Isolation of a WD40-repeat gene regulating anthocyanin biosynthesis in storage roots of purple-fleshed sweet potato

IbMYB1 was one of the major anthocyanin biosynthesis regulatory genes that has been identified and utilized in purple-fleshed sweet potato breeding. At least three members of this gene, namely, IbMYB1-1, -2a, and -2b, have been reported. We found that IbMYB1-2a and -2b are not necessary for anthocyanin accumulation in a variety of cultivated species (hexaploid) with purple shoots or purplish rings/spots of flesh. Transcriptomic and quantitative reverse transcription PCR (RT-qPCR) analyses revealed that persistent and vigorous expression of IbMYB1 is essential to maintain the purple color of leaves and storage roots in this type of cultivated species, which did not contain IbMYB1-2 gene members. Compared with IbbHLH2, IbMYB1 is an early response gene of anthocyanin biosynthesis in sweet potato. It cannot exclude the possibility that other MYBs participate in this gene regulation networks. Twenty-two MYB-like genes were identified from 156 MYBs to be highly positively or negatively correlated with the anthocyanin content in leaves or flesh. Even so, the IbMYB1 was most coordinately expressed with anthocyanin biosynthesis genes. Differences in flanking and coding sequences confirm that IbMYB2s, the highest similarity genes of IbMYB1, are not the members of IbMYB1. This phenomenon indicates that there may be more members of IbMYB1 in sweet potato, and the genetic complementation of these members is involved in the regulation of anthocyanin biosynthesis. The 3′ flanking sequence of IbMYB1-1 is homologous to the retrotransposon sequence of TNT1-94. Transposon movement is involved in the formation of multiple members of IbMYB1. This study provides critical insights into the expression patterns of IbMYB1, which are involved in the regulation of anthocyanin biosynthesis in the leaf and storage root. Notably, our study also emphasized the presence of a multiple member of IbMYB1 for genetic improvement.

Download Full-text

MYB44 competitively inhibits the formation of the MYB340-bHLH2-NAC56 complex to regulate anthocyanin biosynthesis in purple-fleshed sweet potato

BMC Plant Biology ◽

10.1186/s12870-020-02451-y ◽

2020 ◽

Vol 20 (1) ◽

Cited By ~ 1

Author(s):

Zeng-Zheng Wei ◽

Kang-Di Hu ◽

Dong-Lan Zhao ◽

Jun Tang ◽

Zhong-Qin Huang ◽

...

Keyword(s):

Sweet Potato ◽

Anthocyanin Biosynthesis

Download Full-text

Isolation and characterisation of invertase inhibitor from sweet potato storage roots

Journal of the Science of Food and Agriculture ◽

10.1002/jsfa.3380 ◽

2008 ◽

Vol 88 (15) ◽

pp. 2615-2621 ◽

Cited By ~ 3

Author(s):

Guan-Jhong Huang ◽

Ming-Jyh Sheu ◽

Yuan-Shiun Chang ◽

Te-Ling Lu ◽

Heng-Yuan Chang ◽

...

Keyword(s):

Sweet Potato ◽

Potato Storage ◽

Storage Roots ◽

Invertase Inhibitor

Download Full-text

First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽

10.1094/pdis-09-13-0953-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 702-702 ◽

Cited By ~ 1

Author(s):

B. Gao ◽

R. Y. Wang ◽

S. L. Chen ◽

X. H. Li ◽

J. Ma

Keyword(s):

Sweet Potato ◽

Dna Sequences ◽

Molecular Characteristics ◽

28S Rrna ◽

Storage Roots ◽

Specific Primers ◽

First Report ◽

Meloidogyne Enterolobii ◽

Meloidogyne Spp ◽

Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

Effects of Arbuscular Mycorrhizal Fungal Inoculation on Growth and Yield of Two Sweet Potato Varieties

Journal of Agriculture and Ecology Research International ◽

10.9734/jaeri/2019/v18i330063 ◽

2019 ◽

pp. 1-8 ◽

Cited By ~ 1

Author(s):

Michael Ajanja Sakha ◽

Joyce Jefwa ◽

Joseph P. Gweyi-Onyango

Keyword(s):

