scholarly journals An investigation of acid-soluble nuclear proteins of human leucocytes in relation to fraction RP2-L, a component of neoplastic cells

1968 ◽  
Vol 107 (6) ◽  
pp. 799-806 ◽  
Author(s):  
A J MacGillivray ◽  
J. P. P. V. Monjardino
Keyword(s):  
Nuclear Protein ◽  
Tumour Cells ◽  
Nuclear Proteins ◽  
Cell Nuclei ◽  
Histone Protein ◽  
Chromosomal Origin ◽  
Nuclear Extracts ◽  
Mixed Samples ◽  
Specific Nuclear Protein

1. The claim that tumour cells contain a specific nuclear protein was investigated. The presence of this component was confirmed in Walker tumour cells by the chromatography on CM-cellulose of nuclear proteins labelled with [14C]lysine. This protein was studied further in a number of human leucocyte cells. 2. The labelling of leucocyte nuclear proteins with [14C]lysine was attempted during incubation and culture in vitro. Incorporation of the label into acid-soluble nuclear proteins was highest in normal lymphocytes cultured with phytohaemagglutinin, followed by chronic-myeloid-leukaemic leucocytes and mixed samples of normal leucocytes incubated in plasma. Little incorporation was seen in similar extracts of chronic-lymphatic or normal leucocytes. 3. Lymphocytes were the only cells that gave nuclear extracts with amino acid analysis similar to that of unfractionated histones. 4. Little of the [14C]lysine in nuclear extracts of incubated leucocytes proved to be of chromosomal origin. No evidence was found of an RP2-L component in the highly labelled nuclear extracts of phytohaemagglutinin-treated lymphocytes until after 6 days of culture with [14C]lysine. This component was soluble in saline. 5. Evidence is presented that fraction RP2-L is a non-histone protein constituent of cell nuclei whose labelling with [14C]lysine may be dependent on the metabolic state of the cell. Thus this component is not specific to the neoplastic state.

scholarly journals Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins

2005 ◽  
Vol 388 (1) ◽  
pp. 291-297 ◽  
Author(s):  
Christine M. MISQUITTA ◽  
Paromita GHOSH ◽  
James MWANJEWE ◽  
Ashok K. GROVER
Keyword(s):  
Electrophoretic Mobility ◽  
Nuclear Protein ◽  
Left Ventricular ◽  
Nuclear Proteins ◽  
Proximal Fragment ◽  
Mobility Shift ◽  
Cis Acting ◽  
Nuclear Extracts ◽  
Rna Fragments

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3′-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3′-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3′-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5′)ppp(5′)Gm] and polyadenylated (A40) RNA fragments from the 3′-end region (3444–4472) of SERCA2b. The proximal fragment 2B1 (3444–3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521–3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

NeuN, a neuronal specific nuclear protein in vertebrates

Development ◽  
1992 ◽  
Vol 116 (1) ◽  
pp. 201-211 ◽  
Author(s):  
R.J. Mullen ◽  
C.R. Buck ◽  
A.M. Smith
Keyword(s):  
Nervous System ◽  
Nuclear Protein ◽  
Neuronal Cell ◽  
Photoreceptor Cells ◽  
Cell Types ◽  
Brain Cell ◽  
Cell Nuclei ◽  
Neuronal Nuclei ◽  
Specific Nuclear Protein

A battery of monoclonal antibodies (mAbs) against brain cell nuclei has been generated by repeated immunizations. One of these, mAb A60, recognizes a vertebrate nervous system- and neuron-specific nuclear protein that we have named NeuN (Neuronal Nuclei). The expression of NeuN is observed in most neuronal cell types throughout the nervous system of adult mice. However, some major cell types appear devoid of immunoreactivity including cerebellar Purkinje cells, olfactory bulb mitral cells, and retinal photoreceptor cells. NeuN can also be detected in neurons in primary cerebellar cultures and in retinoic acid-stimulated P19 embryonal carcinoma cells. Immunohistochemically detectable NeuN protein first appears at developmental timepoints which correspond with the withdrawal of the neuron from the cell cycle and/or with the initiation of terminal differentiation of the neuron. NeuN is a soluble nuclear protein, appears as 3 bands (46-48 × 10(3) M(r)) on immunoblots, and binds to DNA in vitro. The mAb crossreacts immunohistochemically with nervous tissue from rats, chicks, humans, and salamanders. This mAb and the protein recognized by it serve as an excellent marker for neurons in the central and peripheral nervous systems in both the embryo and adult, and the protein may be important in the determination of neuronal phenotype.

