Development and validation of RT-PCR multiplex detection of grapevine viruses and viroids in the Czech Republic

2019 ◽  
Vol 102 (2) ◽  
pp. 511-515
Author(s):  
Marcela Komínková ◽  
Petr Komínek
Keyword(s):  
Czech Republic ◽  
Multiplex Detection ◽  
Rt Pcr ◽  
The Czech Republic ◽  
Pcr Multiplex ◽  
Development And Validation

scholarly journals Dynamics of seroconversion of anti-SARS-CoV-2 IgG antibodies in the Czech unvaccinated population: nationwide prospective seroconversion (PROSECO) study

2021 ◽  
Author(s):  
Pavel Piler ◽  
Vojtěch Thon ◽  
Lenka Andrýsková ◽  
Kamil Doležel ◽  
David Kostka ◽  
...  
Keyword(s):  
Czech Republic ◽  
Population Based ◽  
Igg Antibodies ◽  
Rt Pcr ◽  
The Czech Republic ◽  
Global Pandemic ◽  
Government Data ◽  
Low Incidence ◽  
Study Participants ◽  
Second Wave

AbstractBackgroundAlthough the Czech Republic weathered the first wave of the COVID-19 epidemic with relatively low incidence, the second wave of the global pandemic saw it rank among countries bearing the greatest COVID-19 burden, both in Europe and on a worldwide scale. The aim of the nationwide prospective seroconversion (PROSECO) study was to investigate the dynamics of seroconversion of anti-SARS-CoV-2 IgG antibodies in the Czech population.MethodsAll clients of the second largest health insurance company in the Czech Republic were sent a written invitation to participate in this longitudinal study. The study includes the first 30,054 persons who provided a blood sample between October 2020 and March 2021. Seroprevalence was compared between calendar periods of blood sample collection, RT-PCR test results, sociodemographic factors, and other characteristics.FindingsThe data show a dramatic increase in seropositivity over time, from 28% in October/November 2020 to 43% in December 2020/January 2021 to 51% in February/March 2021. These trends were consistent with government data on cumulative viral antigenic prevalence in the population captured by PCR testing – although the seroprevalence rates established in this study were considerably higher than those listed in government data. Data pooled across the entire study period exhibited minor differences in seropositivity between sexes, age groups and body mass index categories; results were similar between test providing laboratories. Seropositivity was substantially higher among symptomatic vs. asymptomatic persons (76% vs. 34%). At least one third of all seropositive participants were asymptomatic, and 28% participants who developed antibodies against SARS-CoV-2 never underwent PCR testing.InterpretationAntibody response provides a better marker of past SARS-CoV-2 infection than PCR testing data. Our data on seroconversion confirm the rapidly increasing prevalence in the Czech population during the dramatically rising pandemic wave prior to the beginning of massive vaccination. The planned second and third assessment of the study participants (April 2021 – September 2021, October 2021 – March 2022) will provide valuable evidence on the seroprevalence changes following vaccination and persistence of antibodies resulting from natural infection and vaccination.Research in contextEvidence before this studySimilarly to most European countries, the first COVID-19 epidemic wave in the Czech Republic produced a relatively low incidence (86.9 confirmed cases per 100,000 persons over three months). At the peaks of the second wave, however, over 100 confirmed cases per 100,000 persons were diagnosed daily and the Czech Republic ranked among the countries with the greatest burden of COVID-19 in Europe and in the world. Only a few nationwide population-based studies have been published covering the second wave of the epidemic in Europe, and none of them from the Central and Eastern European region.Added value of this studyThe PROSECO study will provide key data from the heavily affected Central European region and contribute to the epidemiological and serological characteristics of the SARS-CoV-2 infection. All 30,054 study participants were recruited between October 2020 and March 2021, thus covering all three epidemic peaks (November 2020, January and March 2021) of the second COVID-19 epidemic wave. This allows us to follow the dynamics of seroconversion of anti-SARS-CoV-2 IgG antibodies in the immunologically naive and unvaccinated population during the COVID-19 pandemic. The study participants will be re-assessed in the second (April 2021 – September 2021) and third (October 2021 – March 2022) PROSECO phases to further study the post-infection/post-vaccination dynamics of seroconversion in/after a period of massive vaccination.Implications of all the available evidenceData from the first phase of the PROSECO study indicate that the percentage of the population that has been exposed to the SARS-CoV-2 may be substantially higher than estimates based on official data on cumulative viral positivity incidence as at least one third of seropositive participants were asymptomatic, and 28% of participants who developed antibodies against SARS-CoV-2 never underwent PCR testing. Regional seroprevalence data provide key information to inform, in combination with other surveillance data, public health policies and will be instrumental for the successful management of the subsequent phases of the global pandemic.The number of seropositive participants who never underwent RT-PCR testing demonstrates the importance of serological population-based studies describing the spread and exposure to the virus in the population over time.

