scholarly journals Assessment of sequence variation from SIT1 gene on diatom (Bacillariophyceae) using in silico PCR

2016 ◽  
Author(s):  
Immanuel Sanka ◽  
Niken Satuti Nur Handayani ◽  
Eko Agus Suyono ◽  
Riza Arief Putranto
Keyword(s):  
In Silico ◽  
Sequence Variation ◽  
In Silico Pcr

scholarly journals DETECTION OF VIRULENCE GENES phoP AND phoQ IN Salmonella spp. USING IN SILICO POLYMERASE CHAIN REACTION

2020 ◽  
Vol 4 (1) ◽  
Author(s):  
Stalis Norma Ethica ◽  
Hayatun Fuad ◽  
Nur Hidayah ◽  
Sri Sinto Dewi ◽  
Aditya Rahman Ernanto ◽  
...  
Keyword(s):  
In Silico ◽  
Salmonella Enterica ◽  
Virulence Genes ◽  
Gene Detection ◽  
Chain Reaction ◽  
Salmonella Spp ◽  
Detection Tool ◽  
In Silico Study ◽  
Polymerase Chain ◽  
In Silico Pcr

Detection of Salmonella bacteria based on their virulence genes is among essential steps in the eradication of clinical infection by bacteria. In this study, two pair of primers, PhoPF-PhoPR: 5’- CCGCGCAGGAAAAACTCAAA-3’ and 5’-ATCTGTTCCAGCATCACCGG -3’ as well as PhoQF-PhoQR: 5’-AGAGATGATGCGCGTACTGG-3’ and 5’- CAGACGCCCCATGAGAACAT-3’, had been successfully designed using Primer3Plus to detect the presence of phoP and phoQ genes in Salmonella spp. Using genomic DNA of 44 genomic data of Salmonella spp. as templates, PhoPF-PhoPR could produce 520-bp amplicon, while PhoQF-PhoQR could result in 598-bp amplicon. Results of in silico PCR showed that both pairs of primers PhoPF-PhoPR and PhoQF-PhoQR could detect only Salmonella enterica species, and no Salmonella bongori species could be detected based on phoP and phoQ sequences. Both pairs of PhoPF-PhoPR and PhoQF-PhoQR primers were also able to detect the virulence genes in most of the studied subspecies of Salmonella enterica available in silico database unless Arizona subspecies. As conclusion, based on this in silico study, phoP and phoQ genes appeared to be biomarkers for Salmonella enterica species. Both pairs of primers designed in this study has potential to be used as detection tool to differentiate species Salmonella enterica from Salmonella bongori, and also to distinguish S.enterica subsp. enterica from subsp. Arizonae.Keywords: Gene detection, bacterial virulence, phoP, phoQ, Salmonella spp.

scholarly journals Distribution of Biofilm-associated Genes among Acinetobacter baumannii by in-silico PCR

2021 ◽  
pp. 140-149
Author(s):  
A. Aldrin Joshua ◽  
A. S. Smiline Girija ◽  
P. Sankar Ganesh ◽  
J. Vijayashree Priyadharsini
Keyword(s):  
Acinetobacter Baumannii ◽  
In Silico ◽  
Target Genes ◽  
Multidrug Resistant ◽  
Pcr Analysis ◽  
Evolutionary Analysis ◽  
Ompa Gene ◽  
Clinical Strains ◽  
Tract Infections ◽  
In Silico Pcr

