scholarly journals DETECTION OF VIRULENCE GENES phoP AND phoQ IN Salmonella spp. USING IN SILICO POLYMERASE CHAIN REACTION

2020 ◽  
Vol 4 (1) ◽  
Author(s):  
Stalis Norma Ethica ◽  
Hayatun Fuad ◽  
Nur Hidayah ◽  
Sri Sinto Dewi ◽  
Aditya Rahman Ernanto ◽  
...  
Keyword(s):  
In Silico ◽  
Salmonella Enterica ◽  
Virulence Genes ◽  
Gene Detection ◽  
Chain Reaction ◽  
Salmonella Spp ◽  
Detection Tool ◽  
In Silico Study ◽  
Polymerase Chain ◽  
In Silico Pcr

Detection of Salmonella bacteria based on their virulence genes is among essential steps in the eradication of clinical infection by bacteria. In this study, two pair of primers, PhoPF-PhoPR: 5’- CCGCGCAGGAAAAACTCAAA-3’ and 5’-ATCTGTTCCAGCATCACCGG -3’ as well as PhoQF-PhoQR: 5’-AGAGATGATGCGCGTACTGG-3’ and 5’- CAGACGCCCCATGAGAACAT-3’, had been successfully designed using Primer3Plus to detect the presence of phoP and phoQ genes in Salmonella spp. Using genomic DNA of 44 genomic data of Salmonella spp. as templates, PhoPF-PhoPR could produce 520-bp amplicon, while PhoQF-PhoQR could result in 598-bp amplicon. Results of in silico PCR showed that both pairs of primers PhoPF-PhoPR and PhoQF-PhoQR could detect only Salmonella enterica species, and no Salmonella bongori species could be detected based on phoP and phoQ sequences. Both pairs of PhoPF-PhoPR and PhoQF-PhoQR primers were also able to detect the virulence genes in most of the studied subspecies of Salmonella enterica available in silico database unless Arizona subspecies. As conclusion, based on this in silico study, phoP and phoQ genes appeared to be biomarkers for Salmonella enterica species. Both pairs of primers designed in this study has potential to be used as detection tool to differentiate species Salmonella enterica from Salmonella bongori, and also to distinguish S.enterica subsp. enterica from subsp. Arizonae.Keywords: Gene detection, bacterial virulence, phoP, phoQ, Salmonella spp.

scholarly journals Salmonella enterica in semi-aquatic turtles in Colombia

2011 ◽  
Vol 5 (05) ◽  
pp. 361-364 ◽  
Author(s):  
Miryan Margot Sánchez-Jiménez ◽  
Paula Andrea Rincón-Ruiz ◽  
Sara Duque ◽  
María Adelaida Giraldo ◽  
Diber Marcela Ramírez-Monroy ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Salmonella Enterica ◽  
Chain Reaction ◽  
Salmonella Spp ◽  
Wildlife Protection ◽  
Polymerase Chain

Introduction: Turtles can be hosts of Salmonella enterica serovars which can cause disease both in the animals themselves and in people they come into contact with, especially when the turtles are kept as pets. To investigate the prevalence of Salmonella in turtles in Colombia, we studied animals at a wildlife protection centre. The turtles had either been confiscated or donated to the centre. Methodology: Detection of Salmonella spp. was conducted in feces samples using bacteriological cultures and polymerase chain reaction to identify genus and serovar.  Results: By PCR and culture, 30/110 samples (27%) were positive while by PCR alone eight further samples were positive (total of 38/110 (35%) positive). The most common serovar was S. Enteritidis (26/38 (68%) with only one isolate being S. Typhimurium (3%).  Four (11%) samples were positive for both serovars and seven (18%) could only be identified as Salmonella enterica spp. Conclusions: These results show that turtles in Colombia are commonly infected with Salmonella and are a risk for infection to people who come into contact with them.