scholarly journals Histone carbonylation in vivo and in vitro

2000 ◽  
Vol 351 (3) ◽  
pp. 769-777 ◽  
Author(s):  
Georg T. WONDRAK ◽  
Daniel CERVANTES-LAUREAN ◽  
Elaine L. JACOBSON ◽  
Myron K. JACOBSON
Keyword(s):  
Histone H1 ◽  
Nuclear Proteins ◽  
Carbonyl Groups ◽  
Cell Nuclei ◽  
Strand Breaks ◽  
Core Histones ◽  
Dna Strand ◽  
And Function

Non-enzymic damage to nuclear proteins has potentially severe consequences for the maintenance of genomic integrity. Introduction of carbonyl groups into histones in vivo and in vitro was assessed by Western blot immunoassay and reductive incorporation of tritium from radiolabelled NaBH4 (sodium borohydride). Histone H1 extracted from bovine thymus, liver and spleen was found to contain significantly elevated amounts of protein-bound carbonyl groups as compared with core histones. The carbonyl content of nuclear proteins of rat pheochromocytoma cells (PC12 cells) was not greatly increased following oxidative stress induced by H2O2, but was significantly increased following alkylating stress induced by N-methyl-N´-nitro-N-nitrosoguanidine or by combined oxidative and alkylating stress. Free ADP-ribose, a reducing sugar generated in the nucleus in proportion to DNA strand breaks, was shown to be a potent histone H1 carbonylating agent in isolated PC12 cell nuclei. Studies of the mechanism of histone H1 modification by ADP-ribose indicate that carbonylation involves formation of a stable acyclic ketoamine. Our results demonstrate preferential histone H1 carbonylation in vivo, with potentially important consequences for chromatin structure and function.

scholarly journals Regulated expression of nuclear protein(s) in myogenic cells that binds to a conserved 3' untranslated region in pro alpha 1 (I) collagen cDNA.

1989 ◽  
Vol 9 (7) ◽  
pp. 2828-2836 ◽  
Author(s):  
T Herget ◽  
M Burba ◽  
M Schmoll ◽  
K Zimmermann ◽  
A Starzinski-Powitz
Keyword(s):  
Untranslated Region ◽  
Nuclear Protein ◽  
Protein S ◽  
Target Sequence ◽  
Conserved Sequence ◽  
L6 Myotubes ◽  
Double Stranded Dna ◽  
Nuclear Extracts ◽  
Collagen Genes

We describe the identification and DNA-binding properties of nuclear proteins from rat L6 myoblasts which recognize an interspecies conserved 3' untranslated segment of pro alpha 1 (I) collagen cDNA. Levels of the two pro alpha 1 (I) collagen RNAs, present in L6 myoblasts, decreased drastically between 54 and 75 h after induction of myotube formation in serum-free medium. Both mRNAs contained a conserved sequence segment of 135 nucleotides (termed tame sequence) in the 3' untranslated region that had 96% homology to the human and murine pro alpha 1 (I) collagen genes. The cDNA of this tame sequence was specifically recognized by nuclear protein(s) from L6 myoblasts, as judged by gel retardation assays and DNase I footprints. The tame-binding protein(s) was able to recognize its target sequence on double-stranded DNA but bound also to the appropriate single-stranded oligonucleotide. Protein that bound to the tame sequence was undetectable in nuclear extracts of L6 myotubes that did not accumulate the two collagen mRNAs. Therefore, the activity of this nuclear protein seems to be linked to accumulation of the sequences that it recognizes in vitro. The collagen RNAs and the nuclear tame-binding proteins reappeared after a change of medium, which further suggests that the RNAs and the protein(s) are coordinately regulated.

