽  
Dna And Rna ◽  
New Strategy ◽  
The Stability

AbstractDNA and RNA can fold into a variety of alternative conformations. In recent years, a particular nucleic acid structure was discussed to play a role in malignant transformation and cancer development. This structure is called a G-quadruplex (G4). G4 structure formation can drive genome instability by creating mutations, deletions and stimulating recombination events. The importance of G4 structures in the characterization of malignant cells was currently demonstrated in breast cancer samples. In this analysis a correlation between G4 structure formation and an increased intratumor heterogeneity was identified. This suggests that G4 structures might allow breast cancer stratification and supports the identification of new personalized treatment options. Because of the stability of G4 structures and their presence within most human oncogenic promoters and at telomeres, G4 structures are currently tested as a therapeutic target to downregulate transcription or to block telomere elongation in cancer cells. To date, different chemical molecules (G4 ligands) have been developed that aim to target G4 structures. In this review we discuss and compare G4 function and relevance for therapeutic approaches and their impact on cancer development for three cancer entities, which differ significantly in their amount and type of mutations: pancreatic cancer, leukemia and malignant melanoma. G4 structures might present a promising new strategy to individually target tumor cells and could support personalized treatment approaches in the future.

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

Jurnal BIOMA ◽  
2017 ◽  
Vol 13 (1) ◽  
pp. 33-36
Author(s):  
Rini Puspitaningrum ◽  
Ria Amelia ◽  
Adisyahputra Adisyahputra
Keyword(s):  
Molecular Markers ◽  
Glycine Max ◽  
Molecular Marker ◽  
Pcr Amplification ◽  
Housekeeping Gene ◽  
Descriptive Study ◽  
Gene Fragment ◽  
Lectin Gene ◽  
Glycine Max L

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.

scholarly journals Stability of an RNA•DNA–DNA triple helix depends on base triplet composition and length of the RNA third strand

2019 ◽  
Vol 47 (14) ◽  
pp. 7213-7222 ◽  
Author(s):  
Charlotte N Kunkler ◽  
Jacob P Hulewicz ◽  
Sarah C Hickman ◽  
Matthew C Wang ◽  
Phillip J McCown ◽  
...  
Keyword(s):  
Relative Stability ◽  
Triple Helix ◽  
Multiple Factors ◽  
Dna And Rna ◽  
Helix Formation ◽  
Canonical Base ◽  
Triple Helix Formation ◽  
Triple Helices ◽  
Dna Triple Helix ◽  
The Stability

AbstractRecent studies suggest noncoding RNAs interact with genomic DNA, forming an RNA•DNA–DNA triple helix that regulates gene expression. However, base triplet composition of pyrimidine motif RNA•DNA–DNA triple helices is not well understood beyond the canonical U•A–T and C•G–C base triplets. Using native gel-shift assays, the relative stability of 16 different base triplets at a single position, Z•X–Y (where Z = C, U, A, G and X–Y = A–T, G–C, T–A, C–G), in an RNA•DNA–DNA triple helix was determined. The canonical U•A–T and C•G–C base triplets were the most stable, while three non-canonical base triplets completely disrupted triple-helix formation. We further show that our RNA•DNA–DNA triple helix can tolerate up to two consecutive non-canonical A•G–C base triplets. Additionally, the RNA third strand must be at least 19 nucleotides to form an RNA•DNA–DNA triple helix but increasing the length to 27 nucleotides does not increase stability. The relative stability of 16 different base triplets in DNA•DNA–DNA and RNA•RNA–RNA triple helices was distinctly different from those in RNA•DNA–DNA triple helices, showing that base triplet stability depends on strand composition being DNA and/or RNA. Multiple factors influence the stability of triple helices, emphasizing the importance of experimentally validating formation of computationally predicted triple helices.

Simultaneous determination of α-tocopheryl acetate and tocopherols in aquatic organisms and fish feed

1999 ◽  
Vol 724 (2) ◽  
pp. 249-255 ◽  
Author(s):  
Ji Zeng Huo ◽  
Hans J. Nelis ◽  
Patrick Lavens ◽  
Patrick Sorgeloos ◽  
André P. De Leenheer
Keyword(s):  
Simultaneous Determination ◽  
Aquatic Organisms ◽  
Tocopheryl Acetate ◽  
Fish Feed

scholarly journals Viperin catalyzes methionine oxidation to promote protein expression and function of helicases

