Structure of the Retinal Determination Protein Dachshund Reveals a DNA Binding Motif

Knowledge of the diverse DNA binding specificities of transcription factors is important for understanding their specific regulatory functions in animal development and evolution. We have examined the genome-wide binding properties of the mouse HOXB1 protein in embryonic stem cells differentiated into neural fates. Unexpectedly, only a small number of HOXB1 bound regions (7%) correlate with binding of the known HOX cofactors PBX and MEIS. In contrast, 22% of the HOXB1 binding peaks display co-occupancy with the transcriptional repressor REST. Analyses revealed that co-binding of HOXB1 with PBX correlates with active histone marks and high levels of expression, while co-occupancy with REST correlates with repressive histone marks and repression of the target genes. Analysis of HOXB1 bound regions uncovered enrichment of a novel 15 base pair HOXB1 binding motif HB1RE (HOXB1 response element). In vitro template binding assays showed that HOXB1, PBX1, and MEIS can bind to this motif. In vivo, this motif is sufficient for direct expression of a reporter gene and over-expression of HOXB1 selectively represses this activity. Our analyses suggest that HOXB1 has evolved an association with REST in gene regulation and the novel HB1RE motif contributes to HOXB1 function in part through a repressive role in gene expression.

Download Full-text

Insight into the Dual Functions of Bacterial Enhancer-Binding Protein Rrp2 of Borrelia burgdorferi

Journal of Bacteriology ◽

10.1128/jb.01010-15 ◽

2016 ◽

Vol 198 (10) ◽

pp. 1543-1552 ◽

Cited By ~ 8

Author(s):

Yanping Yin ◽

Youyun Yang ◽

Xuwu Xiang ◽

Qian Wang ◽

Zhang-Nv Yang ◽

...

Keyword(s):

Dna Binding ◽

Borrelia Burgdorferi ◽

Binding Protein ◽

Phosphorylation Site ◽

Binding Motif ◽

Cell Replication ◽

Additional Function ◽

Content Type ◽

Terminal Domain ◽

Enhancer Binding Protein

ABSTRACTIt is well established that the RpoN-RpoS sigma factor (σ54-σS) cascade plays an essential role in differential gene expression during the enzootic cycle ofBorrelia burgdorferi, the causative agent of Lyme disease. The RpoN-RpoS pathway is activated by the response regulator/σ54-dependent activator (also called bacterial enhancer-binding protein [bEBP]) Rrp2. One unique feature of Rrp2 is that this activator is essential for cell replication, whereas RpoN-RpoS is dispensable for bacterial growth. How Rrp2 controls cell replication, a function that is independent of RpoN-RpoS, remains to be elucidated. In this study, by generating a series of conditionalrrp2mutant strains, we demonstrated that the N-terminal receiver domain of Rrp2 is required for spirochetal growth. Furthermore, a D52A point mutation at the phosphorylation site within the N terminus of Rrp2 abolished cell replication. Mutation of the ATPase motif within the central domain of Rrp2 did not affect spirochetal replication, indicating that phosphorylation-dependent ATPase activity of Rrp2 for σ54activation is not required for cell growth. However, deletion of the C-terminal domain or a 16-amino-acid truncation of the helix-turn-helix (HTH) DNA-binding motif within the C-terminal domain of Rrp2 abolished spirochetal replication. It was shown that constitutive expression ofrpoSis deleterious to borrelial growth. We showed that the essential nature of Rrp2 is not due to an effect onrpoS. These data suggest that phosphorylation-dependent oligomerization and DNA binding of Rrp2 likely function as a repressor, independently of the activation of σ54, controlling an essential step of cell replication inB. burgdorferi.IMPORTANCEBacterial enhancer-binding proteins (bEBPs) are a unique group of transcriptional activators specifically required for σ54-dependent gene transcription. This work demonstrates that theB. burgdorferibEBP, Rrp2, has an additional function that is independent of σ54, that of its essentiality for spirochetal growth, and such a function is dependent on its N-terminal signal domain and C-terminal DNA-binding domain. These findings expand our knowledge on bEBP and provide a foundation to further study the underlying mechanism of this new function of bEBP.