Background: Acinetobacter baumannii is a coccobacillus that is Gram negative, non motile, non fermentative and oxidase negative. It is the most common and successful nosocomial pathogen recognised by WHO. This dreadful pathogen causes urinary tract infections, ventilator associated pneumonia (VAP), bacteremia, etc., These infections are most common in hospital wards especially Intensive Care Unit (ICU). The infections are due to biofilm formation by the virulent genes of A. baumannii, and the common biofilm-associated genes of A. baumannii were bap, csuE, fimH, epsA, bfmS, ptk, pgaB, ompA, blaPER-1. Among these, bap, epsA and ompA genes are highly prevalent among the clinical strains of A. baumannii. Aim:  To detect the three vital biofilm-associated genes of A. baumannii by in-silico PCR analysis. Materials and Methods: 19 isolates of A. baumannii were selected and 3 target genes, namely epsA, ompA and bap gene were used for the amplification process through in-silico PCR simulation tools. Evolutionary analysis was done for the ompA gene. Results: The epsA gene was expressed in 10.52% of the total strains selected with the highest occurrence of ompA gene as 57.89%. bap gene was not observed from the study strains included. From evolutionary analysis based on ompA distributed strains, the Acinetobacter baumannii SDF and Acinetobacter baumannii BJAB0715 might be the parental strains where the evolution of strains would have started. Through successive generations, the Acinetobacter baumannii MDR-ZJ06 and Acinetobacter baumannii TYTH-1 had become the multidrug resistant strains present in the environment. Conclusion: The findings of the study confirms the distribution of epsA and ompA genes among the 19 different strains of A. baumannii. The study suggests periodical monitoring of biofilm based virulence genes among the clinical strains and to curtail the A. baumannii infections.

scholarly journals KASPspoon: an in vitro and in silico PCR analysis tool for high-throughput SNP genotyping

2019 ◽  
Vol 35 (17) ◽  
pp. 3187-3190 ◽  
Author(s):  
Alsamman M Alsamman ◽  
Shafik D Ibrahim ◽  
Aladdin Hamwieh
Keyword(s):  
High Throughput ◽  
In Silico ◽  
Genetic Maps ◽  
Supplementary Information ◽  
Pcr Analysis ◽  
Analysis Tool ◽  
Data Types ◽  
Kasp Assay ◽  
In Silico Pcr

Abstract Motivation Fine mapping becomes a routine trial following quantitative trait loci (QTL) mapping studies to shrink the size of genomic segments underlying causal variants. The availability of whole genome sequences can facilitate the development of high marker density and predict gene content in genomic segments of interest. Correlations between genetic and physical positions of these loci require handling of different experimental genetic data types, and ultimately converting them into positioning markers using a routine and efficient tool. Results To convert classical QTL markers into KASP assay primers, KASPspoon simulates a PCR by running an approximate-match searching analysis on user-entered primer pairs against the provided sequences, and then comparing in vitro and in silico PCR results. KASPspoon reports amplimers close to or adjoining genes/SNPs/simple sequence repeats and those that are shared between in vitro and in silico PCR results to select the most appropriate amplimers for gene discovery. KASPspoon compares physical and genetic maps, and reports the primer set genome coverage for PCR-walking. KASPspoon could be used to design KASP assay primers to convert QTL acquired by classical molecular markers into high-throughput genotyping assays and to provide major SNP resource for the dissection of genotypic and phenotypic variation. In addition to human-readable output files, KASPspoon creates Circos configurations that illustrate different in silico and in vitro results. Availability and implementation Code available under GNU GPL at (http://www.ageri.sci.eg/index.php/facilities-services/ageri-softwares/kaspspoon). Supplementary information Supplementary data are available at Bioinformatics online.

In Silico PCR Primer Designing and Validation

2015 ◽  
pp. 143-151 ◽  
Author(s):  
Anil Kumar ◽  
Nikita Chordia
Keyword(s):  
In Silico ◽  
In Silico Pcr ◽  
Pcr Primer

scholarly journals Detection of Drug Resistant Genes among A. baumannii by In silico PCR Method

2021 ◽  
pp. 242-253
Author(s):  
A. Roshan ◽  
A. S. Smiline Girija ◽  
P. Sankar Ganesh ◽  
J. Vijayashree Priyadharshini
Keyword(s):  
Multidrug Resistance ◽  
Resistance Genes ◽  
In Silico ◽  
Pcr Amplification ◽  
Opportunistic Pathogen ◽  
World Health ◽  
Drug Resistant ◽  
Resistant Genes ◽  
In Silico Pcr ◽  
Multidrug Resistance Genes