scholarly journals Cherry virus A infecting cherries and plums in the Czech Republic – Short communication

2013 ◽  
Vol 40 (No. 1) ◽  
pp. 37-39 ◽  
Author(s):  
D. Šafářová ◽  
M. Navrátil ◽  
F. Paprštein ◽  
T. Candresse ◽  
A. Marais
Keyword(s):  
Phylogenetic Analysis ◽  
Czech Republic ◽  
Sweet Cherry ◽  
Short Communication ◽  
Rt Pcr ◽  
Pcr Assay ◽  
The Czech Republic ◽  
Germplasm Collections ◽  
Sweet Cherries

 The presence of Cherry virus A (CVA) in the germplasm collections of sweet cherries and plums was studied. CVA was detected using the specific RT-PCR assay in six of eight sweet cherry and one of four plum cultivars. Specifity of amplicons and distant position of cherry and non-cherry isolates was verified by sequencing and phylogenetic analysis. Results indicate that the cherry landraces and cultivars could be infected by CVA more than it has been assumed.

scholarly journals Psychologická laboratoř CASRI

E-psychologie ◽  
2021 ◽  
Vol 15 (4) ◽  
pp. 92-94
Author(s):  
Kristýna Rusnáková ◽  
Miloslav Stehlík
Keyword(s):  
Czech Republic ◽  
Physical Education ◽  
Military Personnel ◽  
The Czech Republic ◽  
Research Activities ◽  
Validation Of Methods ◽  
Service Department ◽  
Sports Team ◽  
Development And Validation ◽  
And Training

The CASRI Psychological Laboratory is part of the scientific and service department of the Physical Education and Sport, which provides service, methodological, advisory, and consultancy services. The laboratory is involved in research tasks aimed at the development and validation of methods selection and training of military personnel for the needs of the Ministry of Defence and the Czech Army of the Czech Republic. It is also involved in educational and methodological activities. In addition to research activities provides support to top athletes from the national sports team and their coaches.

scholarly journals Laboratory diagnostics of selected feline respiratory pathogens and their prevalence in the Czech Republic

2019 ◽  
Vol 64 (No. 1) ◽  
pp. 25-32
Author(s):  
D. Lobova ◽  
V. Kleinova ◽  
J. Konvalinova ◽  
P. Cerna ◽  
D. Molinkova
Keyword(s):  
Czech Republic ◽  
Real Time ◽  
Respiratory Infections ◽  
Animal Health ◽  
Diagnostic Methods ◽  
Feline Calicivirus ◽  
The Czech Republic ◽  
Pcr Multiplex ◽  
The Difference ◽  
One Year

Respiratory problems in cats have a multifactorial character. Therapy without the detection of pathogen is often ineffective. Our study was therefore focused on the detection of important feline respiratory bacterial pathogens such as Mycoplasma felis, Chlamydia felis and Bordetella bronchiseptica and viral pathogens such as Felid alphaherpesvirus-1 and feline calicivirus. The goal of this study was to map the occurrence of these pathogens in cat populations in the Czech Republic with the aim of introducing rapid and highly sensitive methods into routine diagnostics and to provide consulting services to animal health professionals based on the acquired data. A total of 218 cats were investigated in the study: 69 were outdoor and 149 were indoor cats. Three groups of animals were compared: up to one year of age (60 cats), one to three years of age (68 cats) and more than three years of age (90 cats). Samples were taken from conjunctiva and/or the oropharynx. Samples originated from cats with various forms of respiratory disease or from healthy cats from different parts of the Czech Republic. Real-Time RT-PCR, multiplex Real-Time PCR, nested PCR and sequencing analyses were performed. Outdoor cats were infected more often (84 detected pathogens in 69 cats) than indoor cats (110 detected infections in 149 cats). More than one pathogen was detected in a total of 38 cats, and six cats were infected with more than two pathogens. The difference was statistically significant in the case of co-infections, but not for mono-infections (P < 0.05). Kittens and young adults up to the age of one year were the most common reservoirs of respiratory infections (only 19 cats out of 60 were negative and positive cats often harboured coinfections). The difference in age groups were not statistically significant (P > 0.05). Concerning the site of the sampling, feline calicivirus, M. felis and B. bronchiseptica were detected more often from oropharynx than from conjunctival swabs. M. felis was slightly more common in clinically diseased animals (39.6%) than in healthy ones (26.1%). The obtained results reveal the frequency of individual pathogens and their co-infections in cats kept on the territory of the Czech Republic, data which can be used to make the treatment of respiratory infections and breeding measures more effective. Therefore, the diagnostic methods are now available to veterinary surgeons with the possibility of consultation and discussion of the results.