Sweet Potato ◽

Arbuscular Mycorrhizal ◽

Growth And Yield ◽

Shoot Biomass ◽

Storage Roots ◽

Sweet Potatoes ◽

Potato Varieties ◽

Significant Difference ◽

Amf Inoculation ◽

Number Of Branches

Arbuscular mycorrhizal fungi (AMF) represent a functionally important component of soil microbial community, being of particular significance for plant mineral nutrition in tropical agro ecosystems. The effects of AMF inoculation on growth and yield of two sweet potato varieties was studied during the short rains season of 2017/2018 in the Teaching and Research Farm of Agricultural Science and Technology Department, Kenyatta University. The experiment was laid down as 2x2 factorial design in a randomized complete block design (RCBD) with three replications. The experimental factors were two sweet potato varieties (Kemb-10 and Bungoma) and AMF inoculum (With and without inoculation). Data on growth parameters was collected on vine length and number of branches, while data on yield was collected on marketable storage roots and shoot biomass. Data was analyzed using Genstat 15th edition and the results showed that there was significantly difference at P≤0.05 among the treatments. AMF inoculation increased growth and yield of sweet potatoes by vine length 29.74%, Number of branches 22.36%, marketable storage roots 18.32%, and shoot biomass 28.68% in week 20. Also, variety interacting with AMF inoculation enhanced growth and yield parameters. In conclusion, the study demonstrated that the application of commercial AMF inoculum solely or when interacting with varieties enhanced growth and yield of sweet potatoes, though there was no significant difference between the two varieties.

Download Full-text

Characterization of Anthocyanins in Sweet Potato Leaves Grown in Various Stages and Conditions

European Journal of Nutrition & Food Safety ◽

10.9734/ejnfs/2019/v10i430119 ◽

2019 ◽

pp. 253-262

Author(s):

Xiaoyu Su ◽

Zhenbao Jia ◽

Fei Tao ◽

Jiamin Shen ◽

Jingwen Xu ◽

...

Keyword(s):

Sweet Potato ◽

Ipomoea Batatas ◽

Anthocyanin Biosynthesis ◽

Total Phenolic ◽

Growth Stages ◽

Anthocyanin Content ◽

Potential Health ◽

Significant Difference ◽

Young Leaves ◽

Sweet Potato Leaves

Phytochemical-enriched edible greens, sweet potato leaves (Ipomoea batatas L.), have become popular due to potential health benefits. However, the phytochemical contents in sweet potato leaves and their subsequent change over harvest stages and growth condition are mostly unknown. In this study, the anthocyanin profile and content in leaves of four sweet potato cultivars, i.e., white-skinned and white-fleshed Bonita, red-skinned and orange-fleshed Beauregard, red-skinned and white-fleshed Murasaki and purple-skinned and purple-fleshed P40, were evaluated. Fourteen anthocyanins were isolated and identified by HPLC-MSI/MS. The most abundant was cyanidin 3-caffeoyl-p-hydroxybenzoyl sophoroside-5-glucoside, which comprised up to 20% of the total anthocyanins. Of the young leaves (1st and 2nd slip cuttings), Bonita contained the highest anthocyanin content followed by P40. Of the mature leaves (vine stage), Beauregard had the greatest anthocyanin (592.5 ± 86.4 mg/kg DW) and total phenolic (52.2 ± 3 mg GAE/g DW). It should be noted that the lowest anthocyanin and total phenolic content of shoots were found in P40, while tubers of P40 contain the highest content of each. Furthermore, the increase in leaf anthocyanin content over the growth stages that was observed in three of the cultivars but not in P40. No significant difference of anthocyanin content was found in Beauregard leaves grown in the high tunnels when compared with that in the open field. This study demonstrated for the first time that anthocyanin levels were significantly changed in response to various growth stages but not high tunnel condition, indicating that the effect of anthocyanin biosynthesis in sweet potato leaves is highly variable and genotype specific.

Download Full-text

MYB44 competitively inhibits the formation of the MYB340-bHLH2-NAC56 complex to regulate anthocyanin biosynthesis in purple-fleshed sweet potato

10.21203/rs.2.23574/v1 ◽

2020 ◽

Author(s):

Zeng-Zheng Wei ◽

Kang-Di Hu ◽

Dong-Lan Zhao ◽

Jun Tang ◽

Zhong-Qin Huang ◽

...