scholarly journals Phosphorylation of rat thymus histones, its control and the effects thereon of γ-irradiation

1977 ◽  
Vol 162 (1) ◽  
pp. 171-181 ◽  
Author(s):  
A Fónagy ◽  
M G Ord ◽  
L A Stocken
Keyword(s):  
Nuclear Protein ◽  
The Other ◽  
Phosphate Content ◽  
Γ Irradiation ◽  
Histone Protein ◽  
Histone Proteins ◽  
32P Uptake ◽  
Liver Nuclei

The phosphate content of rat thymus histones was determined. As expected for a replicating tissue, histones 1 and 2B were more phosphorylated and had higher 32P uptakes than did histones from resting liver nuclei; the other histones all showed 32P uptake, but the phosphate content and uptake of histone 2A was about half that for liver histone 2A. When thymus nuclei were incubated in a slightly hypo-osmotic medium, non-histone proteins and phosphorylated histones were released into solution; this was enhanced if ATP was present in the medium. [gamma-32P]ATP was incorporated into non-histone proteins, including protein P1, and into the ADP-ribosylated form of histone 1; negligible 32P was incprporated into the other, bound, histones. Histones 1 and 2B added to the incubation medium were extensively, and histones 2A and 4 slightly, phosphorylated. Histones released by increasing the ionic strength of the medium were phosphorylated. Added lysozyme and cytochrome c were neither bound nor phosphorylated, but added non-histone protein P1 was phosphorylated, causing other histones to be released from the nuclei, especially histones 2A and 3. The released histones were phosphorylated. gamma-Irradiation decreased 32P uptake into the non-ADP-ribosylated histones 1 and 4; phosphorylation of histone 1 in vitro was unaffected. The importance of non-histone proteins, ATP availability and nuclear protein kinases to the control of histone phosphorylation in vivo is discussed.

scholarly journals In vitro transport of a fluorescent nuclear protein and exclusion of non-nuclear proteins.

1986 ◽  
Vol 103 (6) ◽  
pp. 2091-2102 ◽  
Author(s):  
D D Newmeyer ◽  
D R Finlay ◽  
D J Forbes
Keyword(s):  
Low Temperature ◽  
Nuclear Protein ◽  
Transport Model ◽  
Nuclear Transport ◽  
Atp Depletion ◽  
Nuclear Proteins ◽  
Direct Role ◽  
In Vitro System

An in vitro system was developed that provides a quick microscopic assay for nuclear transport. The assay uses an extract of Xenopus eggs, normal or synthetic nuclei, and a fluorescently labeled nuclear protein, nucleoplasmin. This in vitro system accurately mimics in vivo nuclear transport, both in exclusivity and in the amount of accumulation observed (up to 17-fold). Selective accumulation of fluorescent nucleoplasmin is observed microscopically within 30 min with rat liver nuclei, Xenopus embryonic nuclei, regrown Xenopus sperm nuclei, or nuclei reconstituted in vitro from bacteriophage lambda DNA. This transport requires the signal domain of nucleoplasmin. Furthermore, the ability of nuclei to accumulate nucleoplasmin directly correlates with their ability to exclude the fluorescent non-nuclear proteins, FITC-immunoglobulin and phycoerythrin. An active transport model would predict that nuclear transport be temperature- and energy-dependent and that inhibition of transport by either low temperature or energy depletion would be reversible. Both predictions were confirmed in our system. Nucleoplasmin accumulation increases with temperature, while the protein is completely excluded at 0 degrees C. The effects of low temperature are reversible. As found for 125I-labeled nucleoplasmin (Newmeyer, D. D., J. M. Lucocq, T. R. Bürglin, and E. M. De Robertis, 1986, EMBO (Eur. Mol. Biol. Organ.) J., 5:501-510), transport of fluorescent nucleoplasmin is inhibited by ATP depletion. This effect is reversed by later ATP addition. Under ATP-depleted conditions non-nuclear proteins continue to be excluded. These results argue for a direct role of ATP in transport rather than for a simple role in preserving envelope integrity. In a first step towards defining the minimum requirements for a transport medium, egg extracts were depleted of membrane vesicles. Membrane-depleted extracts neither support transport nor maintain the integrity of the nuclear envelope.