scholarly journals Genotyping of bovine viral diarrhoea virus isolates from the Czech Republic

2009 ◽  
Vol 54 (No. 9) ◽  
pp. 393-398 ◽  
Author(s):  
B. Robesova ◽  
K. Kovarcik ◽  
S. Vilcek
Keyword(s):  
Czech Republic ◽  
Bovine Viral Diarrhoea Virus ◽  
Computer Assisted ◽  
Bovine Viral Diarrhoea ◽  
Rt Pcr ◽  
Serum Samples ◽  
The Czech Republic ◽  
Genetic Typing ◽  
Diarrhoea Virus ◽  
Virus Isolates

This study was focused on the genetic typing of bovine viral diarrhoea virus (BVDV) isolates obtained from 41 serum samples of persistently infected cattle in the Czech Republic in the period of 2004 to 2007. For the differentiation of BVDV isolates, the 5’-UTR and Npro</sup> regions were selected. A 288-bp fragment from 5’-UTR and 428-bp fragment from Npro of the selected isolates were amplified by RT-PCR and subsequently sequenced and analysed by computer-assisted phylogenetic analysis. The isolates belong to BVDV-1 genotype and the following subtypes were identified: b (<i>n</i> = 16), d (<i>n</i> = 16), e (<i>n</i> = 2) and f (<i>n</i> = 7). In this collection of viral samples, no isolate belonged to BVDV-2 genotype.

scholarly journals First Report of Apricot pseudo-chlorotic leaf spot virus Infecting Plum (Prunus domestica) in the Czech Republic

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 461-461 ◽  
Author(s):  
D. Šafářová ◽  
M. Navrátil ◽  
C. Faure ◽  
T. Candresse ◽  
A. Marais
Keyword(s):  
Czech Republic ◽  
Amino Acid ◽  
Leaf Spot ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Prunus Domestica ◽  
Rt Pcr ◽  
Spot Virus ◽  
The Czech Republic ◽  
Chlorotic Leaf

Apricot pseudo-chlorotic leaf spot virus (APCLSV) is a novel, still poorly known Trichovirus in the family Betaflexiviridae. It is most closely related to Apple chlorotic leaf spot virus (ACLSV) (2,4) and infects stone fruit trees of the Prunus genus. Its presence has so far been detected in apricot, plum, Japanese plum, and peach trees in Italy, Spain, France, Hungary, Turkey, Jordan, and Australia (1,2,4). During the summers of 2008 and 2010, leaf samples of old Czech local plum cultivars were obtained from the Holovousy collection and assessed for the presence of viruses belonging to the Capillovirus, Trichovirus, and Foveavirus genera using the polyvalent degenerate oligonucleotides (PDO) nested reverse transcription (RT)-PCR test (3). Following amplification from total RNAs extracts, the amplicons were cloned and several clones were sequenced for each plant sample. In plum (Prunus domestica) cv. Babce, a mixture of amplicons was observed and BlastN and BlastX analyses of the obtained sequences revealed the presence of ACLSV and APCLSV. The 310-bp APCLSV amplicon (GenBank Accession No. JN790294) showed highest identity (82.9% in nucleotide sequence and 97.1% in amino acid sequence) with the Sus2 isolate of APCLSV (4) and clustered with APCLSV isolates in a phylogenetic analysis. APCLSV infection was further confirmed with an APCLSV-specific RT-PCR assay (4), which yielded a product of the expected 205-bp size (GenBank Accession No. JN653070) with closest homology again to the Sus2 APCLSV isolate (83.4 and 94.3% nucleotide and amino acid identity, respectively). To our knowledge, this finding represents the first detection of APCLSV in domestic plums in the Czech Republic, extending our vision of APCLSV diversity and its geographic distribution. For unknown reasons, APCLSV has almost always been reported in mixed infection with ACLSV (1,2,4) and the situation in cv. Babce does not deviate from this trend. This has greatly hindered the analysis of the pathogenicity of APCLSV, a situation further complicated in the current case because the Babce cultivar was also infected by Plum pox virus. References: (1) M. Barone et al. Acta Hortic. 781:53, 2008. (2) T. Candresse et al. Virus and Virus-Like Diseases of Pome and Stone Fruit Trees. A. Hadidi et al., eds. The American Phytopathological Society, St. Paul, MN, 2011. (3) X. Foissac et al. Phytopathology 95:617, 2005. (4) D. Liberti et al. Phytopathology 95:420, 2005.