Keyword(s):

Sweet Potato ◽

Regulatory Network ◽

Anthocyanin Biosynthesis ◽

Expression System ◽

Firefly Luciferase ◽

Anthocyanin Accumulation ◽

Tuberous Roots ◽

Regulatory Complex ◽

Transcriptional Complex ◽

Insight Into

Abstract Background: Anthocyanins, which have important biological functions and have a beneficial effect on human health, notably account for pigmentation in purple-fleshed sweet potato tuberous roots. Individual regulatory factors of anthocyanin biosynthesis have been identified; however, the regulatory network of anthocyanin biosynthesis in purple-fleshed sweet potato is unclear. Results: We functionally determined that IbMYB340 cotransformed with IbbHLH2 in tobacco and strawberry receptacles induced anthocyanin accumulation, and the addition of IbNAC56a or IbNAC56b caused increased pigmentation. Furthermore, we confirmed the interaction of IbMYB340 with IbbHLH2 and IbNAC56a or IbNAC56b via yeast two-hybrid and firefly luciferase complementation assays; these proteins could form a MYB340-bHLH2-NAC56a or MYB340-bHLH2-NAC56b transcriptional complex to regulate anthocyanin biosynthesis by binding to the IbANS promoter rather than the IbUFGT promoter. Furthermore, it was found by a transient expression system in tobacco leaves that IbMYB44 could decrease anthocyanin accumulation. Moreover, the interaction of IbMYB44 with IbMYB340 and IbNAC56a or IbNAC56b was verified. This result suggested that IbMYB44 acts as a repressor of anthocyanin in sweet potato.Conclusions: The repressor IbMYB44 affected anthocyanin biosynthesis by competitively inhibiting the IbMYB340-IbbHLH2-IbNAC56a or IbMYB340-IbbHLH2-IbNAC56b regulatory complex formation. Overall, the present study proposed a novel regulatory network whereby several vital TFs play key roles in regulating anthocyanin biosynthesis, and it provides strong insight into the potential mechanism underlying anthocyanin biosynthesis in sweet potato tuberous roots with purple color.

Download Full-text

The use of humic acid urea fertilizer for increasing yield and utilization of nitrogen in sweet potato

Czech Journal of Genetics and Plant Breeding ◽

10.17221/24/2017 ◽

2017 ◽

Author(s):

Chen Xiaoguang ◽

Kou Meng ◽

Tang Zhonghou ◽

Zhang Aijun ◽

Li Hongmin

Keyword(s):

Humic Acid ◽

Sweet Potato ◽

Production Efficiency ◽

Potato Production ◽

Utilization Rate ◽

Nitrogen Accumulation ◽

Storage Root ◽

Nitrogen Absorption ◽

Storage Roots ◽

Urea Fertilizer

Humic acid urea fertilizer (HA-N) is a new type of slow-release nitrogenous fertilizer that can enhance utilization rate of urea, and consequently increases crop yield. However, there were few researches about the effect of HA-N on the nitrogen absorption and utilization in sweet potato production. Hence, the effect of HA-N on nitrogen accumulation and distribution, nitrogen use efficiency (NUE), and yield of sweet potato was studied in the field using the <sup>15</sup>N tracer technique. Results showed that HA-N significantly increased the number of storage roots per plant and the average fresh weight per storage root, as well as the yield increased by 29.6% compared with urea fertilizer. Furthermore, nitrogen accumulation of total plant was higher under the HA-N. In addition, HA-N significantly increased nitrogen production efficiency of fertilizer and nitrogen production efficiency. Results of a <sup>15</sup>N tracer experiment revealed that the percentage of nitrogen absorbed by plant from fertilizer increased from 31.1% to 38.7% and NUE increased from 33.5% to 44.8% with application of HA-N when compared with single N treatment, respectively. HA-N significantly increased sweet potato storage root yield, nitrogen absorption and NUE, as well as it reduced the loss of nitrogen fertilizer.

Download Full-text