Molecular Analysis of Uropathogenic E.coli Isolates from Urinary Tract Infections

2019 ◽  
Vol 19 (3) ◽  
pp. 322-326 ◽  
Author(s):  
Hassan Valadbeigi ◽  
Elham Esmaeeli ◽  
Sobhan Ghafourian ◽  
Abbas Maleki ◽  
Nourkhoda Sadeghifard
Keyword(s):  
Escherichia Coli ◽  
Polymerase Chain Reaction ◽  
Urinary Tract ◽  
Urinary Tract Infections ◽  
Multiplex Polymerase Chain Reaction ◽  
Virulence Genes ◽  
Uropathogenic Escherichia Coli ◽  
Chain Reaction ◽  
Polymerase Chain ◽  
Tract Infections

Introduction: The aim of the current study was to investigate the prevalence of virulence genes in uropathogenic Escherichia coli (UPEC) isolates in Ilam. Materials and Methods: For this purpose, a total of 80 UPEC isolates were collected for patients with UTIs during a 6 months period. The multiplex polymerase chain reaction (multiplex PCR) was used to detect the papEF, fimH, iucD, hlyA, fyuA, and ompT genes. Results: The prevalence of fimH, papEF, iucD, fyuA, hlyA, hlyA, and ompT genes were 87.5%, 47.5%, 60%, 67.5%, 27.5%, 47.5% and 71.2%, respectively. Among all of the isolates, 27 profiles were obtained. Conclusion: Our findings demonstrated that the most prevalence was found for fimH, and different distribution of virulence genes suggested different ability of pathogenicity.

scholarly journals Virulence and Antimicrobial Resistance Profiles of Salmonella enterica Serovars Isolated from Chicken at Wet Markets in Dhaka, Bangladesh

2021 ◽  
Vol 9 (5) ◽  
pp. 952
Author(s):  
Nure Alam Siddiky ◽  
Md Samun Sarker ◽  
Md. Shahidur Rahman Khan ◽  
Ruhena Begum ◽  
Md. Ehsanul Kabir ◽  
...  
Keyword(s):  
Antimicrobial Resistance ◽  
Salmonella Enterica ◽  
Virulence Genes ◽  
Health Concern ◽  
Production Cycle ◽  
Salmonella Spp ◽  
Native Chicken ◽  
Resistance Patterns ◽  
Research Findings ◽  
Native Chickens

Virulent and multi drug resistant (MDR) Salmonellaenterica is a foremost cause of foodborne diseases and had serious public health concern globally. The present study was undertaken to identify the pathogenicity and antimicrobial resistance (AMR) profiles of Salmonellaenterica serovars recovered from chicken at wet markets in Dhaka, Bangladesh. A total of 870 cecal contents of broiler, sonali, and native chickens were collected from 29 wet markets. The overall prevalence of S. Typhimurium, S. Enteritidis, and untyped Salmonella spp., were found to be 3.67%, 0.57%, and 1.95% respectively. All isolates were screened by polymerase chain reaction (PCR) for eight virulence genes, namely invA, agfA, IpfA, hilA, sivH, sefA, sopE, and spvC. S. Enteritidis isolates carried all virulence genes whilst S. Typhimurium isolates carried six virulence genes except sefA and spvC. A diverse phenotypic and genotypic AMR pattern was found. Harmonic descending trends of resistance patterns were observed among the broiler, sonali, and native chickens. Interestingly, virulent and MDR Salmonella enterica serovars were found in native chicken, although antimicrobials were not used in their production cycle. The research findings anticipate that virulent and MDR Salmonella enterica are roaming in the wet markets which can easily anchor to the vendor, consumers, and in the food chain.

scholarly journals Multidrug Antimicrobial Resistance and Molecular Detection of mcr-1 Gene in Salmonella Species Isolated from Chicken

Animals ◽  
2021 ◽  
Vol 11 (1) ◽  
pp. 206
Author(s):  
Md Bashir Uddin ◽  
S.M. Bayejed Hossain ◽  
Mahmudul Hasan ◽  
Mohammad Nurul Alam ◽  
Mita Debnath ◽  
...  
Keyword(s):  
Functional Analysis ◽  
Antimicrobial Resistance ◽  
In Silico ◽  
Salmonella Enterica ◽  
Molecular Mechanisms ◽  
Antimicrobial Agents ◽  
Genetic Relationships ◽  
Evolutionary Relationship ◽  
Salmonella Spp ◽  
Gram Negative