Download Full-text

Cell Cycle Localization, Dimerization, and Binding Domain Architecture of the Telomere Protein cPot1

Molecular and Cellular Biology ◽

10.1128/mcb.24.5.2091-2102.2004 ◽

2004 ◽

Vol 24 (5) ◽

pp. 2091-2102 ◽

Cited By ~ 28

Author(s):

Chao Wei ◽

Carolyn M. Price

Keyword(s):

Cell Cycle ◽

Dna Binding ◽

Binding Site ◽

Domain Architecture ◽

Binding Domain ◽

Binding Motif ◽

Dna Binding Domain ◽

Telomere Protein ◽

Ob Fold

ABSTRACT Pot1 is a single-stranded-DNA-binding protein that recognizes telomeric G-strand DNA. It is essential for telomere capping in Saccharomyces pombe and regulates telomere length in humans. Human Pot1 also interacts with proteins that bind the duplex region of the telomeric tract. Thus, like Cdc13 from S. cerevisiae, Pot 1 may have multiple roles at the telomere. We show here that endogenous chicken Pot1 (cPot1) is present at telomeres during periods of the cell cycle when t loops are thought to be present. Since cPot1 can bind internal loops and directly adjacent DNA-binding sites, it is likely to fully coat and protect both G-strand overhangs and the displaced G strand of a t loop. The minimum binding site of cPot1 is double that of the S. pombe DNA-binding domain. Although cPot can self associate, dimerization is not required for DNA binding and hence does not explain the binding-site duplication. Instead, the DNA-binding domain appears to be extended to contain a second binding motif in addition to the conserved oligonucleotide-oligosaccharide (OB) fold present in other G-strand-binding proteins. This second motif could be another OB fold. Although dimerization is inefficient in vitro, it may be regulated in vivo and could promote association with other telomere proteins and/or telomere compaction.

Download Full-text

A novel DNA-binding motif in the nuclear matrix attachment DNA-binding protein SATB1

Molecular and Cellular Biology ◽

10.1128/mcb.14.3.1852-1860.1994 ◽

1994 ◽

Vol 14 (3) ◽

pp. 1852-1860

Author(s):

K Nakagomi ◽

Y Kohwi ◽

L A Dickinson ◽

T Kohwi-Shigematsu

Keyword(s):

Amino Acid ◽

Dna Binding ◽

Direct Contact ◽

Binding Protein ◽

Binding Activity ◽

Binding Domain ◽

Binding Motif ◽

Dna Binding Domain ◽

Sequence Context ◽

Dna Binding Activity

The nuclear matrix attachment DNA (MAR) binding protein SATB1 is a sequence context-specific binding protein that binds in the minor groove, making virtually no contact with the DNA bases. The SATB1 binding sites consist of a special AT-rich sequence context in which one strand is well-mixed A's, T's, and C's, excluding G's (ATC sequences), which is typically found in clusters within different MARs. To determine the extent of conservation of the SATB1 gene among different species, we cloned a mouse homolog of the human STAB1 cDNA from a cDNA expression library of the mouse thymus, the tissue in which this protein is predominantly expressed. This mouse cDNA encodes a 764-amino-acid protein with a 98% homology in amino acid sequence to the human SATB1 originally cloned from testis. To characterize the DNA binding domain of this novel class of protein, we used the mouse SATB1 cDNA and delineated a 150-amino-acid polypeptide as the binding domain. This region confers full DNA binding activity, recognizes the specific sequence context, and makes direct contact with DNA at the same nucleotides as the whole protein. This DNA binding domain contains a novel DNA binding motif: when no more than 21 amino acids at either the N- or C-terminal end of the binding domain are deleted, the majority of the DNA binding activity is lost. The concomitant presence of both terminal sequences is mandatory for binding. These two terminal regions consist of hydrophilic amino acids and share homologous sequences that are different from those of any known DNA binding motifs. We propose that the DNA binding region of SATB1 extends its two terminal regions toward DNA to make direct contact with DNA.

Download Full-text

Identification of amino acids essential for DNA binding and dimerization in p67SRF: implications for a novel DNA-binding motif

Molecular and Cellular Biology ◽

10.1128/mcb.13.1.123-132.1993 ◽

1993 ◽

Vol 13 (1) ◽

pp. 123-132

Author(s):

A D Sharrocks ◽

H Gille ◽

P E Shaw

Keyword(s):

Amino Acids ◽

Amino Acid ◽

Dna Binding ◽

Transcriptional Activation ◽

Serum Response Factor ◽

Alpha Helix ◽

Site Directed Mutagenesis ◽

Binding Motif ◽

Amino Acid Peptide ◽

Serum Response

The serum response factor (p67SRF) binds to a palindromic sequence in the c-fos serum response element (SRE). A second protein, p62TCF binds in conjunction with p67SRF to form a ternary complex, and it is through this complex that growth factor-induced transcriptional activation of c-fos is thought to take place. A 90-amino-acid peptide, coreSRF, is capable for dimerizing, binding DNA, and recruiting p62TCF. By using extensive site-directed mutagenesis we have investigated the role of individual coreSRF amino acids in DNA binding. Mutant phenotypes were defined by gel retardation and cross-linking analyses. Our results have identified residues essential for either DNA binding or dimerization. Three essential basic amino acids whose conservative mutation severely reduced DNA binding were identified. Evidence which is consistent with these residues being on the face of a DNA binding alpha-helix is presented. A phenylalanine residue and a hexameric hydrophobic box are identified as essential for dimerization. The amino acid phasing is consistent with the dimerization interface being presented as a continuous region on a beta-strand. A putative second alpha-helix acts as a linker between these two regions. This study indicates that p67SRF is a member of a protein family which, in common with many DNA binding proteins, utilize an alpha-helix for DNA binding. However, this alpha-helix is contained within a novel domain structure.