scholarly journals Effects of oestradiol-17β and progesterone on total and nuclear-protein synthesis in epithelial and stromal tissues of the mouse uterus, and of progesterone on the ability of these tissues to bind oestradiol-17β

1970 ◽  
Vol 119 (4) ◽  
pp. 773-784 ◽  
Author(s):  
J. A. Smith ◽  
L. Martin ◽  
R. J. B. King ◽  
M. Vértes
Keyword(s):  
Protein Synthesis ◽  
Total Protein ◽  
Nuclear Protein ◽  
Gradient Centrifugation ◽  
Sucrose Density Gradient ◽  
Nuclear Proteins ◽  
Sucrose Density Gradient Centrifugation ◽  
Mouse Uterus

1. A method is described for separating uterine epithelium that is 80% pure and connective-tissue stroma that is 60% pure. This was used to study the effects of steroid hormones on total and nuclear-protein synthesis in these tissues. 2. Oestradiol-17β given alone produces mitoses in the epithelium but not in the stroma. It stimulated incorporation in vitro of [14C]lysine into total protein, histones and acidic nuclear proteins to a greater extent in epithelium than stroma. Incorporation into acidic nuclear proteins was most markedly stimulated, reaching four to six times the normal value 4h after treatment, and then declining rapidly. This peak was only seen in epithelial preparations. 3. After pretreatment with progesterone, oestradiol-17β has the reverse effect, producing mitoses only in stroma. Progesterone alone had no effect on the amounts or rates of incorporation of [14C]lysine into stromal nuclear proteins, but changes after oestradiol-17β treatment were similar to those seen in epithelium with oestradiol-17β alone. In the epithelium, progesterone alone depressed incorporation into histones and acidic nuclear proteins, but did not abolish the subsequent response to oestradiol-17β. With this treatment there was a rapid, large and transient increase in incorporation into epithelial total protein not seen with oestradiol-17β alone. 4. Progesterone had no qualitative effect on the distribution of specific oestrogen-binding proteins, as judged by sucrose-density-gradient centrifugation. However, progesterone treatment increased the uptake in vivo of [6,7-3H]oestradiol-17β by stroma, and it is possible that this is important although the differences were not apparent after labelling in vitro.

Characterization of a HMG2-like protein from Schistosoma mansoni

Parasitology ◽  
1994 ◽  
Vol 108 (1) ◽  
pp. 43-50 ◽  
Author(s):  
M. R. Fantappié ◽  
F. D. Rumjanek
Keyword(s):  
Amino Acid ◽  
Sequence Analysis ◽  
Schistosoma Mansoni ◽  
Cyanogen Bromide ◽  
Nuclear Protein ◽  
Nuclear Proteins ◽  
Carbohydrate Analysis ◽  
Nuclear Extracts ◽  
Low Degree

SUMMARYAn HMG2-like protein was purified from nuclear extracts of adult Schistosoma mansoni. Investigation of the amino acid composition of the schistosome HMG2-like protein showed that glutamic acid, glycine, aspartic acid and lysine were the most abundant. Carbohydrate analysis showed that the HMG2-like protein presented a low degree of glycosylation, galactose or glucose being the major monosaccharide constituent. Incubation of live schistosomes with 32P followed by isolation of nuclear proteins showed that the HMG-2 like protein could be phosphorylated. Partial sequence analysis of cyanogen bromide peptides revealed the occurrence of a phosphorylation consensus motif. The schistosome HMG2-like protein was found to bind preferentially to single-stranded DNA. The results suggest that the major non-histone S. mansoni nuclear protein belongs to the HMG family.

scholarly journals HANP1/H1T2, a Novel Histone H1-Like Protein Involved in Nuclear Formation and Sperm Fertility