Colistin (polymyxin E) is widely used in animal and human medicine and is increasingly used as one of the last-resort antibiotics against Gram-negative bacilli. Due to the increased use of colistin in treating infections caused by multidrug-resistant Gram-negative bacteria, resistance to this antibiotic ought to be monitored. The study was undertaken to elucidate the molecular mechanisms, genetic relationships and phenotype correlations of colistin-resistant isolates. Here, we report the detection of the mcr-1 gene in chicken-associated Salmonella isolates in Bangladesh and its in-silico functional analysis. Out of 100 samples, 82 Salmonella spp. were isolated from chicken specimens (liver, intestine). Phenotypic disc diffusion and minimum inhibitory concentration (MIC) assay using different antimicrobial agents were performed. Salmonella isolates were characterized using PCR methods targeting genus-specific invA and mcr-1 genes with validation for the functional analysis. The majority of the tested Salmonella isolates were found resistant to colistin (92.68%), ciprofloxacin (73.17%), tigecycline (62.20%) and trimethoprim/sulfamethoxazole (60.98%). When screened using PCR, five out of ten Salmonella isolates were found to carry the mcr-1 gene. One isolate was confirmed for Salmonella enterica subsp. enterica serovar Enteritidis, and other four isolates were confirmed for Salmonella enterica subsp. enterica serovar Typhimurium. Sequencing and phylogenetic analysis revealed a divergent evolutionary relationship between the catalytic domain of Neisseria meningitidis lipooligosaccharide phosphoethanolamine transferase A (LptA) and MCR proteins, rendering them resistant to colistin. Three-dimensional homology structural analysis of MCR-1 proteins and molecular docking interactions suggested that MCR-1 and LptA share a similar substrate binding cavity, which could be validated for the functional analysis. The comprehensive molecular and in-silico analyses of the colistin resistance mcr-1 gene of Salmonella spp. of chicken origin in the present study highlight the importance of continued monitoring and surveillance for antimicrobial resistance among pathogens in food chain animals.

scholarly journals Adenovirus 12 E1A gene detection by polymerase chain reaction in both the normal and coeliac duodenum.

Gut ◽  
1994 ◽  
Vol 35 (9) ◽  
pp. 1226-1232 ◽  
Author(s):  
M Lawler ◽  
P Humphries ◽  
C O'Farrelly ◽  
H Hoey ◽  
O Sheils ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Gene Detection ◽  
Chain Reaction ◽  
Polymerase Chain ◽  
E1a Gene

Polymerase Chain Reaction Detection of Salmonella spp. in Fecal Samples of Pet Birds

2008 ◽  
Vol 3 (1) ◽  
pp. e29-e29
Author(s):  
B. Sareyyüpoğlu ◽  
A Çelik Ok ◽  
Z. Cantekin ◽  
H. Yardimci ◽  
M. Akan ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Polymerase Chain Reaction Detection ◽  
Chain Reaction ◽  
Salmonella Spp ◽  
Fecal Samples ◽  
Pet Birds ◽  
Polymerase Chain

scholarly journals Carbapenemase Production and Epidemiological Characteristics of Carbapenem-Resistant Klebsiella pneumoniae in Western Chongqing, China

2022 ◽  
Vol 11 ◽  
Author(s):  
Wan Huang ◽  
Jisheng Zhang ◽  
Lingyi Zeng ◽  
Chengru Yang ◽  
Lining Yin ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Klebsiella Pneumoniae ◽  
Virulence Genes ◽  
Resistance Rate ◽  
Molecular Characteristics ◽  
Chain Reaction ◽  
Detection Rates ◽  
Carbapenem Resistant ◽  
Polymerase Chain ◽  
Epidemiological Characteristics

BackgroundThis study aimed to determine the molecular characteristics of carbapenem-resistant Klebsiella pneumoniae (CRKP) isolates in a hospital in western Chongqing, southwestern China.MethodsA total of 127 unique CRKP isolates were collected from the Yongchuan Hospital of Chongqing Medical University, identified using a VITEK-2 compact system, and subjected to microbroth dilution to determine the minimal inhibitory concentration. Enterobacteriaceae intergenic repeat consensus polymerase chain reaction and multilocus sequence typing were used to analyze the homology among the isolates. Genetic information, including resistance and virulence genes, was assessed using polymerase chain reaction. The genomic features of the CRKP carrying gene blaKPC-2 were detected using whole-genome sequencing.ResultsST11 was the dominant sequence type in the homology comparison. The resistance rate to ceftazidime-avibactam in children was much higher than that in adults as was the detection rate of the resistance gene blaNDM (p < 0.0001). Virulence genes such as mrkD (97.6%), uge (96.9%), kpn (96.9%), and fim-H (84.3%) had high detection rates. IncF (57.5%) was the major replicon plasmid detected, and sequencing showed that the CRKP063 genome contained two plasmids. The plasmid carrying blaKPC-2, which mediates carbapenem resistance, was located on the 359,625 base pair plasmid IncFII, together with virulence factors, plasmid replication protein (rep B), stabilizing protein (par A), and type IV secretion system (T4SS) proteins that mediate plasmid conjugation transfer.ConclusionOur study aids in understanding the prevalence of CRKP in this hospital and the significant differences between children and adults, thus providing new ideas for clinical empirical use of antibiotics.