scholarly journals First Report of Barley yellow dwarf virus-MAV in Oat, Wheat, and Barley Grown in the Czech Republic

Plant Disease ◽  
2009 ◽  
Vol 93 (9) ◽  
pp. 964-964 ◽  
Author(s):  
J. K. Kundu
Keyword(s):  
Czech Republic ◽  
Barley Yellow Dwarf Virus ◽  
Virus Disease ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Rt Pcr ◽  
The Czech Republic ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus

Barley yellow dwarf disease, a ubiquitous virus disease of cereal crops worldwide, is caused by a group of related, single-stranded RNA viruses assigned to Luteovirus (Barley yellow dwarf virus [BYDV] spp. PAV, PAS, MAV, and GAV) or Polerovirus (Cereal yellow dwarf virus-RPV) genera or unassigned to a genera (BYDV-SGV, BYDV-RMV, and BYDV-GPV) in the family Luteoviridae (1). Incidence of BYDV in cereal crops (e.g., barley, wheat, and oats) was high, and in recent years, reached epidemic levels in many regions of the Czech Republic. BYDV-PAV and BYDV-PAS have been identified in Czech cereal crops (2,4). Surveys of the incidence of BYDV were carried out using ELISA (SEDIAG SAS, Longvic, France) and one-step reverse transcription (RT)-PCR (Qiagen, Hilden, Germany) (2) during 2007 and 2008. Samples (125) were collected from different fields around the Czech Republic and 96 were BYDV positive. Three of the field isolates, CZ-6815, CZ-1561, and CZ-10844, from oat (Avena sativa; cv. Auron), winter wheat (Triticum aestivum; cv. Apache), and winter barley (Hordeum vulgare; cv. Merlot), respectively, were identified as BYDV-MAV by sequencing of the RT-PCR product (641-bp fragment) used to identify BYDV, which spanned 2839–3479 of the BYDV genome (GenBank Accession Nos. EF043235 and NC_002160) (2). The partial coat protein gene sequence of 483 nt was compared with the available sequences of 12 BYDV-PAV isolates (PAV-JP, PAV-NY, PAV-ILL, PAV-AUS, PAV-WG2, PAV-whG4y3, PAV-on21-4, Tahoe1, CA-PAV, HB3, FH3, and MA9501); nine BYDV-PAS isolates (PAS-129, PAS-64, WS6603, WG13, PAS-Tcb4-1, PASwaw5-9, FL2, PAS-Vd29, and PAS-MA9516); and six BYDV-MAV isolates (MAV-CA, MAV-PS1X1, MAV-Alameds268, LMB2a, SI-o4, and MAV-CN) by MEGA4 (3). Nucleotide and amino acid sequence identities for the three isolates ranged from 92.9 to 99.4% and 88.0 to 95.8%, respectively, for available BYDV-MAV isolates; 76.8 to 78.2% and 62.7 to 67.6%, respectively, for available BYDV-PAS isolates; and 77.6 to 79.3% and 65.5 to 70.4%, respectively, for available PAV isolates. The sequence data indicates that these isolates (CZ-6815, CZ-1561, and CZ10844; GenBank Accession Nos. FJ645747, FJ645758, and FJ645746, respectively) are BYDV-MAV. To my knowledge, this is the first record of BYDV-MAV in the Czech Republic. References: (1) C. J. D'Arcy and L. L. Domier. Page 891 in: Virus Taxonomy-8th Report of the ICTV. C. M. Fauquet et al., eds. Springer-Verlag, NY, 2005. (2) J. K. Kundu. Plant Dis. 92:1587, 2008. (3) K. Tamura et al. Mol. Biol. Evol. 24:1596, 2007. (4) J. Vacke. Page 100 in: Sbornik Referatu z Odborneho Seminare, Aktualni Problemy Ochrany Polnich Plodin, Praha, 1991.