2005 ◽  
Vol 25 (16) ◽  
pp. 7107-7119 ◽  
Author(s):  
Hiromitsu Tanaka ◽  
Naoko Iguchi ◽  
Ayako Isotani ◽  
Kouichi Kitamura ◽  
Yoshiro Toyama ◽  
...  
Keyword(s):  
Biochemical Analysis ◽  
Nuclear Protein ◽  
Physiological Role ◽  
Histone H1 ◽  
Vitro Fertilization ◽  
Rich Domain ◽  
And Function ◽  
Specific Nuclear Protein

ABSTRACT We cloned a testis-specific cDNA from mice that encodes a histone H1-like, haploid germ cell-specific nuclear protein designated HANP1/H1T2. The HANP1/H1T2 protein was specifically localized to the nuclei of murine spermatids during differentiation steps 5 to 13 but not to the nuclei of mature sperm. HANP1/H1T2 contains an arginine-serine-rich domain and an ATP/GTP binding site, and it binds to DNA, ATP, and protamine. To investigate the physiological role of HANP1/H1T2, we generated Hanp1/H1T2-disrupted mutant mice. Homozygous Hanp1/H1T2 mutant males were infertile, but females were fertile. Although a substantial number of sperm were recovered from the epididymides, their shape and function were abnormal. During sperm morphogenesis, the formation of nuclei was disturbed and protamine-1 and -2 were only weakly detectable in the nuclei. The chromatin packaging was aberrant, as demonstrated by electron microscopy and biochemical analysis. The mutant sperm exhibited deficient motility and were not competent to fertilize eggs under in vitro fertilization conditions; however, they were capable of fertilizing eggs via intracytoplasmic sperm injection that resulted in the birth of healthy progeny. Thus, we found that HANP1/H1T2 is essential for nuclear formation in functional spermatozoa and is specifically involved in the replacement of histones with protamines during spermiogenesis. At the time of submission of the manuscript, we found an independent publication by Martianov et al. (I. Martianov, S. Brancorsini, R. Catena, A. Gansmuller, N. Kotaja, M. Parvinen, P. Sassone-Corsi, and I. Davidson, Proc. Natl. Acad. Sci. USA 102:2808-2813, 2005) that reported similar results.

scholarly journals The Nuclear Orphan Receptor CAR-Retinoid X Receptor Heterodimer Activates the Phenobarbital-Responsive Enhancer Module of the CYP2B Gene

1998 ◽  
Vol 18 (10) ◽  
pp. 5652-5658 ◽  
Author(s):  
Paavo Honkakoski ◽  
Igor Zelko ◽  
Tatsuya Sueyoshi ◽  
Masahiko Negishi
Keyword(s):  
Binding Sites ◽  
Nuclear Protein ◽  
Retinoid X Receptor ◽  
Orphan Receptor ◽  
Hek293 Cells ◽  
Nuclear Extracts ◽  
Nuclear Orphan Receptor ◽  
Cytochrome P 450 ◽  
Dna Affinity Chromatography

ABSTRACT PBREM, the phenobarbital-responsive enhancer module of the cytochrome P-450 Cyp2b10 gene, contains two potential nuclear receptor binding sites, NR1 and NR2. Consistent with the finding that anti-retinoid X receptor (RXR) could supershift the NR1-nuclear protein complex, DNA affinity chromatography with NR1 oligonucleotides enriched the nuclear orphan receptor RXR from the hepatic nuclear extracts of phenobarbital-treated mice. In addition to RXR, the nuclear orphan receptor CAR was present in the same enriched fraction. In the phenobarbital-treated mice, the binding of both CAR and RXR was rapidly increased before the induction of CYP2B10 mRNA. In vitro-translated CAR bound to NR1, but only in the presence of similarly prepared RXR. PBREM was synergistically activated by transfection of CAR and RXR in HepG2 and HEK293 cells when the NR1 site was functional. A CAR-RXR heterodimer has thus been characterized as atrans-acting factor for the phenobarbital-inducibleCyp2b10 gene.

Sign in / Sign up

Export Citation Format

Share Document