2019 ◽  
Vol 5 (8) ◽  
pp. eaax1031 ◽  
Author(s):  
Lei Bai ◽  
Jiazhen Dong ◽  
Zhenqiu Liu ◽  
Youliang Rao ◽  
Pinghui Feng ◽  
...  
Keyword(s):  
Posttranslational Modifications ◽  
Methionine Oxidation ◽  
Biological Processes ◽  
Loss Of Function ◽  
Rna Helicases ◽  
Dna And Rna ◽  
Biochemical Studies ◽  
The Stability ◽  
And Function

Helicases play pivotal roles in fundamental biological processes, and posttranslational modifications regulate the localization, function, and stability of helicases. Here, we report that methionine oxidation of representative helicases, including DNA and RNA helicases of viral (ORF44 of KSHV) and cellular (MCM7 and RIG-I) origin, promotes their expression and functions. Cellular viperin, a major antiviral interferon-stimulated gene whose functions beyond host defense remain largely unknown, catalyzes the methionine oxidation of these helicases. Moreover, biochemical studies entailing loss-of-function mutations of helicases and a pharmacological inhibitor interfering with lipid metabolism and, hence, decreasing viperin activity indicate that methionine oxidation potently increases the stability and enzyme activity of these helicases that are critical for DNA replication and immune activation. Our work uncovers a pivotal role of viperin in catalyzing the methionine oxidation of helicases that are implicated in diverse fundamental biological processes.

scholarly journals Application of Optical Trapping for Cells Grown on Plates: Optimization of PCR and Fidelity of DNA Sequencing of p53 Gene from a Single Cell

2003 ◽  
Vol 49 (3) ◽  
pp. 415-424 ◽  
Author(s):  
James M Gale ◽  
Christopher P Romero ◽  
Gregory B Tafoya ◽  
Jérôme Conia
Keyword(s):  
Dna Sequencing ◽  
Single Cell ◽  
Optical Trapping ◽  
Pcr Amplification ◽  
P53 Gene ◽  
Rrna Gene ◽  
Dna And Rna ◽  
A Cell ◽  
Nonadherent Cells ◽  
Positive Results

Abstract Background: Optical trapping has traditionally been used to visually select and isolate nonadherent cells grown in suspension because cells grown in monolayers will rapidly reattach to surfaces if suspended in solution. We explored methods to slow cell reattachment that are also compatible with high-fidelity PCR. Methods: Using HeLa cells grown on plates and suspended after trypsinization, we measured the efficiency of capture by retention and movement of the cell by the laser. Success for removing a captured cell by pipette was determined by PCR amplification of the 5S rRNA gene. After optimizing PCR amplification of a 2049-bp region of the p53 gene, we determined PCR fidelity by DNA sequencing. Results: Addition of bovine serum albumin to suspended cells slowed reattachment from seconds to minutes and allowed efficient trapping. The success rate of removing a cell from the trap by pipette to a PCR tube was 91.5%. The 5S PCR assay also revealed that DNA and RNA that copurify with polymerases could give false-positive results. Sequence analysis of four clones derived from a single cell showed only three polymerase errors in 7200 bp of sequence read and revealed difficulties in reading the correct number in a run of 16 A:T. Comparison of the HeLa and wild-type human sequences revealed several previously unreported base differences and an (A:T)n length polymorphism in p53 introns. Conclusions: These results represent the first use of optical trapping on adherent cells and demonstrate the high accuracy of DNA sequencing that can be achieved from a single cell.

IDENTIFICATION AND CHARACTERIZATION OF PIGMENTED BACTERIA ISOLATED FROM MALAYSIAN SEAWATER

2019 ◽  
Vol 7 (4) ◽  
pp. 01-08
Author(s):  
Nur Afifah Mursyida Zaujan ◽  
Mohamad Zohdi Othman ◽  
Fatin Najihah Mohd Lutfi ◽  
Kamarul Rahim Kamarudin ◽  
Hanina Mohd Noor ◽  
...  
Keyword(s):  
Human Health ◽  
Pcr Amplification ◽  
Fluorescent Light ◽  
Rrna Gene ◽  
Yellow Orange ◽  
Exiguobacterium Profundum ◽  
The Stability ◽  
Antimicrobial Metabolites ◽  
Pigmented Bacteria

