scholarly journals Ancient hybridization and mtDNA introgression behind current paternal leakage and heteroplasmy in hybrid zones

2019 ◽  
Vol 9 (1) ◽  
Author(s):  
Valentina Mastrantonio ◽  
Sandra Urbanelli ◽  
Daniele Porretta
Keyword(s):  
Natural Populations ◽  
Hybrid Zones ◽  
Sympatric Populations ◽  
Direct Role ◽  
Paternal Leakage ◽  
Specific Pcr ◽  
Mitochondrial Heteroplasmy ◽  
Specific Pcr Assay ◽  
Genetic Novelty ◽  
Mtdna Introgression

AbstractHybridization between heterospecific individuals has been documented as playing a direct role in promoting paternal leakage and mitochondrial heteroplasmy in both natural populations and laboratory conditions, by relaxing the egg-sperm recognition mechanisms. Here, we tested the hypothesis that hybridization can lead to mtDNA heteroplasmy also indirectly via mtDNA introgression. By using a phylogenetic approach, we showed in two reproductively isolated beetle species, Ochthebius quadricollis and O. urbanelliae, that past mtDNA introgression occurred between them in sympatric populations. Then, by developing a multiplex allele-specific PCR assay, we showed the presence of heteroplasmic individuals and argue that their origin was through paternal leakage following mating between mtDNA-introgressed and pure conspecific individuals. Our results highlight that mtDNA introgression can contribute to promote paternal leakage, generating genetic novelty in a way that has been overlooked to date. Furthermore, they highlight that the frequency and distribution of mtDNA heteroplasmy can be deeply underestimated in natural populations, as i) the commonly used PCR-Sanger sequencing approach can fail to detect mitochondrial heteroplasmy, and ii) specific studies aimed at searching for it in populations where mtDNA-introgressed and pure individuals co-occur remain scarce, despite the fact that mtDNA introgression has been widely documented in several taxa and populations.

scholarly journals Are members of the Anopheles fluviatilis complex conspecific?

2021 ◽  
Author(s):  
Om P Singh ◽  
Ankita Sindhania ◽  
Gunjan Sharma ◽  
Shobhna Mishra ◽  
Surya K Sharma ◽  
...  
Keyword(s):  
Cryptic Species ◽  
Specific Primer ◽  
Pcr Assay ◽  
Sympatric Populations ◽  
Diagnostic Pcr ◽  
Specific Pcr ◽  
Anopheles Fluviatilis ◽  
As Species ◽  
Specific Pcr Assay ◽  
Species Specific

Anopheles fluviatilis sensu lato, a primary malaria vector in India, was identified to be comprised of four cryptic species, provisionally designated as species S, T, U and V. However, Kumar et al. (Mol Ecol Resour, 2013;13:354-61) considered all of the then known three members of this species complex (S, T and U) conspecific. The specific status of species S and T was refuted based on the lack of sufficient barcode gap in mitochondrial-CO1 and the perceived presence of heterozygotes in populations as detected through one of the two species-specific PCR assays employed for the cryptic species identification. The existence of species U was refuted claiming that earlier investigations have already refuted their existence. This conclusion is concerning because of the differential public health implications of members of the Fluviatilis Complex. Here we discuss problems associated with the CO1-based barcode approach for delimitation of cryptic species, the perceived heterozygosity between species S and T based on a species-specific PCR assay, and interpretation of published reports. We demonstrated that fixed differences do exist in the ITS2-rDNA sequence of species S and T with no evidence of heterozygotes in sympatric populations and, that the observed heterozygosity by Kumar et al. in the ITS2-based species diagnostic PCR is due to the high mispriming tendency of the T-specific primer with species S. We infer that mitochondrial DNA-based barcoding-gap, an arbitrary threshold recommended for species delimitation, alone, is inadequate to delimit the members of An. fluviatilis complex.

scholarly journals The Genetic Architecture of Ovariole Number in Drosophila melanogaster: Genes with Major, Quantitative, and Pleiotropic Effects

2017 ◽  
Vol 7 (7) ◽  
pp. 2391-2403 ◽  
Author(s):  
Amanda S Lobell ◽  
Rachel R Kaspari ◽  
Yazmin L Serrano Negron ◽  
Susan T Harbison
Keyword(s):  
Candidate Genes ◽  
Genome Wide Association Study ◽  
Natural Populations ◽  
Direct Role ◽  
Genome Wide ◽  
A Genome ◽  
Fitness Trait ◽  
Sleep Parameters ◽  
Activity Behavior ◽  
Ovariole Number

Abstract Ovariole number has a direct role in the number of eggs produced by an insect, suggesting that it is a key morphological fitness trait. Many studies have documented the variability of ovariole number and its relationship to other fitness and life-history traits in natural populations of Drosophila. However, the genes contributing to this variability are largely unknown. Here, we conducted a genome-wide association study of ovariole number in a natural population of flies. Using mutations and RNAi-mediated knockdown, we confirmed the effects of 24 candidate genes on ovariole number, including a novel gene, anneboleyn (formerly CG32000), that impacts both ovariole morphology and numbers of offspring produced. We also identified pleiotropic genes between ovariole number traits and sleep and activity behavior. While few polymorphisms overlapped between sleep parameters and ovariole number, 39 candidate genes were nevertheless in common. We verified the effects of seven genes on both ovariole number and sleep: bin3, blot, CG42389, kirre, slim, VAChT, and zfh1. Linkage disequilibrium among the polymorphisms in these common genes was low, suggesting that these polymorphisms may evolve independently.