Background: Acinetobacter baumannii is a gram-negative bacterium classified as an opportunistic pathogen in humans by the World Health Organization. Different genetic determinants contribute to multidrug resistance, and transform it as a nosocomial pathogen. Aim: Using in-silico PCR, this analysis aims to characterize the 13 distinct drug resistant genes found in 19 virulent A.baumannii strains. Materials & Methods: There were 11 A.baumannii multidrug resistance genes chosen. In-silico PCR amplification was performed using forward and reverse primers from the 11 genes described in previous research. The amplicon bands were detected in 19 strains of A.baumannii that were set as default on the server. Results: Among the 13 multidrug resistance genes studied, tet A, tet B, Sul 1, Sul 2, DfrA1,  ISAba-1 and ISAba-125 were detected among the 19 virulent strains of ​A.baumannii​. Conclusion: The findings of the study documents the frequency of tet A, tet B, Sul 1, Sul 2, DfrA1, ISAba-1 and ISAba-125 like from the selected strains of A. baumannii. However, more experimental validation is needed in order to conduct routine surveillance on drug-resistant A. baumannii strains in hospital settings.

scholarly journals Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

2020 ◽  
Vol 15 (1) ◽  
pp. 31
Author(s):  
Stalis Norma Ethica ◽  
Sri Darmawati ◽  
Sri Sinto Dewi ◽  
Nurrahman Nurrahman ◽  
Ayu Rahmawati Sulistyaningtyas
Keyword(s):  
In Silico ◽  
Genomic Dna ◽  
Bacterial Species ◽  
Disease Outbreaks ◽  
Polymerase Chain Reaction Analysis ◽  
Streptococcus Iniae ◽  
Fish Pathogen ◽  
Marine Aquaculture ◽  
Pcr Products ◽  
In Silico Pcr

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.

Comparative Evaluation of Genomic and Laboratory Approaches for Determination of Shiga Toxin Subtypes in Escherichia coli

2016 ◽  
Vol 79 (12) ◽  
pp. 2078-2085 ◽  
Author(s):  
CATHERINE D. CARRILLO ◽  
ADAM G. KOZIOL ◽  
AMIT MATHEWS ◽  
NORIKO GOJI ◽  
DOMINIC LAMBERT ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Genome Sequence ◽  
Shiga Toxin ◽  
In Silico ◽  
Whole Genome Sequence ◽  
Whole Genome ◽  
Pcr Method ◽  
In Silico Pcr

ABSTRACT The determination of Shiga toxin (ST) subtypes can be an important element in the risk characterization of foodborne ST-producing Escherichia coli (STEC) isolates for making risk management decisions. ST subtyping methods include PCR techniques based on electrophoretic or pyrosequencing analysis of amplicons and in silico techniques based on whole genome sequence analysis using algorithms that can be readily incorporated into bioinformatics analysis pipelines for characterization of isolates by their genetic composition. The choice of technique will depend on the performance characteristics of the method and an individual laboratory's access to specialized equipment or personnel. We developed two whole genome sequence–based ST subtyping tools: (i) an in silico PCR algorithm requiring genome assembly to replicate a reference PCR-based method developed by the Statens Serum Institut (SSI) and (ii) an assembly-independent routine in which raw sequencing results are mapped to a database of known ST subtype sequence variants (V-Typer). These tools were evaluated alongside the SSI reference PCR method and a recently described PCR-based pyrosequencing technique. The V-Typer method results corresponded closely with the reference method in the analysis of 67 STEC cultures obtained from a World Health Organization National Reference Laboratory. In contrast, the in silico PCR method failed to detect ST subtypes in several cases, a result which we attribute to assembly-induced errors typically encountered with repetitive gene sequences. The V-Typer can be readily integrated into bioinformatics protocols used in the identification and characterization of foodborne STEC isolates.

scholarly journals PUNS: transcriptomic- and genomic-in silico PCR for enhanced primer design

2004 ◽  
Vol 20 (15) ◽  
pp. 2399-2400 ◽  
Author(s):  
P. C. Boutros ◽  
A. B. Okey
Keyword(s):  
In Silico ◽  
Primer Design ◽  
In Silico Pcr
Sign in / Sign up

Export Citation Format

Share Document