Purpose of study: Bacteria can naturally produce pigments that can be useful for various applications as they possess antimicrobial metabolites among other numerous benefits towards the human health. This study was carried out to identify the species of marine bacterial isolates PMA, PM3C1 and PM5C1 exhibiting yellow, orange and green colors respectively. Methodology: The current study is using Polymerase Chain Reaction (PCR) amplification and sequence analysis of their 16S rRNA gene. The stability of pigments extracted from the bacterial samples was also analyzed against different temperature and light conditions. Main Findings: Sequence alignment using BLAST revealed that the yellow, orange, and green-pigmented bacteria have 84% similarity with Staphylococcus aureus, 85% similarity with Exiguobacterium profundum and 95% similarity with Pseudomonas aeruginosa respectively. The green pigment showed major changes in color following exposure to sunlight and fluorescent light, and when incubated at 24°C and 50°C. Exposure to direct sunlight also results in the reduction of color for the yellow and orange extracts, while no effect was observed for both pigments under fluorescent light. Incubation at 50°C results in the reduction of the orange color, while the yellow pigment was observed to be unaffected suggesting its stability at high temperature. Implications: Natural pigments production can provide many advantages including reduction of pollution generation, ease of disposal and other benefits to the human health.

Synthesis, physico-chemical and biological properties of DNA and RNA oligonucleotides containing short alkylamino internucleotide bond

2011 ◽  
Vol 76 (12) ◽  
pp. 1471-1486
Author(s):  
Milena Sobczak ◽  
Katarzyna Kubiak ◽  
Magdalena Janicka ◽  
Malgorzata Sierant ◽  
Barbara Mikolajczyk ◽  
...  
Keyword(s):  
Biological Properties ◽  
Protecting Group ◽  
Dna And Rna ◽  
Double Stranded Dna ◽  
Physico Chemical ◽  
Rna Oligomers ◽  
Phosphate Linkage ◽  
Sirna Molecule ◽  
Fetal Bovine ◽  
The Stability

The condensation of the 5′-O-DMT-3′-deoxy-3′-aminothymidine with 3′-O-TBDMS-thymidine- 5′-aldehyde, followed by reduction of the resultant imine derivative and removal of tert-butyldimethylsilyl (TBDMS) protecting group, provided a dimer (denoted as TNHT), which is a congener of dithymidine phosphate with the phosphate linkage 3′-O-P(O)(OH)-O-5′ replaced with an amino group (–NH–). After phosphitylation of the 3′-OH group, the dimer TNHT was introduced (by the standard phosphoramidite approach) into a central part of the nonadecathymidylate. This oligomer exhibited lower affinity to the complementary single and double stranded DNA complements as compared to unmodified T19 oligonucleotide. The cleavage of modified oligomer with the snake venom and calf spleen phosphodiesterases was completely suppressed at the site of modification. RNA oligomers containing the TNHT dimer were used for preparation of siRNA molecules directed towards mRNA of BACE1 (beta-site amyloid precursor protein cleaving enzyme). The presence of the TNHT units at the 3′-ends of the RNA strands of the siRNA molecule (the siRNA itself is an effective gene expression inhibitor for BACE1) preserved the gene silencing activity and improved the stability of the modified siRNA in 10% fetal bovine serum.

RNAi effects on regulation of endogenous acid invertase activity in potato (Solanum tuberosum L.) tubers

2008 ◽  
Vol 5 (2) ◽  
pp. 107-112 ◽  
Author(s):  
Zhang Chi ◽  
Xie Cong-Hua ◽  
Song Bo-Tao ◽  
Liu Xun ◽  
Liu Jun
Keyword(s):  
Solanum Tuberosum ◽  
Solanum Tuberosum L ◽  
Pcr Amplification ◽  
Invertase Activity ◽  
Northern Blotting ◽  
Acid Invertase ◽  
Transcriptional Gene Silencing ◽  
Post Transcriptional Gene Silencing ◽  
Transgenic Lines ◽  
Potential Strategy

AbstractIn plants, acid invertases are known to be the key enzymes cleaving sucrose into reducing sugars (RS) (glucose and fructose). To improve the quality of potato (Solanum tuberosum L.) chips, which is largely influenced by RS accumulation in tubers stored at low temperature, a part of acid invertase cDNA with hairpin RNA (hpRNA) structure was transformed into potato cv. N2. Detection of polymerase chain reaction (PCR) amplification and Northern blotting suggested that the RNA interference (RNAi) vector was successfully transformed into cv. N2. The analysis of acid invertase activity in the plantlets and microtubers of RNAi transgenic lines indicated that the expression of the acid invertase was significantly repressed by the activity of RNAi of plantlets by an average 69.8% (with the exception of line Ni-1) with a maximal decrease of 78% (line Ni-4), and the highest decrease of activity in microtubers of 68%. Compared with that of well-inhibited antisense inv transgenic plants, the comparative downregulation of RNAi suggests a distinct alteration of endogenous acid invertase activity and a potential strategy for post-transcriptional gene silencing (PTGS) in modulation of cold-sweetening in potato.

Sign in / Sign up

Export Citation Format

Share Document