Wolbachia and Cytoplasmic Incompatibility in the CaliforniaCulex pipiensMosquito Species Complex: Parameter Estimates and Infection Dynamics in Natural Populations

Genetics ◽  
2003 ◽  
Vol 165 (4) ◽  
pp. 2029-2038 ◽  
Author(s):  
Jason L Rasgon ◽  
Thomas W Scott
Keyword(s):  
Species Complex ◽  
Cytoplasmic Incompatibility ◽  
Natural Populations ◽  
Wolbachia Infection ◽  
Field Conditions ◽  
Parameter Estimates ◽  
Infection Prevalence ◽  
Infection Frequency ◽  
Specific Pcr ◽  
Vector Borne

AbstractBefore maternally inherited bacterial symbionts like Wolbachia, which cause cytoplasmic incompatibility (CI; reduced hatch rate) when infected males mate with uninfected females, can be used in a program to control vector-borne diseases it is essential to understand their dynamics of infection in natural arthropod vector populations. Our study had four goals: (1) quantify the number of Wolbachia strains circulating in the California Culex pipiens species complex, (2) investigate Wolbachia infection frequencies and distribution in natural California populations, (3) estimate the parameters that govern Wolbachia spread among Cx. pipiens under laboratory and field conditions, and (4) use these values to estimate equilibrium levels and compare predicted infection prevalence levels to those observed in nature. Strain-specific PCR, wsp gene sequencing, and crossing experiments indicated that a single Wolbachia strain infects Californian Cx. pipiens. Infection frequency was near or at fixation in all populations sampled for 2 years along a >1000-km north-south transect. The combined statewide infection frequency was 99.4%. Incompatible crosses were 100% sterile under laboratory and field conditions. Sterility decreased negligibly with male age in the laboratory. Infection had no significant effect on female fecundity under laboratory or field conditions. Vertical transmission was >99% in the laboratory and ∼98.6% in the field. Using field data, models predicted that Wolbachia will spread to fixation if infection exceeds an unstable equilibrium point above 1.4%. Our estimates accurately predicted infection frequencies in natural populations. If certain technical hurdles can be overcome, our data indicate that Wolbachia can invade vector populations as part of an applied transgenic strategy for vector-borne disease reduction.

Identification of Klebsiella oxytoca using a specific PCR assay targeting the polygalacturonase pehX gene

2003 ◽  
Vol 154 (8) ◽  
pp. 587-592 ◽  
Author(s):  
Gennadiy Kovtunovych ◽  
Tetyana Lytvynenko ◽  
Valentyna Negrutska ◽  
Olena Lar ◽  
Sylvain Brisse ◽  
...  
Keyword(s):  
Klebsiella Oxytoca ◽  
Pcr Assay ◽  
Specific Pcr ◽  
Specific Pcr Assay

scholarly journals First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 835-835 ◽  
Author(s):  
Y. M. Shen ◽  
T. C. Huang ◽  
C. H. Chao ◽  
H. L. Liu
Keyword(s):  
First Record ◽  
Tween 20 ◽  
Post Inoculation ◽  
Bacterial Spot ◽  
Japanese Plum ◽  
Specific Pcr ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Xanthomonas Arboricola ◽  
Specific Pcr Assay

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5′CCGACATTGCCGTCAGCGATCACG3′ and rv-5′AGCGTTCTTGGGTGTGTTGAGCATTTG3′ (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

scholarly journals Genus Level Identification of Mycobacteria from Clinical Specimens by Using an Easy-To-Handle Mycobacterium-Specific PCR Assay

1998 ◽  
Vol 36 (3) ◽  
pp. 614-617 ◽  
Author(s):  
Fritz Stauffer ◽  
Heinrich Haber ◽  
Armin Rieger ◽  
Robert Mutschlechner ◽  
Petra Hasenberger ◽  
...  
Keyword(s):  
Positive Result ◽  
Internal Control ◽  
Specific Probe ◽  
Culture Result ◽  
Pcr Assay ◽  
Clinical Specimens ◽  
Genus Level ◽  
Specific Pcr ◽  
Specific Pcr Assay ◽  
Culture Positive

An easy-to-handle Mycobacterium-specific PCR assay for detection of the presence of a wide range of mycobacterial species in clinical samples was evaluated. The performance of the genus probe was compared with the performance of probes specific forMycobacterium tuberculosis and Mycobacterium avium and with that of standard culture. In addition, the utility of an internal control in monitoring amplification inhibitors was studied. Of 545 respiratory and 325 nonrespiratory specimens (a total of 870 specimens), 58 (6.7%) showed the presence of amplification inhibitors, as determined by a negative result for the internal control. Of these 58 specimens, 31 (53%) were stool specimens; other material, even citrate blood after lysis of erythrocytes, did not pose a problem with regard to inhibition of PCR amplification. Eighty-one of the remaining 812 specimens had a positive Mycobacterium culture result. Of these culture-positive specimens, 58 (71.6%) showed a positive result with the Mycobacterium genus-specific probe. Seventy-two samples had a positive result with theMycobacterium-specific probe but a negative culture result. Of these 72 samples, 26 samples were regarded as true positive, either because the M. tuberculosis- or M. avium-specific probe was also positive at the same time or because other specimens from the same patient taken at the same time were culture positive. The sensitivity of theMycobacterium-specific probe was 78.5% and the specificity was 93.5%. This study showed that pretesting of clinical specimens for mycobacteria to the genus level with aMycobacterium-specific probe offers the routine clinical laboratory the possibility of detecting tuberculous and nontuberculous mycobacteria with one test. Furthermore, specimens testing positive with the genus-specific probe can be immediately identified with species-specific probes.

Sign in / Sign up

Export Citation Format

Share Document