Download Full-text

DNA-binding protein activated by gamma radiation in human cells

Molecular and Cellular Biology ◽

10.1128/mcb.10.10.5279-5285.1990 ◽

1990 ◽

Vol 10 (10) ◽

pp. 5279-5285

Author(s):

S P Singh ◽

M F Lavin

Keyword(s):

Dna Binding ◽

Ionizing Radiation ◽

Mammalian Cells ◽

Binding Protein ◽

Simian Virus 40 ◽

Dna Binding Protein ◽

Simian Virus ◽

Human Cells ◽

Binding Motif ◽

Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Download Full-text

A DNA binding motif coordinating synthesis and degradation in proofreading DNA polymerases.

The EMBO Journal ◽

10.1002/j.1460-2075.1996.tb00709.x ◽

1996 ◽

Vol 15 (13) ◽

pp. 3430-3441 ◽

Cited By ~ 34

Author(s):

V. Truniger ◽

J. M. Lázaro ◽

M. Salas ◽

L. Blanco

Keyword(s):

Dna Binding ◽

Dna Polymerases ◽

Binding Motif ◽

Synthesis And Degradation

Download Full-text

The trihelix DNA-binding motif in higher plants is not restricted to the transcription factors GT-1 and GT-2

Proceedings of the National Academy of Sciences ◽

10.1073/pnas.95.6.3318 ◽

1998 ◽

Vol 95 (6) ◽

pp. 3318-3322 ◽

Cited By ~ 22

Author(s):

J. Smalle ◽

J. Kurepa ◽

M. Haegman ◽

J. Gielen ◽

M. Van Montagu ◽

...

Keyword(s):

Transcription Factors ◽

Dna Binding ◽

Higher Plants ◽

Binding Motif

Download Full-text

Crystal Structures of the BlaI Repressor from Staphylococcus aureus and Its Complex with DNA: Insights into Transcriptional Regulation of the bla and mec Operons

Journal of Bacteriology ◽

10.1128/jb.187.5.1833-1844.2005 ◽

2005 ◽

Vol 187 (5) ◽

pp. 1833-1844 ◽

Cited By ~ 46

Author(s):

Martin K. Safo ◽

Qixun Zhao ◽

Tzu-Ping Ko ◽

Faik N. Musayev ◽

Howard Robinson ◽

...

Keyword(s):

Staphylococcus Aureus ◽

Dna Binding ◽

Crystal Structures ◽

Double Helix ◽

Free Form ◽

Binding Motif ◽

Dimerization Domain ◽

Gene Encoding ◽

Dna Binding Sites ◽

Dna Double Helix

ABSTRACT The 14-kDa BlaI protein represses the transcription of blaZ, the gene encoding β-lactamase. It is homologous to MecI, which regulates the expression of mecA, the gene encoding the penicillin binding protein PBP2a. These genes mediate resistance to β-lactam antibiotics in staphylococci. Both repressors can bind either bla or mec DNA promoter-operator sequences. Regulated resistance genes are activated via receptor-mediated cleavage of the repressors. Cleavage is induced when β-lactam antibiotics bind the extramembrane sensor of the sensor-transducer signaling molecules, BlaR1 or MecR1. The crystal structures of BlaI from Staphylococcus aureus, both in free form and in complex with 32 bp of DNA of the mec operator, have been determined to 2.0- and 2.7-Å resolutions, respectively. The structure of MecI, also in free form and in complex with the bla operator, has been previously reported. Both repressors form homodimers, with each monomer composed of an N-terminal DNA binding domain of winged helix-turn-helix topology and a C-terminal dimerization domain. The structure of BlaI in complex with the mec operator shows a protein-DNA interface that is conserved between both mec and bla targets. The recognition helix α3 interacts specifically with the conserved TACA/TGTA DNA binding motif. BlaI and, probably, MecI dimers bind to opposite faces of the mec DNA double helix in an up-and-down arrangement, whereas MecI and, probably, BlaI dimers bind to the same DNA face of bla promoter-operator DNA. This is due to the different spacing of mec and bla DNA binding sites. Furthermore, the flexibility of the dimeric proteins may make the C-terminal proteolytic cleavage site more accessible when the repressors are bound to DNA than when they are in solution, suggesting that the induction cascade involves bound rather than free repressor.

Download Full-text