scholarly journals First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1537-1537 ◽  
Author(s):  
M. Hassan ◽  
P. Rysanek ◽  
F. Di Serio
Keyword(s):  
Czech Republic ◽  
Stone Fruit ◽  
Reference Sequence ◽  
Mixed Infections ◽  
Rt Pcr ◽  
The Czech Republic ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

scholarly journals First Report of Tobacco streak virus on Dahlia in the Czech Republic

Plant Disease ◽  
2008 ◽  
Vol 92 (3) ◽  
pp. 484-484 ◽  
Author(s):  
V. Mokra ◽  
B. Gotzova ◽  
V. Bezdekova ◽  
P. Dedic ◽  
J. Ptacek
Keyword(s):  
Czech Republic ◽  
Mosaic Virus ◽  
Rna Extraction ◽  
Chenopodium Quinoa ◽  
Spherical Particles ◽  
Tobacco Streak Virus ◽  
Streak Virus ◽  
Rt Pcr ◽  
The Czech Republic ◽  
Dahlia Mosaic Virus

Dahlia is an important ornamental crop in the Czech Republic where they have been grown for more than 150 years. New dahlia cultivars have been selected by Czech plant breeders. Virus diseases, including mosaic and stunt caused mostly by Dahlia mosaic virus, have been a problem. From 2003 to 2005, color breaking was observed in several dahlia cultivars of foreign and Czech origin. White stripes in blossoms were most frequently expressed in the second half of the flowering season. No symptoms are visible in flowers of white and yellow cultivars. It was difficult to characterize symptoms on leaves because most cultivars were infected simultaneously by Dahlia mosaic virus. Sap inoculations of Chenopodium quinoa produced local lesions after 5 to 7 days, followed by systemic chlorosis, necrosis of younger leaves, and death of the shoot apex, indicating possible Tobacco streak virus (TSV) infection (2). Spherical particles (25 to 30 nm) were observed in leaf-dip preparations of samples from experimentally infected C. quinoa plants and analyzed by using transmission electron microscopy. These particles became decorated when using immunoelectron microscopy with TSV IgG (Bioreba, Reinach, Switzerland and Neogen, Ayrshire, Scotland). Samples of 80 dahlia cultivars were tested for TSV infection by ELISA using commercially available kits (Bioreba and Neogen). Most of the samples were grown in a collection of dahlia cultivars of Czech and foreign origin and some were obtained from growers in the Czech Republic. Fifty six dahlia cultivars were shown to be TSV infected. ELISA also indicated a higher concentration of the virus in flowers. The identity of the virus isolated from symptomatic plants was confirmed by reverse transcription (RT)-PCR using total RNA extraction from symptomatic plants. RT-PCR (4), using a primer pair (1) derived from the coat protein gene sequence of TSV (3), was followed by electrophoresis on 1.0% agarose gels. Products of the predicted size (approximately 700 bp) were found in naturally infected dahlia plants (n = 10), systemically infected host plants C. quinoa (n = 10), and symptomatic Nicotina megalosiphon (n = 10) that scored as TSV positive by ELISA. No bands of this size were seen in negative controls. To our knowledge, this is the first detection of TSV in the Czech Republic. References: (1) A. I. Bhat et al. Arch. Virol. 147:651, 2002. (2) A. A. Brunt Plant Pathol. 17:119, 1968. (3) B. J. C. Cornelissen et al. Nucleic Acids Res.12:2427, 1984. (4) S. S. Pappu et al. J. Virol. Methods 4:9, 1993.

Sign in / Sign up

Export Citation Format

Share Document