scholarly journals Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk

2021 ◽  
Vol 8 (3) ◽  
pp. 316
Author(s):  
Taufik Muhammad Fakih ◽  
Salsabilla Wijaya ◽  
Sani Ega Priani
Keyword(s):  
Polymerase Chain Reaction ◽  
In Silico ◽  
Sus Scrofa ◽  
12S Rrna ◽  
Chain Reaction ◽  
Polymerase Chain

Beberapa produk seperti obat, makanan, dan kosmetika khususnya kolagen dapat berpotensi mengandung turunan babi sehingga diperlukan adanya analisis kehalalan. . Polymerase Chain Reaction (PCR) merupakan metode yang dapat digunakan untuk melakukan analisis sampel secara molekuler. Tujuan dari penelitian ini adalah mendesain kandidat primer dari gen 12S rRNA babi secara in silico. . Metode yang digunakan adalah penelusuran data gen 12S rRNA melalui situs National Center for Biotechnology Information (NCBI), kemudian sekuen gen 12S rRNA dianalisis menggunakan server web Integrated DNA Technologies (IDT) dan MFEprimer-3.1 untuk dilakukan pemilihan kandidat primer terbaik. Kandidat primer terpilih kemudian diidentifikasi menggunakan server web SnapGene Viewer untuk mengamati kemampuan penempelan kandidat primer pada sekuen target. Pada tahap terakhir dilakukan evaluasi kandidat primer menggunakan server web OligoAnalyzer™ Tool agar diperoleh pasangan kandidat primer terbaik yang memenuhi kriteria primer yang baik. Kandidat primer yang terbaik adalah primer forward rRNA-5 (5’ GTACTACTCGCAACTGCCTAAA 3’) dan primer reverse rRNA-6 (5’GCAAGGGTTGGTAAGGTCTATC 3’) karena memenuhi persyaratan primer ideal. . Dengan demikian, kandidat primer tersebut dapat digunakan untuk karakterisasi sampel secara in vitro menggunakan teknik PCR.

scholarly journals In silico Analysis of Phylogeny and Virulence Genes in STEC Strains Associated with Outbreaks

2021 ◽  
Author(s):  
Mehmet Demirci ◽  
Akın Yiğin ◽  
Fadile Yıldız Zeyrek
Keyword(s):  
Foodborne Pathogens ◽  
In Silico ◽  
Virulence Genes ◽  
Genomic Analysis ◽  
In Silico Analysis ◽  
Comparative Genomic ◽  
Phylogeny Analysis ◽  
In Silico Study ◽  
The World ◽  
Different Parts

Objective: Shiga toxin-producing E. coli (STEC) strains are important foodborne pathogens. Significant outbreaks with STEC strains can be encountered, even if the geography, time or resources were different. The aim of our in silico study was to compare the virulance factors and phylogeny of STEC strains such as EDL933 and Sakai, which have been identified as an agent in important outbreaks in different parts of the world and whole genomic data were in open databases. Method: Genomic NCBI data of eight strains were included in our study, including seven different STEC strains associated with significant epidemics in different parts of the world, and one supershedder strain obtained from cattle feces. Results: According to phylogeny analysis, the most similar strain to EDL933 strain was TW14588, with 96.4% similarity. The most distant similarity was Sakai strains with 79.2%. According to the virulence genes analysis; the presence of 333 genes that constitute virulence factors under nine headings were detected. In the first STEC origin, EDL933, 45% of all virulence genes were found to be active. Adherence genes such as Ecp, Elf, Hcp and toxin genes such as clyA were active in all strains except stx genes. Conclusion: In our in silico study of comparative genomic analysis of STEC strains which are associated with outbreaks, it was determined that STEC strains used different virulence genes besides the stx gene. Indeed, they used certain virulence genes, even their sources, time and locations were different, in the pathogenesis

Sign in / Sign up

Export Citation Format

Share Document